2023 생화학 기말시험 문제모음집 - 추가 PDF

퀴즈 9주차 1) Sugars are compounds copentaining an _______ or _______ group and two or more hydroxyl groups. ① aldehyde, ketone ② aldehyde, phosphate ③ base, ketone ④ base, phosphate 2) Monosaccharides generally contain several _______ carbons and therefore exist in a variety of stereoisome...

퀴즈 9주차 1) Sugars are compounds copentaining an _______ or _______ group and two or more hydroxyl groups. ① aldehyde, ketone ② aldehyde, phosphate ③ base, ketone ④ base, phosphate 2) Monosaccharides generally contain several _______ carbons and therefore exist in a variety of stereoisomers. ① achiral ② chiral ③ acyclic ④ cyclic 3) Cyclization of monosaccharides: ① is the reaction of hemiketal or hemiacetal formation ② is irreversible ③ creates α and β epimers ④ only occurs in hexoses 4) Oligosaccharides are short polymers of several monosaccharide joined by _______ bonds. ① peptide ② hydrogen ③ ionic ④ glycosidic 1) Polysaccharides: ① do not fold into three-dimensional structures ② are glycans ③ must be homopolysaccharides ④ are never branched 2) Cellulose is a ________ homopolysaccharide of _________: ① linear, fructose ② linear, glucose ③ branched, fructose ④ branched, glucose 3) The difference between glycogen and amylopectin is: ① the monosaccharides found in each ② the types of glycosidic linkages found in each ③ that amylopectin is found in animals, whereas glycogen is a form of starch ④ how often each branches 4) Which characteristic is NOT one that is true of glycosaminoglycans? ① found in extracellular matrix ② always contain sulfates ③ are heteropolysaccharides ④ are disaccharide repeat units 10주차 1) Proteoglycans are glycoconjugates in which one or more large _____ are covalently attached to a core protein. ① glycans ② proteins ③ DNA ④ RNA 2) Glycoproteins contain oligosaccharides covalently linked to Asn or _______Ser/Thr residues. ① Asp ② Gly ③ Phe ④ Ser/Thr 3) Lectins are proteins with highly specific _______-binding domains. ① DNA ② RNA ③ protein ④ carbohydrate 4) Bacterial and viral pathogens adhere to their host cell targets through bind of _______ in the pathogens to oligosaccharides on the target cell surface. ① DNA ② RNA ③ lectins ④ carbohydrates 1) Which of the following is NOT part of a deoxyribonucleotide? ① deoxyribose ② phosphate ③ a nitrogenous base ④ ribose 2) In polynucleotides, covalent bonds are formed via _______ linkages. ① cytosine ② uracil ③ adenosine ④ phosphodiester. 3) _______ is found only in DNA. ① Cytosine ② Adenine ③ Guanine ④ Thymine 4) In nucleotides, the pentose ring is attached to the nitrogenous base via a _______ bond. ① N-glycosidic ② O-glycosidic ③ hydrogen ④ ionic 11주차 1) The self-complementarity within each strand confers the potential to form _______ or _______ structures. ① hairpin, cruciform ② hairpin, B-form ③ palindrome, cruciform ④ palindrome, B-form 2) The process of separating strands of a DNA double helix is known as: ① separation ② denaturation ③ annealing ④ replication 3) The temperature at the mid-point of the transition is the melting point: ① Km ② kcat ③ tm ④ Kcat / Km 4) Several nucleotide bases undergo spontaneous loss of their amino group: ① deamination ② methylation ③ dimer formation ④ denaturation 1) In its simplest form, polymerase chain reaction: ① is remarkably insensitive to contamination ② requires reverse transcriptase ③ requires two oligonucleotide primers ④ requires a minimum of 10,000 copies of the DNA to be amplified 2) Which nucleoside is the one MOST commonly found as part of coenzymes? ① adenosine ② guanosine ③ cytosine ④ inosine 3) _______ is the central carrier of chemical energy in cells. ① ATP ② GTP ③ TTP ④ CTP 4) ATP and ADP serve as _______ in a variety of signaling pathways. ① enzymes ② precursors ③ neurotransimitters ④ inhibitors 12주차 1) Which general procedure is NOT used in the cloning of DNA? ① joining two DNA fragments covalently ② selecting a small molecule of DNA capable of autonomous replication ③ determining the function of the protein coded for by the DNA ④ obtaining the DNA segment to be cloned 2) Restriction endonucleases: ① recognize and cleave DNA at specific sequences ② restrict the choice of host organisms for cloned DNA sequences ③ always produce sticky ends ④ include the subclass known as DNA ligases 3) Which statement regarding cloning vectors is FALSE? ① They can sometimes be artificial chromosomes, both yeast and bacterial ② They usually have selectable and/or screenable markers ③ They are sometimes plasmids, small circular DNA molecules lacking an ori sequence ④ They often contain polylinker sequences 4) Expression vectors: ① are only used in bacteria and yeast ② can allow for production of fusion proteins ③ are created by oligonucleotide-directed mutagenesis ④ require a promoter if used in yeast but not in bacteria 1) Specific amino acids may be replaced individually by _______ mutagenesis. ① site-directed ② unspecific ③ random ④ spontaneous 2) Which statement regarding the use of PCR FALSE? ① It can be used to attach a glutathione tag to a protein of interest ② It can be used to introduce mutations in a DNA sequence of interest ③ It can be used to determine relative expression levels of genes under different conditions ④ It can introduce restriction endonuclease sites at the ends of the DNA sequence of interest 3) Terminal tags provide handles for _______ purification. ① ion ② hydrogen bond ③ glycosidic bond ④ affinity 4) GFP is derived from _______. ① E. coli ② C. elegans ③ jellyfish ④ yeast 13주차 1) Which of the following is NOT a mechanisms for studying proteins in cells? ① green fluorescent protein ② epitope tags ③ synteny analysis ④ two-hybrid analysis 2) DNA microarrays allow the rapid and simultaneous _____ of many thousands of genes. ① cloning ② screening ③ mutation ④ expression 3) The CRISPR/Cas system: ① involves the non-homologous end joining DNA repair system ② usually, but not always, requires the use of an RNA ③ uses caspase enzymes ④ can be used for creating specific mutations in genomic DNA 4) The human genome contains: ① about 30% exons ② transposons ③ about 100,000 genes ④ circular chromosomes 1) Fatty acids: ① are highly oxidized storage forms of hydrocarbons ② are referred to as “saturated” if they have one or more C–C double bonds ③ are usually (but not always) unbranched ④ by definition, never exceed 20 carbons in length 2) Which statement regarding linoleic acid (18:2D9,12) is FALSE? ① It has 20 carbons ② It has two double bonds ③ It has one carboxylic acid functional group ④ It has a C–C double bond between carbons 9 and 10 3) Triacylglycerols: ① consist of glycerol and three identical fatty acids ② consist of glycerol and three different fatty acids ③ always have at least one fatty acid with a trans double bond ④ are a major energy storage form 4) Which statement is FALSE? ① The number of C–C double bonds in a fatty acid affects its melting point ② Triacylglycerols are polar due to their ester functional groups ③ Wax esters contain long chain fatty acids and long chain alcohols ④ Naturally occurring fatty acids usually have an even number of carbons 14주차 1) Membrane lipids do NOT include: ① triacylglycerols ② glycerophospholipids ③ sphingolipids ④ glycolipids 2) _____ is/are a parent compound(s) of structural membrane lipids. ① Ceramides ② Sphingomyelins ③ Glycerol-3-phosphate ④ Phospholipases 3) _____ is a major component of eukaryotic cell membranes ① Ceramide ② Sphingomyelin ③ Phosphatidylcholine ④ Phospholipase 4) _____ is a major component of chloroplast membranes ① MDGD ② Sphingomyelin ③ Phosphatidylcholine ④ Phospholipase 5) Phospholipids are degraded by _______. ① cholesterol ② sphingomyelins ③ glycerol-3-phosphate ④ phospholipases 6) _____ and related sterols are present in the membranes of most eukaryotic cells, which modulate fluidity and permeability. ① Cholesterol ② Sphingomyelins ③ Glycerol-3-phosphate 7) Enzymatic oxidation of _______ yields: prostaglandins, thromboxanes, leukotrienes ① cholesterol ② sphingomyelins ③ glycerol-3-phosphate ④ arachidonic acid 8) Steroid hormones are oxidized derivatives of _______. ① vitamin ② sphingomyelins ③ glycerol-3-phosphate ④ sterols ----------------------------------------------------------------퀴즐렛-------------------------------------------------------- Chapter 7 *Aspartame is an artificial non-saccharide sweetener 200배 than sucrose. (trade name: Nutrasweet, Equal, Canderal) To possess optical activity, a compound must be: A) a carbohydrate. B) a hexose. C) asymmetric. D) colored. E) D-glucose. Which of the following monosaccharides is NOT an aldose? A) erythrose B) fructose C) glucose D) glyceraldehyde E) ribose The reference compound for naming D and L isomers of sugars is: A) fructose. B) glucose. C) glyceraldehyde. D) ribose. E) sucrose. When two carbohydrates are epimers: A) one is a pyranose, the other a furanose. B) one is an aldose, the other a ketose. C) they differ in length by one carbon. D) they differ only in the configuration around one carbon atom. E) they rotate plane-polarized light in the same direction. Which pair is epimeric? A) D-glucose and D-glucosamine B) D-glucose and D-mannose C) D-glucose and L-glucose D) D-lactose and D-sucrose E) L-mannose and L-fructose Which pair is anomeric? A) D-glucose and D-fructose B) D-glucose and L-fructose C) D-glucose and L-glucose D) α-D-glucose and β-D-glucose E) α-D-glucose and β-L-glucose When the linear form of glucose cyclizes, the product is a(n): A) anhydride. B) glycoside. C) hemiacetal. D) lactone. E) oligosaccharide. Which pair is interconverted in the process of mutarotation? A) D-glucose and D-fructose B) D-glucose and D-galactose C) D-glucose and D-glucosamine D) D-glucose and L-glucose E) α-D-glucose and β-D-glucose Which compound is NOT a reducing sugar? A) fructose B) glucose C) glyceraldehyde D) ribose E) sucrose **Sucrose and Trehalose은 nonreducing sugars. Lactose는 reducing sugar. Which monosaccharides is NOT a carboxylic acid? A) 6-phospho-gluconate B) gluconate C) glucose D) glucuronate E) muramic acid When forming the disaccharide maltose from two glucose monosaccharides: A) water is eliminated. B) a hemiacetal is converted to an acetal. C) the resulting dissacharide is no longer a reducing sugar. D) water is eliminated and a hemiacetal is converted to an acetal. E) None of the answers is correct. From the abbreviated name of the compound Gal(β1→α 4)Glc, we know that: A) C-4 of glucose is joined to C-1 of galactose by a glycosidic bond. B) the compound is a D-enantiomer. C) the galactose residue is at the reducing end. D) the glucose is in its pyranose form. E) the glucose residue is the β anomer. Starch and glycogen are both polymers of: A) fructose. B) glucose1-phosphate. C) sucrose. D) α-D-glucose. E) β-D-glucose. Which statement about starch and glycogen is FALSE? A) Amylose is unbranched; amylopectin and glycogen contain many (α1 ---> 6) branches. B) Both are homopolymers of glucose. C) Both serve primarily as structural elements in cell walls. D) Both starch and glycogen are stored intracellularly as insoluble granules. E) Glycogen is more extensively branched than starch. Which statement about hydrogen bonding in glycogen and cellulose is TRUE? A) Glycogen forms more internal H-bonds than cellulose. B) Extensive internal hydrogen bonding makes cellulose more water soluble than glycogen. C) Extensive hydrogen bonding with water makes cellulose more soluble than glycogen. D) Glycogen primarily forms hydrogen bonds within a single chain. E) The hydrogen bonding in cellulose favors a helical conformation. *cellulose 가 glycogen 보다 more insoluble함. ( 많은 수소결합 ) Following complete hydrolysis of a sample of glycogen and a sample of cellulose, which statement must be TRUE? A) The glycogen sample is more soluble than the cellulose sample. B) The cellulose sample is more soluble than the glycogen sample. C) Both samples consist of a mixture of α-D-glucose and β-D-glucose. D) The glycogen sample has a higher ratio of α-D-glucose than the cellulose sample. E) The cellulose sample contains only β-D-glucose. ** (E) 는 왜틀린지? Which compound is a heteropolysaccharide? A) cellulose B) chitin C) glycogen D) hyaluronate E) starch The basic structure of a proteoglycan consists of a core protein and a: A) glycolipid. B) glycosaminoglycan. C) lectin. D) lipopolysaccharide. E) peptidoglycan. Which statement about heparan sulfate is NOT true? A) Sulfation of heparan sulfate to form NS domains is important for its role as an anticoagulant. B) Heparan sulfate can promote protein-protein interactions via the NS domains. C) The secondary structure of heparan sulfate is completely random. D) The NA domains of heparan sulfate contain no sulfation. E) The core repeating structure of heparan sulfate is made up of alternating GlcNAc and GlcA. In glycoproteins, the carbohydrate moiety is always attached through the amino acid residues: A) asparagine, serine, or threonine. B) aspartate or glutamate. C) glutamine or arginine. D) glycine, alanine, or aspartate. E) tryptophan, aspartate, or cysteine. Which compound(s) is/are a dominant feature of the outer membrane of the cell wall of gram-negative bacteria? A) amylose B) cellulose C) glycoproteins D) lipopolysaccharides E) lipoproteins The biochemical property of lectins that is the basis for most of their biological effects is their ability to bind to: A) amphipathic molecules. B) hydrophobic molecules. C) specific lipids. D) specific oligosaccharides. E) specific peptides. Which statement concerning sialic acid residues on glycoproteins is TRUE? A) Sialic residues on erythrocytes are recognized by lectins, leading to removal of the erythrocytes. B) Sialic residues on ceruloplasmin are recognized by lectins, leading to removal of ceruloplasmin. C) Sialic residues are removed by neuraminidases. D) The antiviral drug oseltamavir accelerates the removal of sialic acid residues. E) All of the statements are true. **antiviral drug는 neuraminidase의 리간드인 sialic acid에 경쟁적 길항 -> 바이러스입자 방출 막음 Which statement is NOT a reason that it is difficult to study oligosaccharide composition from biological systems? A) Oligosaccharides are often branched. B) Oligosaccharides often have a high negative charge density. C) Oligosaccharides have a variety of linkages (e.g., 16 or 14). D) Oligosaccharides have too much conformational flexibility. E) There are no specific glycosidase enzymes that can be used to selectively digest oligosaccharides. **답 모르겟음 A glycoconjugate molecule may include a carbohydrate as well as: A) an amino acid. B) a lipid. C) a saccharide. D) both an amino acid and a lipid. E) an amino acid, a lipid, and a saccharide. In a(n) _____ the carbonyl group is at the end of the carbon chain, but in a(n) _____ the carbonyl group can be at any other position. A) aldose; ketose B) ketose; aldose C) hexose; heptose D) aldose; hexose E) ketose; tetrose Which reason is the MOST plausible for why most hexoses of living organisms are D isomers? A) D isomers are more energetically favorable. B) D isomers are also used by amino acids. C) Sugars must be opposite isomers from amino acids. D) Evolving enzymes were made to remain with an initial preference. E) Evolving enzymes switch preference often to find the best isomer. Which monosaccharide is NOT a six-carbon monosaccharide? A) fructose B) ribose C) mannose D) glucose E) galactose When drawing a Haworth perspective formula from a Fisher projection, which statement is TRUE regarding anomers? A) It is α if the hydroxyl group on the anomeric carbon is up. B) It is α if the hydroxyl group on the anomeric carbon is down C) It is α if the hydroxyl group on the anomeric carbon on the same side of the ring as the C6 D) It is α if the hydroxyl group on the anomeric carbon on the opposite side of the ring as the C6 E) None of the answers is correct. Which disaccharide does NOT have an anomeric carbon available for oxidation? A)Glc (α1↔1α) Glc B)Glc (α1↔2β) Fru C)Fru (β2↔1α) Glc D)both Glc (α1↔2β) Fru and Fru (β2↔1α) Glc E)None of the above 42. What is the CORRECT name for the linkage between these monosaccharide derivatives? A) (α1→4) B) (β1→4) C) (1 4) D) (α1→β4) E) (α1→α4) Polysaccharides CANNOT be used by cells: A) as fuel storage molecules. B) for structural elements in cell walls. C) for structural elements in animal exoskeletons. D) for the extracellular matrix in animal cells. E) All of the answers are correct. Which statement about dextrans is FALSE? A) Dextrans are bacterial and yeast polysaccharides. B) All dextrans are made up of (α1→4)-linked poly-D-glucose. C) All dextrans have (α1→3) branches. D) Some dextrans have (α1→2) branches. E) All statements are true. **(a16)Glc임. Branch는 a13 Which statement about cellulose is TRUE? A) Cellulose is the main storage polysaccharide of animal cells. B) Cellulose is a highly branched polysaccharide. C) Cellulose is a homopolysaccharide. D) Cellulose glucose residues contain the same configuration as amylose glucose residues. E) Cellulose cannot be broken down by invertebrate animals. Which polysaccharide is NOT a homopolysaccharide? A) glycogen B) chitin C) amylose D) glycosaminoglycan E) dextran **peptidoglycan, glycosaminoglycan만 Heteropolysaccharide The polysaccharide chitin is MOST chemically similar to: A) cellulose. B) dextran. C) glycogen. D) starch. E) amylose. **chitin은 (베타14)GlcNAc in insects Which polysaccharide(s) can the enzyme -amylase break? A) glycogen B) starch C) cellulose D) both glycogen and cellulose E) both glycogen and starch Why are ruminant animals like cows able to digest cellulose? A) Their teeth are able to grind the polysaccharide into smaller saccharides. B) Their stomachs secrete the enzyme cellulose. C) They have a stomach compartment that houses symbiotic microorganisms that can hydrolyze cellulose. D) Their small intestine contains an environment suitable to hydrolyze cellulose. E) All animals can digest cellulose. In amylose, the most stable structure is a _____, which is stabilized by _____. A) coiled helix; interchain hydrogen bonds B) coiled helix; interchain covalent branching C) coiled helix; hydrogen bonds to surrounding water molecules D) straight, extended chain; interchain hydrogen bonds E) straight, extended chain; hydrogen bonds to surrounding water molecules The difference in interchain stability between the polysaccharides glycogen and cellulose is due to: A) the different glycosidic linkages of the molecules. B) the different hydrogen bonding partners of the individual chains. C) the incorporation of complex ions in the three dimensional structures of both polysaccharides. D) both the different glycosidic linkages of the molecules and the different hydrogen bonding partners of the individual chains. E) None of the answers is correct. Which statement is FALSE about the enzyme lysozyme? A) It is the active ingredient in penicillin. B) It is found in human tears. C) It is produced by some bacterial viruses. D) It hydrolyzes the (β1→4) glycosidic bond of peptidoglycan. E) It causes osmotic lysis of bacterial cells. Which glycosaminoglycan is found in the synovial fluid of joints? A) chondroitin sulfate B) dermatan sulfate C) hyaluronan D) keratin sulfate E) heparan sulfate Which commonality does NOT exist between peptides, nucleic acids, and poly- and oligosaccharides? A) They are all synthesized from a template. B) They are all information-carrying molecules. C) They are all created from multiple building blocks. D) The sequence of monomers is important for function. E) All of the answer choices are commonalities between peptides, nucleic acids, and poly- and oligosaccharides. In most cases, in order for an informational carbohydrate to become a biologically active molecule, it must: A) be an asymmetric molecule. B) contain a reducing sugar. C) contain an O-glycosidic bond. D) be covalently joined to a protein or lipid. E) be present in the extracellular matrix. Which statement is FALSE regarding proteoglycans? A) Both syndecans and glypicans can be shed into the extracellular space. B) Proteoglycan shedding is unregulated in cells. C) A protease or phospholipase is responsible for releasing proteoglycans. D) Proteoglycan shedding is activated in cancerous cells. E) Cell features such as proteoglycans can be changed quickly. Which type of protein interaction is NOT one with the NS domains of heparan sulfate? A) conformational activation B) cell-surface localization/concentration C) enhanced protein-protein interaction D) binding extracellular signaling molecules E) All of the answer choices are types of protein interaction with heparan sulfate. ***D가 Coreceptor Several types of human joint and skeletal defects are a result of a defect in a biosynthetic enzyme responsible for synthesis of: A) glycosaminoglycans. B) glycoproteins. C) glycolipids. D) lipopolysaccharides. E) glycosphingolipids. _____ are secreted or membrane proteins that contain large numbers of O-linked oligosaccharide chains. A) Gangliosides B) Mucins C) Glycins D) Aminoglycans E) Immunoglobulins Oligosaccharides differ from nucleic acids and proteins in that oligosaccharides are commonly: A) branched. B) polymeric. C) acidic. D) basic. E) None of the answers is correct. Which sequence is the CORRECT one for leukocyte extravasion in the inflammatory response? A) integrin binding → selectin binding → adhesion → arrest → extravasion B) adhesion → integrin binding → selectin binding → arrest → extravasion C) selectin binding → integrin binding → adhesion → arrest → extravasion D) integrin binding → adhesion → selectin binding → arrest → extravasion E) selectin binding → adhesion → integrin binding → arrest → extravasion The antiviral drugs oseltamivir (Tamiflu) and zanamivir (Relenza) do NOT work by: A) inhibiting the viral enzyme that trims the host cell's oligosaccharides. B) causing the viral particles to aggregate. C) competing with the host cell's oligosaccharides for binding. D) preventing the release of viruses from the infected cell. E) All of the answers are correct Which factor is NOT a part of determining the complete structure of an oligosaccharide or polysaccharide? A) determination of linear sequence B) determination of lectin partners C) determination of branching positions D) determination of glycosidic linkages E) determination of monosaccharide configuration Chapter 8 The compound that consists of ribose linked by an N-glycosidic bond to N-9 of adenine is: A) a deoxyribonucleoside. B) a purine nucleotide. C) a pyrimidine nucleotide. D) adenosine monophosphate. E) adenosine. Purines have ____ ring(s), (each) containing _____ nitrogen(s), whereas pyrimidines have _____ ring(s), (each) containing _____ nitrogens. A) 1; 1; 1; 1 B) 1; 2; 1; 2 C) 2; 1; 1; 2 D) 2; 2; 1; 1 E) 2; 2; 1; 2 A major component of RNA but not of DNA is: A) adenine. B) cytosine. C) guanine. D) thymine. E) uracil. The difference between thymine and uracil is: A) one methylene group on the pyrimidine ring. B) one methyl group on the pyrimidine ring. C) one hydroxyl group on the ribose ring. D) one amine group on the pyrimidine ring. E) one methyl group on the purine ring. The difference between a ribonucleotide and a deoxyribonucleotide is: A) a deoxyribonucleotide has an —H instead of an —OH at C-2. B) a deoxyribonucleotide has an —H instead of an —OH at C-3. C) a ribonucleotide has an extra —OH at C-4. D) a ribonucleotide has more structural flexibility than deoxyribonucleotide. E) a ribonucleotide is a pyranose, deoxyribonucleotide is a furanose. Which statement is TRUE of the pentoses found in nucleic acids? A) C-5 and C-1 of the pentose are joined to phosphate groups. B) The pentoses are in a planar configuration. C) The bond that joins nitrogenous bases to pentoses is an O-glycosidic bond. D) The pentoses are always in the β-furanose forms. E) The straight-chain and ring forms undergo constant interconversion. The phosphodiester bonds that link adjacent nucleotides in both RNA and DNA: A) always link A with T and G with C. B) are susceptible to alkaline hydrolysis. C) are uncharged at neutral pH. D) form between the planar rings of adjacent bases. E) join the 3' hydroxyl of one nucleotide to the 5' hydroxyl of the next. The phosphodiester bond that joins adjacent nucleotides in DNA: A) associates ionically with metal ions, polyamines, and proteins. B) is positively charged. C) is susceptible to alkaline hydrolysis. D) Links C-2 of one base to C-3 of the next. E) links C-3 of deoxyribose to N-1 of thymine or cytosine. **이 음전하는 단백질, 금속이온, 폴리아민 등의 양전하와 이온상호작용을 통해 중화된다 The alkaline hydrolysis of RNA does NOT produce: A) 2'- AMP. B) 2',3'-cGMP. C) 2'-CMP. D) 3',5'-cAMP. E) 3'-UMP. ** 3’,5-cAMP, cGMP, ppGpp 는 second messenger임 ** alkaline hydrolysis – 5’AMP, 2’-AMP, 3’-AMP, 2’,3’-AMP 등 The DNA oligonucleotide abbreviated pATCGAC: A) has seven phosphate groups. B) has a hydroxyl at its 3' end. C) has a phosphate on its 3' end. D) has an A at its 3' end. E) violates Chargaff's rules. For the oligoribonucleotide pACGUAC, the nucleotide at the: A) 3' end has a phosphate at its 3' hydroxyl. B) 3' end is a purine. C) 5' end has a 5' hydroxyl. D) 5' end has a phosphate on its 5' hydroxyl. E) 5' end is a pyrimidine. The nucleic acid bases: A) absorb ultraviolet light maximally at 280 nm. B) are all about the same size. C) are relatively hydrophilic. D) are roughly planar. E) can all stably base-pair with one another. In a double-stranded nucleic acid, cytosine typically base-pairs with: A) adenosine. B) guanine. C) inosine. D) thymine. E) uracil. In the Watson-Crick model for the DNA double helix (B form) the A-T and G-C base pairs share which property?몰라 A) The distance between the two glycosidic (base-sugar) bonds is the same in both base pairs, within a few tenths of an angstrom. B) The molecular weights of the two base pairs are identical. C) The number of hydrogen bonds formed between the two bases of the base pair is the same. D) The plane of neither base pair is perpendicular to the axis of the helix. E) The proton-binding groups in both base pairs are in their charged or ionized form. Chargaff's rules state that in typical DNA: A) A = G. B) A = C. C) A = U. D) A + T = G + C. E) A + G = T + C. In the Watson-Crick structure of DNA, the: A) absence of 2'-hydroxyl groups allows bases to lie perpendicular to the helical axis. B) adenine content of one strand must equal the thymine content of the same strand. C) nucleotides are arranged in the A-form. D) purine content (fraction of bases that are purines) must be the same in both strands. E) two strands are parallel. In the Watson-Crick model for the DNA double helix, which statement is NOT true? A) The two strands run anti-parallel to one another. B) The base-pairing occurs on the inside of the double helix. C) The double helix is right-handed. D) There are two equally sized grooves that run up the sides of the helix. E) The two strands have complementary sequences. In the Watson-Crick model of DNA structure: A) both strands run in the same direction, 3' 5'; they are parallel. B) phosphate groups project toward the middle of the helix, where they are protected from interaction with water. C) T can form three hydrogen bonds with either G or C in the opposite strand. D) the distance between the sugar backbone of the two strands is just large enough to accommodate either two purines or two pyrimidines. E) the distance between two adjacent bases in one strand is about 3.4 Å. Which statement is NOT true of all naturally occurring DNA? A) Deoxyribose units are connected by 3',5'-phosphodiester bonds. B) The amount of A always equals the amount of T. C) The ratio A+T/G+C is constant for all natural DNAs. D) The two complementary strands are antiparallel. E) Two hydrogen bonds form between A and T. In the Watson-Crick model of DNA structure (now called B-form DNA): A) a purine in one strand always hydrogen bonds with a purine in the other strand. B) A-T pairs share three hydrogen bonds. C) G-C pairs share two hydrogen bonds. D) the 5' ends of both strands are at one end of the helix. E) the bases occupy the interior of the helix. The double helix of DNA in the B-form is stabilized by: A) covalent bonds between the 3' end of one strand and the 5' end of the other. B) hydrogen bonding between the phosphate groups of two side-by-side strands. C) hydrogen bonds between the riboses of each strand. D) nonspecific base-stacking interaction between two adjacent bases in the same strand. E) ribose interactions with the planar base pairs. ** bacse stacking interactions via van-der-waals interactions. In nucleotides and nucleic acids, syn and anti conformations relate to: A) base stereoisomers. B) rotation around the phosphodiester bond. C) rotation around the sugar-base bond. D) sugar pucker. E) sugar stereoisomers. B-form DNA in vivo is a _____-handed helix, _____ Å in diameter, with a rise of _____ Å per base pair. A) left; 20; 3.9 B) right; 18; 3.4 C) right; 18; 3.6 D) right; 20; 3.4 E) right; 23; 2.6 Which sequence is palindromic? A) AGGTCC - TCCAGG B) CCTTCC - GCAAGG C) GAATCC - CTTAGG D) GGATCC - CCTAGG E) GTATCC – CATAGG Triple-helical DNA structures can result from Hoogsteen (non Watson-Crick) interactions. These interactions are primarily: A) covalent bonds involving deoxyribose. B) covalent bonds involving the bases. C) hydrogen bonds involving deoxyribose. D) hydrogen bonds involving the bases. E) hydrophobic interactions involving the bases. Which base compositions for single-stranded RNA are possible? %A %G %C %T %U A) 5 45 45 0 5 B) 25 25 25 0 25 C) 35 10 30 0 25 D) All of the answers are correct. E) None of the answers is correct. Double-stranded regions of RNA: A) are less stable than double-stranded regions of DNA. B) can be observed in the laboratory, but probably have no biological relevance. C) can form between two self-complementary regions of the same single strand of RNA. D) do not occur. E) have the two strands arranged in parallel (unlike those of DNA, which are antiparallel). ** A는 왜 아닌지 Double stranded regions of RNA typically take on a(n): A) A-form left-handed helix. B) A-form right-handed helix. C) B-form left-handed helix. D) B-form right-handed helix. E) Z-form left-handed helix. When double-stranded DNA is heated at neutral pH, which change does NOT occur? A) The absorption of ultraviolet (260 nm) light increases. B) The covalent N-glycosidic bond between the base and the pentose breaks. C) The helical structure unwinds. D) The hydrogen bonds between A and T break. E) The viscosity of the solution decreases. Which deoxyoligonucleotide will hybridize with a DNA containing the sequence (5')AGACTGGTC(3')? A) (5')CTCATTGAG(3') B) (5')GACCAGTCT(3') C) (5')GAGTCAACT(3') D) (5')TCTGACCAG(3') E) (5')TCTGGATCT(3') In the laboratory, several factors are known to cause alteration of the chemical structure of DNA. The factor(s) likely to be important in a living cell is/are: A) heat. B) low pH. C) oxygen. D) UV light. E) both oxygen and UV light Compounds that generate nitrous acid (such as nitrites, nitrates, and nitrosamines) change DNA molecules by: A) breakage of phosphodiester bonds. B) deamination of bases. C) depurination. D) formation of thymine dimers. E) transformation of A→ T. In DNA sequencing by the Sanger (dideoxy) method: A) radioactive dideoxy ATP is included in each of four reaction mixtures before enzymatic synthesis of complementary strands. B) specific enzymes are used to cut the newly synthesized DNA into small pieces, which are then separated by electrophoresis. C) the dideoxynucleotides must be present at high levels to obtain long stretches of DNA sequence. D) the role of the dideoxy CTP is to occasionally terminate enzymatic synthesis of DNA where Gs occur in the template strands. E) the template DNA strand is radioactive. In living cells, nucleotides and their derivatives can serve as: A) carriers of metabolic energy. B) enzyme cofactors. C) intracellular signals. D) precursors for nucleic acid synthesis. E) All of the answers are correct. The "energy carrier" ATP is an example of a(n): A) deoxyribonucleoside triphosphate. B) dinucleotide. C) peptide. D) ribonucleotide. E) ribonucleoside triphosphate. The chemical difference between a nucleotide and a nucleoside is that: A) a different nitrogenous base is added to each. B) nucleotides do not contain phosphate groups. C) nucleosides do not contain phosphate groups. D) nucleotides do not contain pentose sugars E) nucleosides do not contain pentose sugars. In a nucleoside, the pentose sugar is in its _____ form, and the ring is _____. A) α-furanose; planar B) α-pyranose; puckered C) β-furanose; planar D) β-furanose; puckered E) β-pyranose; planar ** puckered은 분자구조에서 특정부분이 평면이 아니라 약간 구부러진 상태 A pyrimidine is joined covalently to the pentose sugar through the: A) N-1 of the base to the 1' carbon of the pentose. B) N-9 of the base to the 1' carbon of the pentose. C) N-1 of the base to the 5' carbon of the pentose. D) N-9 of the base to the 5' carbon of the pentose. E) None of the answers is correct. **pyrimidine은 N-1 이고 Purine은 N-9임 The CORRECT name for the molecule shown below is: (see pic) A) 5-methylcytidine. B) C5-methylcytidine. C) 5-methyluridine. D) C5-methylthymidine. E) 5-methylthymidine. The covalent backbone of DNA and RNA consists of: A) alternating phosphate groups and nitrogenous bases. B) alternating phosphate groups and pentose residues. C) alternating pentose residues and nitrogenous bases. D) alternating pentose residues and cyclic nucleosides. E) None of the answers is correct. The 5' → 3' orientation of a DNA or RNA chain refers to the: A) linkage of the phosphodiester bonds between the nucleotides. B) location of the attachment of the nitrogenous base on the pentose sugar. C) positions of the chain that do not have a nucleotide attached. D) positions of the chain that do not have a phosphate group attached. E) respective net charges found at each end of the chain. DNA is _____ chemically stable than RNA due to the _____ on _____. A) more; 2'-hydroxyl groups; RNA B) more; 2'-hydroxyl groups; DNA C) more; 3'-hydroxyl groups; RNA D) less; 2'-hydroxyl groups; RNA E) less; 2'-hydroxyl groups; DNA The chemical moiety of nucleotides that allows quantification of concentration via UV absorbance is the: A) phosphate group(s). B) pentose sugar. C) nitrogenous base. D) hydroxyl group(s) on the pentose sugar. E) None of the answers is correct. Which statement is NOT true about base stacking when nucleic acids are in a double-stranded conformation? A) Stacking interactions occur when two or more bases are positioned with their rings parallel to each other. B) Stacking interactions are hydrophilic in nature. C) Stacking involves a combination of van der Waals and dipole-dipole interactions between bases. D) Base stacking helps to minimize contact of the bases with water. E) Base stacking interactions are important in stabilizing the three-dimensional structure of nucleic acids. The scientists who used x-ray crystallography to shed light on the three-dimensional structure of DNA were: A) Erwin Chargaff and colleagues. B) Alfred D. Hershey and Martha Chase. C) James Watson and Francis Crick. D) Rosalind Franklin and Maurice Wilkins. E) Oswald T. Avery, Colin MacLeod, and Maclyn McCarty. The MOST striking difference between A-, B-, and Z-form DNA is that: A) A -form does not contain a major and minor groove. B) B-form has the smallest helical diameter. C) Z-form is left handed. D) B-form has the greatest number of base pairs per helical turn. E) A-form maximizes base stacking interactions. Which conformation is NOT permitted due to steric interference? A) purine in syn conformation B) purine in anti conformation C) pyrimidine in syn conformation D) pyrimidine in anti conformation E) All of these conformations are permitted. Which single-stranded nucleic acid could form a hairpin structure? A) 5' TTTGCGATACTCATCGCATT 3' B) 5' TTTGCGATACTCACGCTATT 3' C) 5' TTTGCGATACTCTGCGATTT 3' D) All of the answers are correct. E) None of the answers is correct. ** palindromic -> hairpin, cruciform A tetraplex of DNA is MOST likely to form with which residue? A) Adenosine B) Thymidine C) Guanosine D) Cytidine E) A tetraplex is equally likely with all bases. Which DNA primer would have the HIGHEST melting temperature? A) GCATCGGC B) AATCGGAT C) ATACAGATCGGC D) ACCGGCAGGTCGGC E) ATACGCAGATCGGC Incubation of DNA at low pH is MOST likely to cause: A) depurination. B) depyrimidination. C) mutation of cytosine to uracil. D) hydrolysis of the phosphodiester bond. E) deamination of adenine and guanine. Which type of damage to DNA structure is MOST likely to be caused by UV light? A) deamination B) pyrimidine dimers C) depurination D) depyrimidination E) hydrolysis of the phosphodiester bond When performing PCR, what is the advantage to using a DNA polymerase isolated from a thermophilic organism? A) The PCR reaction does not need to be cooled below the denaturation step. B) The PCR reaction does not need primers to proceed. C) The PCR reaction does not need to have fresh enzyme added after each cycle. D) The PCR reaction does not need to have fresh dNTPs added after each cycle. E) The PCR reaction does not need to have fresh template DNA added after each cycle. How did the addition of different-colored fluorescent tags on each ddNTP improve the Sanger DNA sequencing method? A) Scientists did not need to use a heat-stable DNA polymerase. B) A DNA primer was no longer needed. C) All four ddNTPs could be incorporated into a single reaction. D) Scientists could now use short tandem repeats to assist their sequencing. E) The template DNA could now be double stranded. Which molecule contains the GREATEST amount of stored chemical energy? A) dGTP ** hydrolysis시 anhydride가 ester 보다 더 많은 에너지 방출 B) GDP C) dGDP D) GMP E) cGMP One of the MOST common regulatory second messengers in cells is: A) FAD. B) NAD+. C) coenzyme A. D) ATP. E) cAMP. ** some coenzymes containing adenosine => coenzyme A(CoA), NAD+, FAD 9장 Restriction enzymes: A) act at the membrane to restrict the passage of certain molecules into the cell. B) are highly specialized ribonucleases that degrade mRNA soon after its synthesis. C) are sequence-specific DNA endonucleases. D) are very specific proteases that cleave peptides at only certain sequences. E) catalyze the addition of a certain amino acid to a specific tRNA. The biological role of restriction enzymes is to: A) aid recombinant DNA research. B) degrade foreign DNA that enters a bacterium. C) make bacteria resistant to antibiotics. D) restrict the damage to DNA by ultraviolet light. E) restrict the size of DNA in certain bacteria. The size of the DNA region specifically recognized by type II restriction enzymes is typically: A) 4 to 6 base pairs. B) 10 to 15 base pairs. C) 50 to 60 base pairs. D) 200 to 300 base pairs. E) about the size of an average gene. Which of the following statements about type II restriction enzymes is false? A) Many make staggered (off-center) cuts within their recognition sequences. B) Some cut DNA to generate blunt ends. C) They are part of a bacterial defense system in which foreign DNA is cleaved. D) They cleave and ligate DNA. E) They cleave DNA only at recognition sequences specific to a given restriction enzyme. Certain restriction enzymes produce cohesive (sticky) ends. This means that they: A) cut both DNA strands at the same base pair. B) cut in regions of high GC content, leaving ends that can form more hydrogen bonds than ends of high AT content. C) make a staggered double-strand cut, leaving ends with a few nucleotides of single-stranded DNA protruding. D) make ends that can anneal to cohesive ends generated by any other restriction enzyme. E) stick tightly to the ends of the DNA they have cut. In the laboratory, recombinant plasmids are commonly introduced into bacterial cells by: A) electrophoresis - a gentle low-voltage gradient draws the DNA into the cell. B) infection with a bacteriophage that carries the plasmid. C) microinjection. D) mixing plasmids with an extract of broken cells. E) transformation - heat shock of the cells incubated with plasmid DNA in the presence of CaCl2. The E. coli recombinant plasmid pBR322 has been widely utilized in genetic engineering experiments. pBR322 has all of the following features except: A) a number of conveniently located recognition sites for restriction enzymes. B) a number of palindromic sequences near the EcoRI site, which permit the plasmid to assume a conformation that protects newly inserted DNA from nuclease degradation. C) a replication origin, which permits it to replicate autonomously. D) resistance to two different antibiotics, which permits rapid screening for recombinant plasmids containing foreign DNA. E) small overall size, which facilitates entry of the plasmid into host cells. Which of the following statements regarding plasmid cloning vectors is correct? A) Circular plasmids do not require an origin of replication to be propagated in E. coli. B) Foreign DNA fragments up to 45,000 base pairs can be cloned in a typical plasmid. C) Plasmids do not need to contain genes that confer resistance to antibiotics. D) Plasmid vectors must carry promoters for inserted gene fragments. E) The copy number of plasmids may vary from a few to several hundred. A convenient cloning vector with which to introduce foreign DNA into E. coli is a(n): A) E. coli chromosome. B) messenger RNA. C) plasmid. D) yeast "ARS" sequence. E) yeast transposable element. In genetic engineering, in vitro packaging is used to: A) cut a desired region out of the host bacterium's chromosome. B) ensure that genetically engineered bacteria are not accidentally released into the environment. C) incorporate recombinant DNA into infectious bacteriophage particles. D) place an antibiotic resistance gene in a plasmid. E) splice a desired gene into a plasmid. Which of the following does not apply to the construction or use of a DNA library? A) Determining the location of a particular DNA sequence in a DNA library requires a suitable hybridization probe. B) Genomic libraries are better for expressing gene products than cDNA libraries. C) Many segments of DNA from a cellular genome are cloned. D) Specialized DNA libraries can be made by cloning DNA copies of mRNAs. E) The DNA copies of mRNA found in a cDNA library are made by reverse transcriptase. The PCR reaction mixture does not include: A) all four deoxynucleoside triphosphates. B) DNA containing the sequence to be amplified. C) DNA ligase. D) heat-stable DNA polymerase. E) oligonucleotide primer(s). Which of the following statements about the polymerase chain reaction (PCR) is false? A) DNA amplified by PCR can be cloned. B) DNA is amplified at many points within a cellular genome. C) Newly synthesized DNA must be heat-denatured before the next round of DNA synthesis begins. D) The boundaries of the amplified DNA segment are determined by the synthetic oligonucleotides used to prime DNA synthesis. E) The technique is sufficiently sensitive that DNA sequences can be amplified from a single animal or human hair. RFLP is a: A) bacteriophage vector for cloning DNA. B) genetic disease. C) plasmid vector for cloning DNA. D) protein. E) variation in DNA base sequence. Current estimates indicate that humans have about ________ genes. A) 3,000 B) 10,000 C) 30,000 D) 100,000 E) 300,000 Current estimates indicate that ________ % of the human genome is translated into protein. A) less than 0.5% B) roughly 1.5% C) roughly 10% D) roughly 25% E) more than 50% Rank the following organisms in order from smallest genome (number of base pairs of DNA) to largest genome. A) Human, fruit fly, E. coli bacterium B) E. coli bacterium, human, fruit fly C) E. coli bacterium, fruit fly, human D) fruit fly, E. coli bacterium, human E) fruit fly, human, E. coli bacterium Which one of the following analytical techniques does not help illuminate a gene's cellular function? A) DNA microarray analysis B) Protein chip analysis C) Southern blotting D) Two-dimensional gel electrophoresis E) Two-hybrid analysis The technique known as two hybrid analysis for detecting interacting gene products depend on: A) activation of DNA polymerase by the nearby binding of hybridizing protein complexes. B) direct binding of a Gal4p activation domain to a DNA sequence in the promoter region. C) having a promoter that responds directly to one of the two proteins whose interactions is being measured. D) hybridization of DNA segments corresponding to the two genes being examined. E) stimulation of trasncription by interaction of two Gal4p domains via fused protein sequence A common cloning strategy for introducing foreign genes into plants with Agrobacterium employs all the following features except: A) a selectable antibiotic marker such as kanamycin resistance. B) a shuttle vector with 25 bp T-DNA repeats flanking the foreign gene of choice. C) a Ti plasmid lacking its T-DNA segment. D) active vir gene products from the altered Ti plasmid. E) an ability to induce crown gall formation in infected leaves. Which of the following tags is not used to study protein function? A) Green fluorescent protein (GFP) B) Synteny tag C) Tandem affinity purification (TAP) D) Gal4p DNA binding domain E) Gal4p activation domain Which of the following is not needed in 454 pyrosequencing of DNA? A) dNTPs B) Sulfurylase C) Luciferase D) ddNTPs E) Apyrase Which of the following is not needed to build a cDNA library? A) Genomic DNA B) mRNA C) Reverse transcriptase D) dNTPs E) DNA polymerase Which of the following is not a commonly used tag for affinity purification of cloned proteins? A) Glutathione-S-transferase B) Maltose binding protein C) Nickel D) Protein A E) Chitin-binding domain Which of the following is not used as a heterologous host for the expression of recombinant proteins? A) Retroviruses B) Bacteria such as E. coli C) Eukaryotes such as S. cerevisiae D) Insect cells E) Mammalian cells Common features found in a cloning plasmid used for protein expression include all except which of the following? A) Polylinker B) Origin of replication. C) Antibiotic resistance marker(s) D) Ribosome binding site E) Telomeric ends Which type of DNA sequence is not found in the human genome? A) Long repetitive repeats B) Introns C) Retro-palindromes D) Simple sequence repeats E) Transposons Which of the following methods is not used in linkage analysis? A) Compare densely spaced polymorphisms. B) Collect DNA from a family affected by the disease of interest. C) Sequence selected parts of the genome. D) Introduce retroviruses at the mutated locus. E) Look for SNP variants. 10장 Which molecules or substances contain, or are derived from, fatty acids? A) beeswax B) prostaglandins C) sphingolipids D) triacylglycerols E) All of these contain or are derived from fatty acids. Triacylglycerols are composed of: A) a glycerol backbone. B) three fatty acids. C) amide linkages between the fatty acids and the glycerol. D) both a glycerol backbone and three fatty acids. E) a glycerol backbone, three fatty acids, and amide linkages between the fatty acids and the glycerol. **amide linkage가 아니라 ester linkage Biological waxes are all: A) triesters of glycerol and palmitic acid. B) esters of single fatty acids with long-chain alcohols. C) triesters of glycerol and three long chain saturated fatty acids. D) sphingolipids. E) None of the answers is correct. **Waxes 는 palmitic acid(single fatty acid) + long chain alcohol Which statement concerning fatty acids is CORRECT? A) A fatty acid is the precursor of prostaglandins. B) Phosphatidic acid is a common fatty acid. C) Fatty acids all contain one or more double bonds. D) Fatty acids are a constituent of sterols. E) Fatty acids are strongly hydrophilic. **Arachidonate _____ contain(s) an ether-linked alkyl group. A) Cerebrosides B) Gangliosides C) Phosphatidyl serine D) Platelet-activating factor E) Sphingomyelin Sphingosine is NOT a component of: A) cardiolipin. B) ceramide. C) cerebrosides. D) gangliosides. E) sphingomyelin. **cardiolipin은 glycerophospholipid로 미토콘드리아의 inner membrane 구성 Which statement about membrane lipids is TRUE? A) Glycerophospholipids are found only in the membranes of plant cells. B) Glycerophospholipids contain fatty acids linked to glycerol through amide bonds. C) Lecithin (phosphatidylcholine), which is used as an emulsifier in margarine and chocolate, is a sphingolipid. D) Some sphingolipids include oligosaccharides in their structure. E) Triacylglycerols are the principal components of erythrocyte membranes. Which compound is NOT a glycerophospholipid? A) phosphatidylcholine B) phosphatidylethanolamine C) phosphatidylserine D) cardiolipin E) ceramide Which statement is TRUE of sphingolipids? A) Cerebrosides and gangliosides are sphingolipids. B) Phosphatidylcholine is a typical sphingolipid. C) They always contain glycerol and fatty acids. D) They contain two esterified fatty acids. E) They may be charged, but are never amphipathic. A compound containing N-acetylneuraminic acid (sialic acid) is: A) cardiolipin. B) ganglioside GM2. C) phosphatidylcholine. D) platelet-activating factor. E) sphingomyelin. Which statement is NOT true? A) Phospholipase A1 hydrolyzes the fatty acid from the 1-position on the glycerol backbone. B) Phospholipase B1 hydrolyzes the fatty acid from the 2-position on the glycerol backbone. C) Phospholipase C hydrolyzes the complete phospho-head group from the glycerol backbone. D) Phospholipase D hydrolyzes just the head group from the phospho-glycerol backbone. m Which statement about sterols is TRUE? A) All sterols share a fused-ring structure with four rings. B) Sterols are found in the membranes of all living cells. C) Sterols are soluble in water, but less so in organic solvents such as chloroform. D) Cholesterol is the principal sterol in fungi. E) The principal sterol of animal cells is ergosterol. Which statement is NOT true of sterols? A) Cholesterol is a sterol that is commonly found in mammals. B) Sterols are commonly found in bacterial membranes. C) Sterols are more common in plasma membranes than in intracellular membranes (mitochondria, lysosomes, etc.). D) Serols are precursors of steroid hormones. E) Sterols have a structure that includes four fused rings. Nonsteroidal anti-inflammatory drugs (NSAIDS) like aspirin and ibuprofen act by blocking production of: A) biological waxes B) prostaglandins C) sphingolipids D) vitamin D E) None of the answers is correct. Which vitamin is NOT fat soluble? A) A B) C C) D D) E E) K ** 지용성 비타민 – ADEK Which vitamin is derived from cholesterol? A) A B) B12 C) D D) E E) K ** vitamin D3 regulates calcium metanolism. Identify the molecule(s) derived from sterols. A) arachidonic acid B) gangliosides C) phosphatidylglycerol D) prostaglandins E) cortisol or vitamin D What is the abbreviated nomenclature for octadecanoic acid with two double bonds? A) 16:1 B) 14:2 C) 18:2 D) 18:0 E) 18:1 Which statement is TRUE about fatty acids? A) Fatty acids with longer chains have higher melting points. B) Fatty acids with longer chains have lower solubility in water. C) Fatty acids with more double bonds have higher melting points. D) Fatty acids with longer chains have higher melting points and lower solubility in water. E) None of the statements is true. What is the abbreviated nomenclature for a 14-carbon omega-3 fatty acid that contains no other double bonds? A) 14:1(Δ11) B) 17:1(Δ14) C) 14:1(Δ3) D) 13:1(Δ11) E) 14:0(Δ11) Which type of chemical linkage is used to join fatty acids to glycerol? A) an ether linkage B) a peptide bond C) an ester linkage D) a double bond E) a peroxide bond Waxes are BEST described as: A) esters of glycerol and three fatty acids. B) esters of one long-chain fatty acid and one long-chain alcohol. C) polyunsaturated long-chain fatty acids. D) esters of two long-chain fatty acids. E) ethers of glycerol and short-chain alcohols. _____ is NOT a biological use of waxes. A) Energy storage B) Lubrication C) Structure D) Insulation E) Waterproofing Which molecule is MOST commonly used as a backbone the linkage of three fatty acids to form fats? A) glycogen B) glycerol C) sphingosine D) glucose E) phosphoglycerol Which term BEST describes the polarity of membrane lipids? A) ambidextrous B) completely nonpolar C) amphipathic D) completely polar E) amphibolic Which statement describes a distinct difference between membrane lipids in archaea and membrane lipids in eukarya? A) Archaeal membrane lipids have alkyl acids that are ether-linked to glycerol at both ends. B) Eukaryotic membrane lipids consist of glycerol that is ester-linked to three fatty acids. C) Only eukaryotic membrane lipids are amphipathic. D) Archaeal membrane lipids always contain sphingosine. E) Eukaryotic membrane lipids always have a phosphate group attached to glycerol. Which compound is NOT a type of membrane lipid? A) sphingolipid B) glycerophospholipid C) sulfolipid D) sterol E) triacylglycerolipid Which glycerophospholipid has a net charge of zero at pH 7? A) phosphatidylserine B) phasphatidic acid C) phosphatidylcholine D) phosphatidylglycerol E) phosphatidylinositol 4,5-bisphosphate Which types of membrane lipids are modified to determine blood type in humans? A) phosphatidylserines B) glycosphingolipids C) galactolipids D) plasmalogens E) sphingomyelins Which types of membrane lipids make up 70% to 80% of the total membrane lipids in a vascular plant? A) phosphatidylserines B) glycosphingolipids C) galactolipids D) plasmalogens E) sphingomyelins Fatty acids are attached to sphingosine by what type of chemical linkage? A) an ether linkage B) an amide linkage C) an ester linkage D) a peroxide linkage E) a alkyl linkage Which types of signaling lipids are produced by platelets to aid in the formation of blood clots? A) prostaglandins B) thromboxanes C) arachidonates D) lipoxins E) leukotrienes Overproduction of which types of signaling lipids causes asthmatic attacks? A) prostaglandins B) thromboxanes C) arachidonates D) lipoxins E) leukotrienes Nonsteroidal antiinflammatory drugs (NSAIDs) inhibit the synthesis of which signaling lipids from arachidonic acid? A) prostaglandins B) thromboxanes C) leukotrienes D) both prostaglandins and thromboxanes E) both thromboxanes and leukotrienes The steroid hormones testosterone and beta-estradiol are derived from which lipid molecule? A) phosphatidylcholine B) cholesterol C) lipoxin A D) arachidonic acid E) geraniol Which membrane lipid serves as a reservoir of messenger molecules for signal transduction? A) taruocholic acid (TA) B) phosphatidylserine (PS) C) phosphatidylinositol 4,5-bisphosphate (PIP2) D) thromboxane A2 (TXA2) E) sphingomyelin (SM) Which compound can be cleaved in half to generate a molecule important in vision? A) calcitol B) beta-carotene C) arachidonic acid D) tocopherol E) isoprene **여기서 vision은 시력 Which feature allows certain lipid molecules to be used as colorful pigments in plants and animals? A) Their high oxygen content helps electrons circulate, which allows absorption of visible light. B) Their conjugated bond structures allow absorption of visible light. C) Their four-fused ring structure allows visible light reflection. D) Their hydrophobicity bends light around them. E) Their low specific gravities cause light to reflect from their surfaces. Phospholipase C hydrolyzes phosphatidylinositol 4,5-bisphosphate (PIP2) to form which signaling molecule that triggers Ca2+ release from the endoplasmic reticulum? A) diacylglycerolphosphate (DAGP) B) inositol 5-monophosphate (IP1) C) diacylglycerol (DAG) D) inositol 1,4,5-triphosphate (IP3) E) inositol 4,5-bisphosphate (IP2) Which lipid compound is NOT at least partially made from the condensation of isoprene units? A) sterols B) limonene C) beta-carotene D) vitamin E E) phosphatidylinositol 추가 7장 D-Glucose is called a reducing sugar because it undergoes an oxidation-reduction reaction at the anomeric carbon. One of the products of this reaction is: A) D-galactose. B) D-gluconate. C) D-glucuronate. D) D-ribose. E) muramic acid Hemoglobin glycation is a process where _______ is _______ attached to hemoglobin. A) glycerol; covalently B) glucose; enzymatically C) glucose; non-enzymatically D) N-acetyl-galactosamine; enzymatically E) galactose; non-enzymatically Why is it surprising that the side chains of tryptophan residues in proteins can interact with lectins? A) because the side chain of tryptophan is hydrophilic and lectins are hydrophobic. B) because the side chain of tryptophan is (-) charged and lectins are generally (+) charged or neutral. C) because the side chain of tryptophan can make hydrogen bonds and lectins cannot. D) because the side chain of tryptophan is hydrophobic and lectins are generally hydrophilic. E) none of the above. Which of the following techniques is not commonly used to study oligosaccharide structures? A) X-ray crystallography B) Matrix-assisted laser desorption/ionization mass spectroscopy (MALDI-MS) C) Nuclear magnetic resonance (NMR) D) Complete chemical synthesis E) Oligosaccharide microarrays About what percentage of mammalian proteins are glycosylated? a. 5% b. 15% c. 50% d. 90% e. 95% A solution of the heteropolysaccharide _____ can be heated and cooled to form a three-dimensional matrix that traps water and supports the electrophoretic separation of nucleic acids. a. dextrose b. agarose c. glycosaminoglycans d. amylose e. cellulose _____ could be used to determine human blood group type. a. Lipopolysaccharides b. Globoside c. Glycoproteins d. Lipoproteins e. Mucins Which modification CANNOT be made to a sugar molecule by an organism? a. oxidation of the carbonyl carbon b. replacing a hydroxyl group with an amino group c. oxidizing a carbon atom to a carboxyl group d. replacing a hydroxyl group with a hydrogen atom. e. All of the answer choices are possible sugar derivatives. Which statement accurately describes the interactions between the molecules thrombin, antithrombin, and heparan sulfate? a. In the absence of heparan sulfate, antithrombin binds tightly to thrombin, inhibiting blood coagulation. b. In the absence of heparan sulfate, antithrombin cannot bind to thrombin, inhibiting blood coagulation. c. In the presence of heparan sulfate, antithrombin binds tightly to thrombin, inhibiting blood coagulation. d. In the presence of heparan sulfate, antithrombin cannot bind to thrombin, enabling blood coagulation. e. In the presence of heparan sulfate, antithrombin binds tightly to thrombin, enabling blood coagulation. 8장 Which of the following statements concerning the tautomeric forms of bases such as uracil is correct? A) The all-lactim form contains a ketone group. B) The lactam form contains an alcohol group. C) The lactam form predominates at neutral pH. D) They are geometric isomers. E) They are stereoisomers. The experiment of Avery, MacLeod, and McCarty in which nonvirulent bacteria were made virulent by transformation was significant because it showed that: A) bacteria can undergo transformation. B) genes are composed of DNA only. C) mice are more susceptible to pneumonia than are humans. D) pneumonia can be cured by transformation. E) virulence is determine genetically. Which of the following is not true of all naturally occurring DNA? A) Deoxyribose units are connected by 3',5'-phosphodiester bonds. B) The amount of A always equals the amount of T. C) The ratio A+T/G+C is constant for all natural DNAs. D) The two complementary strands are antiparallel. E) Two hydrogen bonds form between A and T. In double-stranded DNA: A) only a right-handed helix is possible. B) sequences rich in A-T base pairs are denatured less readily than those rich in G-C pairs. C) the sequence of bases has no effect on the overall structure. D) the two strands are parallel. E) the two strands have complementary sequences. The ribonucleotide polymer (5')GTGATCAAGC(3') could only form a double-stranded structure with: A) (5')CACTAGTTCG(3'). B) (5')CACUAGUUCG(3'). C) (5')CACUTTCGCCC(3'). D) (5')GCTTGATCAC(3'). E) (5')GCCTAGTTUG(3'). In comparison with DNA-DNA double helices, the stability of DNA-RNA and RNA-RNA helices is: A) DNA-DNA > DNA-RNA > RNA-RNA. B) DNA-DNA > RNA-RNA > DNA-RNA. C) RNA-DNA > RNA-RNA > DNA-DNA. D) RNA-RNA > DNA-DNA > DNA-RNA. E) RNA-RNA > DNA-RNA > DNA-DNA. In the chemical synthesis of DNA: A) the dimethoxytrityl (DMT) group catalyzes formation of the phosphodiester bond. B) the direction of synthesis is 5' to 3'. C) the maximum length of oligonucleotide that can be synthesized is 8-10 nucleotides. D) the nucleotide initially attached to the silica gel support will become the 3' end of the finished product. E) the protecting cyanoethyl groups are removed after each step. 10장 Which of the following statements is true of lipids? A) Many contain fatty acids in ester or amide linkage. B) Most are simply polymers of isoprene. C) Testosterone is an important sphingolipid found in myelin. D) They are more soluble in water than in chloroform. E) They play only passive roles as energy-storage molecules. Fatty acids are a component of: A) carotenes. B) cerebrosides. C) sterols. D) vitamin D. E) vitamin K. Which of the following best describes the cholesterol molecule? A) Amphipathic B) Nonpolar, charged C) Nonpolar, uncharged D) Polar, charged E) Polar, uncharged Tay-Sachs disease is the result of a genetic defect in the metabolism of: A) gangliosides. B) phosphatidyl ethanolamine. C) sterols. D) triacylglycerols. E) vitamin D. An example of a glycerophospholipid that is involved in cell signaling is: A) arachidonic acid. B) ceramide. C) phosphatidylinositol. D) testosterone. E) vitamin A (retinol). Which of the following is not a fat-soluble vitamin? A) A B) C C) D D) E E) K Which of the following techniques is not commonly used to analyze lipid composition? A) Selective extraction using apolar solvents B) Adsorption chromatography C) X-ray crystallography D) Hydrolysis using enzymes with specificity for certain linkages E) Mass spectroscopy Which of the following is not a consequence of partial hydrogenation of vegetable oils? A) Longer shelf life B) Lower melting temperature C) Reduction of some cis double bonds to single bonds D) Conversion of some cis double bonds to trans double bonds E) Increased risk of cardiovascular disease upon consumption by humans