BOH1 - 2024 amino acids and proteins Ashik Srinivasan.pptx

Building Blocks of Life Amino Acids and Proteins Dr Ashik Srinivasan School of Medical Sciences [email protected] Last updated, and Presented: 27 Feb 2024 The University of Sydney Page 1  Proteins The University of Sydney...

Building Blocks of Life Amino Acids and Proteins Dr Ashik Srinivasan School of Medical Sciences [email protected] Last updated, and Presented: 27 Feb 2024 The University of Sydney Page 1  Proteins The University of Sydney Page 2  Learning outcomes Definition of amino acids, peptides, and proteins. Basic structure of an amino acid. Classification of amino acids. Outline the process of proteins synthesis. Differentiate four levels of a protein structure: primary, secondary, tertiary, and quaternary. Function of amino acids and proteins in the body. The University of Sydney Page 3  Amino acids : monomeric units of proteins Amino acids are the basic structural units of proteins. Consist of an amino group, a carboxylic acid group, and a distinctive R group (side chain) bonded to a carbon atom. The University of Sydney Page 4  Each Amino acid has: Amino group: (-NH2) Contains a basic nitrogen atom. Found at the amino end of an amino acid Carboxylic acid group:(-COOH) Part of an organic compound, Found at the carboxyl end of an amino acid The University of Sydney Page 5  Amino acids : Zwitterion Zwitterionic form at physiological pH (7.35-7.45) acidic alkali H+ OH- The University of Sydney Page 6  Abbreviations of amino acids It’s good to know the amino acids, but you don’t need to memorise the list The University of Sydney Page 7  The “standard” twenty amino acids Contents of this page are for your interest only The University of Sydney Page 8  Contents of this page are for your interest only The University of Sydney Page 9 By TungstenEinsteinium - Own work, CC BY-SA 4.0, https://commons.wikimedia.org/w/index.php?curid=117005436  Contents of this page are for your interest only Lower pKa value = gives up H+ more easily The University of Sydney Page 10 By TungstenEinsteinium - Own work, CC BY-SA 4.0, https://commons.wikimedia.org/w/index.php?curid=117005436  Classification of amino acids Essential Conditionally Nonessential essential Synthesized NO. Comes from YES. Produced YES. Produced by the body food by the body. by the body Except in the time of illness and stress. Amino acids (9) phenylalanine, (8) (4) valine, tryptophan, arginine, alanine, threonine, cysteine, asparagine, isoleucine, glutamine, aspartic acid, methionine, tyrosine, and glutamic histidine, leucine, glycine, acid. and lysine ornithine, proline, and (PVT TIM HaLL) serine Source Protein-rich diet Backbone: carbohydrates and (eggs, meats, fats. The University of Sydney legumes and Nitrogen: recycled and dietaryPage 11 beans, protein  Routes for non-essential amino acids synthesis The University of Sydney Page 12  Protein deficiency: Loss of muscle mass Hair loss Blood sugar fluctuation Anxiety Weight gain Depression Fatigue Slow wound healing Frequent infection The University of Sydney Page 13  Peptides and proteins Peptides consists of 2- 50 amino acids. Dipeptide : 2 amino acids Tripeptides: 3 amino acids Polypeptides: More than 10 amino acids Proteins are molecules that consist of more than 50 amino acids and one or more polypeptide chains. Typically, these polypeptides range in length from 40 to 34,000 amino acid residues (although few have more than 1500 residues). Average mass of an amino acid residue is 110 D. Molecular mass of polypeptides, range from 40 to over 3700 kD. The University of Sydney Page 14 Peptide bonds link amino acids to form polypeptide chains Adjacent amino acids in a protein are connected by a peptide bond (CO-NH linkage). For every monomer (amino acid) added to a polymer (polypeptide or protein), a molecule of water (H2O) is released. Hydrolysis Condensation H2O H2O The University of Sydney Page 15  Peptides and proteins Classified by number of amino acids in a chain Peptides: 2- 50 amino acids. Proteins: more than 50 amino acids and one or more polypeptide chains. Typically, 100 to 10,000 amino acids The sequence is always read from N to C-terminus H3N+-Lys-Val-Phe-Ala-Met-Cys-Leu-leu-Arg-Val-COO- Or KVFAMCLLRV The University of Sydney Page 16 Possible combinations from 20 “standard” amino acids How many distinct dipeptides are possible? 202 = 400. How many distinct tripeptides are possible? Ans: 203 = 8000. Possible combinations for a small protein of 100 residues: 20100 = 1.27X10130. The University of Sydney Page 17  Central Dogma- flow of genetic information The University of Sydney Page 18  Central Dogma- flow of genetic information mRNA: AUGAAGCCGAGUGUAGAU AUG-AAG-CCG-AGU-GUA-GAU Protein: Met-Lys-Pro-Ser-Val-Asp Or MKPSVD CCUGAGCCAACUAUUGAUGAA PEPTIDE Proline-Glutamic acid-Proline-Threonine- Isoleucine-Aspartic acid-Glutamic acid The University of Sydney Page 19  Ribosomes – Action site Ribosomes: rRNA and ribosomal proteins. Two subunits, large (50S) and small (30S) Small subunit: Binds to the mRNA and links codon in mRNA with anti-codon in tRNA Large subunit: Catalyses formation of peptide bonds, linking amino acids to form protein https://youtu.be/gG7uCskUOrA?si=r1e4LBPNr1gLH4Xj&t=44 The University of Sydney Page 20  Components of Translation mRNA Amino acids tRNA = Adapter molecules Ribosomes = Action stations Enzymes and energy The University of Sydney Page 21  Synthesis of proteins from RNA  Initiation: o Start codon AUG (Methionine)  Elongation o Addition of amino acids by peptide bonds  Termination o Stop codon UAA, UAG and UGA The University of Sydney Page 22  Central Dogma- flow of genetic information mRNA: AUGAAGCCGAGUGUAGAU AUG-AAG-CCG-AGU-GUA-GAU Protein: Met-Lys-Pro-Ser-Val-Asp Or MKPSVD CCUGAGCCAACUAUUGAUGAA PEPTIDE Proline-Glutamic acid-Proline-Threonine- Isoleucine-Aspartic acid-Glutamic acid The University of Sydney Page 23  Details on this slide are for your interest only Post translational modifications can include methylation, hydroxylation, phosphorylation… 700 different amino acids are known in animals, plants, fungi and prokaryotes combined. The University of Sydney Page 24  Mutations on Genetic Code Mutation of genetic code: malfunctioning or absence of protein The University of Sydney Page 25  Mutations on Genetic Code Frameshift mutations: Insertion or deletion of number of bases that is not a multiple of three. The University of Sydney Page 26  Gene mutations and craniofacial disorders National Institute of Dental and Craniofacial Research Genetics (2008): More than 700 genetic mutations in human are linked with craniofacial disorders: Fibroblast growth factors (FGF) Transforming growth factors (TGF) Bone morphogenetic protein 4 (BMP4), Wnt (Wingless) Sonic hedgehog (Shh) T-box proteins, Nkx2-5, MSX1, Pax9, GLI3 OK, But what has all that got to do with today’s topic? The University of Sydney Page 27 E6V mutation in beta-globin gene causes sickle-cell anemia The gene defect is a single nucleotide mutation GAG codon changing to GTG at position 6 of the β-globin gene glutamate (E) gets substituted by valine (V) That small change makes RBCs go into sickle shape in sickness and low oxygen conditions. The University of Sydney Page 28  Levels of protein structure Primary structure: Defined sequence of amino acids in a polypeptide. Secondary structure: Regular, recognizable conformations observed in the polypeptide such as alpha-helices, beta pleated sheets, turns and loops. Tertiary structure: Three-dimensional structure of entire folded protein. Quaternary structure: the arrangement of multiple protein subunits into a protein complex, only in proteins with more than 1 polypeptide chain The University of Sydney Page 29 The properties of a protein are largely determined by its three- dimensional structure. The University of Sydney Page 30 The properties of a protein are largely determined by its three-dimensional structure. The University of Sydney Page 31  Denaturation of proteins Denaturation - Any alteration/ mild disruption in the structure that changes the biological, chemical and physical properties of the protein This may happen due to: Heat Ultra-violet radiation Acids, Bases Solvents Salts Mechanical agitation Primary structure remains unchanged by denaturation The University of Sydney Page 32  Denaturation of proteins –Irreversible The University of Sydney Page 33  Denaturation of proteins – Reversible Heat shock proteins (HSPs) are a group of proteins that function to reverse or inhibit denaturation or unfolding of cellular proteins in response to stress or high temperature. Traditionally, HSPs have also been known as molecular chaperones because of their physiological and protective roles in cells. The University of Sydney Page 34  gs ! Function of proteins in se th Function of Mode of action the proteins know Enzymes and Enzymes-speed up reactions in the body hormones Hormones-direct specific activities, such as Must regulating blood glucose levels (insulin). Antibodies and Involved in immune system to defend the complement system body from antigens (foreign invaders). Structural and Provide strength and flexibility to body mechanical support tissues essential for the ongoing maintenance of the body. Carriers and Shuttle substances such as oxygen, nutrients transport nutrients (such as iron) and waste products through the blood and into and out of cells. Fluid balance Ensure that body fluids are evenly dispersed in the blood and inside and outside cells. Acid-base balance Act as buffers to help keep the pH of body fluids within a tight range. Energy The University of Sydney Provide calories, can be used as energy Page 35 when necessary.  Specialized Roles of Amino Acids gs ! in se th Chemical messengers (neurotransmitters) : Glycine the 𝛄-aminobutyric acid (GABA; a glutamate know decarboxylation product) Dopamine (a tyrosine derivative) Must Potent local mediator of allergic reactions: Histamine (the decarboxylation product of histidine) Thyroid hormone: Thyroxine (a tyrosine derivative) Intermediates in various metabolic processes: Citrulline (urea biosynthesis) Ornithine (urea biosynthesis) Homocysteine (amino acid metabolism) The University of Sydney Page 36  Specialized Roles of non-standard Amino Acids Details in this slide are for your interest only Azaserine β-Cyanoalanine / β-Cyano-L-alanine Antimicrobial, Antifungal, Removal of cyanide from Antineoplastic, nature. Antimetabolite, Immunosuppressive, β‐cyanoalanine synthase (β‐ Glutamine antagonist. CAS) pathway in cyanogenic plants cause cyanide Use for treating acute detoxification in nature. childhood leukemia The University of Sydney Page 37  Have a lovely week, thinking about these marvelous proteins  The University of Sydney Page 38