BIO LESSONS PDF

What’s Living, what’s Non-living Living Non-Living Composed of matter Composed of matter Organized in atoms Organized in atoms Living on Earth Living on Earth Engaging metabolism Not engaging Engaging meta...

What’s Living, what’s Non-living Living Non-Living Composed of matter Composed of matter Organized in atoms Organized in atoms Living on Earth Living on Earth Engaging metabolism Not engaging Engaging metabolism reproduction Not engaging DNA present reproduction DNA absent  What’s Living, what’s Non-living Metabolism? How living organisms master to live. Metabolism is the ability to acquire, use and transform energy in order to perform cellular functions, to grow, and to reproduce What’s Living, what’s Non-living How about viruses? What’s Living, what’s Non-living DNA present?  Shared Characteristics of Life Life emerges at the level of cells, which are organized units of life  Shared Characteristics of Life Common Features of Cells Cells can exist as independent organisms. Cells are composed of macromolecules that participate in identical or similar metabolic processes or chemical reactions. In all cells, genes are stored in DNA written in the same chemical code All cells use the machinery of DNA transcription and RNA translation to produce protein molecules Shared Characteristics of Life: Cells Bacteria (Unicellular Prokaryotes)  Shared Characteristics of Life: Cells Eukaryotic Cells Pancreatic Secretory Cell  Shared Characteristics of Life Living organisms are organized in a certain fashion 1) Biosphere: all the environments on Earth inhabited by life 2) Ecosystem: made of non- living and living components — deserts, prairies 3) Community: all the organisms living in a particular ecosystem 4) Population: all the individuals of a specie living in a specific area — human population 5) Organism: an individual living entity — a bird  Shared Characteristics of Life Living organisms are organized in a certain fashion An organism is constituted by several organ systems Organ systems include several organs Organs are made of different tissues A tissue is an arrangement of cells Cell parts are made of macromolecules  Shared Characteristics of Life Living organisms are interdependent Producers (plants and other chemo- or photosynthetic organisms) are able to synthesize macromolecules that consumers will intake and digest Decomposers break down organic matter (dead or alive)  Shared Characteristics of Life Living organisms sense and respond to change Homeostasis is the ability of an organism to maintain its internal environment conditions within tolerable limits  Shared Characteristics of Life Living organisms reproduce, grow, and mutate A mutation is an alteration of hereditary instructions. It may have an adaptative value, which may lead to diversity What Is Chemistry to Life?  Shared Characteristics of Life Living organisms are organized in a certain fashion An organism is constituted by several organ systems Organ systems include several organs Organs are made of different tissues A tissue is an arrangement of cells Cell parts are made of macromolecules Macromolecules are atomic arrangements  What is an Atom? An atom is the smallest unit of matter that is unique to a particular element Matter refers to anything that occupies space and has a mass; it is made of the 92 naturally occurring elements Elements are fundamental substances that cannot be broken down to a different substance Naturally Occurring Elements in the Human Body Why these elements?  How is an Atom Structured? Atoms are constituted by a certain number of subatomic particles (electrons, neutrons, and protons) Electrons are negatively charged and move around the nucleus Protons (positively charged) and neutrons (no net charge) are located at the core region — the atom’s nucleus Atoms are electrically neutral (# protons = # electrons) Atomic Number refers to the number of protons in the nucleus Atomic Mass refers to the number of protons and neutrons in the nucleus Bohr’s Atomic Model Atomic Number and Atomic Mass  Helium has __ electrons. 25% 25% 25% 25% 1. 8 2. 2 3. 4 4. 6 8 2 4 6  Helium has __ neutrons. 25% 25% 25% 25% 1. 8 2. 2 3. 4 4. 6 8 2 4 6 Borh’s Atomic Theory Niels Bohr  How is Matter Organized? Atoms, Molecules, and Compounds Atom: The smallest unit of matter Compound: A substance in which the relative Molecule: A Bonded unit of two or proportions of two or more elements never vary more – same or different - atoms  How Do Atoms Make Molecules? Atoms make molecules because chemical bonds occur A chemical bond is a union between atoms that occurs when atoms give up, gain, or share electrons Whether an atom will bond to another atom depends upon both the number the number an arrangement of its electrons, and on the bond distance Electrons in an atom are neither uniformly distributed around the nucleus nor randomly. They are attracted to the atom’s nucleus and repelled by other electrons. Why? Electrons move in different orbitals Bond Distance  What is an Orbital? An orbital is a region of space around the atom’s nucleus where electrons are likely to be found at any instant. A particular orbital allows space for two electrons at the most Orbitals with vacancy will be the reactive orbitals  Two more electrons fit in the hydrogen’s orbital. Do you agree? 1. Yes 2. No 50% 50% s o Ye N Simplified Atomic Models Valence: electron vacancy Simplified Atomic Model of The First 18 Elements Orbitals and Shells  How Do Atoms Make Molecules? Atoms make molecules because chemical bonds occur A chemical bond is a union between atoms that occurs when atoms give up, gain, or share electrons Whether an atom will bond to another atom depends upon both the number the number an arrangement of its electrons, and on the bond distance Orbitals with vacancy will be the reactive orbitals  Chemical Bonds Ionic Bonds An ionic bond is a chemical bond that occurs between two oppositely charged ions Cations are positively charged ions (i.e. Na+) Anions are negatively charged ions (i.e. Cl-) NaCl (or Na+ Cl-) represents an ionic bond Atoms joint by an ionic bond are referred to as salts or ionic compounds Chemical Bonds Ionic Bonds  Chemical Bonds Covalent Bonds Covalent bonds are high energy bonds. In a covalent bond, atoms share electrons In a non-polar covalent bond, shared electrons are evenly attracted to all of the atoms that constitute the bond (i.e. H2) Non-polar covalent bonds In a polar covalent bond, shared electrons are attracted unevenly (i.e. H2O). Polar covalent bonds form polar molecules Atoms joint by covalent bonds are referred to as molecules Polar covalent bond  Chemical Bonds Polar Molecules Oxygen is more electronegative than hydrogen and pulls electrons more toward its nucleus This uneven pulling force results in a partial negative charge on the oxygen side (δ-, more electrons there for a longer time) and a partial positive charge on the hydrogen sides (δ+, less electrons there for a shorter period of time) — a polar molecule Electronegativity is the atom’s ability to attract electrons  Chemical Bonds Hydrogen Bonds In a hydrogen bond, an atom or molecule interacts weakly with one hydrogen atom already participating in a polar covalent bond Hydrogen bonds are represented by discontinuous lines Hydrogen bonds structure big macromolecules (i.e. DNA)  An ionic bond is a chemical bond sustained by the attraction between oppositely charged ions. Do you agree? 1. Yes 33% 33% 33% 2. No 3. Abstain s in o Ye N ta bs A  A covalent bond occurs when two or more atoms share electrons. Do you agree? 1. Yes 33% 33% 33% 2. No 3. Abstain s in o Ye N ta bs A  There is always an atom of hydrogen in a hydrogen bond. Do you agree? 1. Yes 33% 33% 33% 2. No 3. Abstain s in o Ye N ta bs A The Molecule of Water The Molecule of Water Water is Cohessive The Molecule of Water “The Solvent of Life” Dissociation of Salts Dissociation of Water and pH Scale Carbon and Macromolecules  Shared Characteristics of Life Living organisms are organized in a certain fashion An organism is constituted by several organ systems Organ systems include several organs Organs are made of different tissues A tissue is an arrangement of cells Cell parts are made of macromolecules Macromolecules are atomic arrangements Naturally Occurring Elements in the Human Body Why these elements? The Main Components of Macromolecules  Carbon Makes Organic Molecules Why Carbon Carbon is the second most abundant element in living organisms Carbon can share four electrons, therefore it can bond to four additional atoms Carbon establishes covalent bonds (stable, high energy bonds)  Carbon Makes Organic Molecules Why Carbon? When a carbon atom establishes four single covalent bonds to other atoms, the resulting molecules is tetrahedrical What does that mean? Methane, CH4  Carbon Makes Organic Molecules Why Carbon? Carbon single covalently bonded to another C atom has the ability to rotate up to 180° What does that mean? Ethane, C2H6  Carbon Makes Organic Molecules Why Carbon? Carbon double covalently bonded with another atom of C (C=C) results in a stable, rigid bond What does that mean? Ethene, C2H4  Carbon Makes Organic Molecules Why Carbon? Methane, CH4 Carbon molecules have strength, flexibility, and great versatility to chemically react with other atoms and molecules Ethane, Ethene, C2H6 C2H4  Categories of Macromolecules Carbohydrates (sugars): act as storage and source of energy Lipids (fats): act as storage of energy; they are components of cell membranes Proteins: perform multiple cellular functions Nucleic Acids: hold genetic message and intervene in the processing of genetic information  Macromolecules: Hydrocarbon Backbones and Functional Groups Functional Group Backbone Macromolecules are constituted by hydrocarbon backbones, which mainly provide structural stability, and by one or several functional groups. Functional groups are involved in many and diverse chemical reactions, establishing bonds with other atoms and molecules Functional Groups  This functional group is a ___ and therefore the molecule is a ___. 1. carbonyl aldehyde/ sugar 50% 50% (aldehyde) 2. carbonyl ketone/sugar (ketone)... ga... /s u /s de e y on eh et ld lk la ny ny o o rb rb ca ca  This functional group is a ___ and therefore the molecule is a ___. 50% 50% 1. carbonyl aldehyde/ sugar 2. carboxyl/fat ta l/f... xy /s o de rb y ca eh ld la ony rb ca  Macromolecules: Dehydration and Hydrolysis Reactions Through dehydration (or condensation) reactions, monomers are joint together to form polymers Hydrolysis reactions break down polymers into monomers Carbohydrates  Carbohydrates Carbohydrates are used by cells as the main source of energy. Chemical energy is stored in carbohydrates, which is dispensed when needed In carbohydrates the functional group may be a carbonyl aldehyde or carbonyl ketone Electron micrographs of glycogen containing liver cells  Carbohydrates Carbohydrates also perform structural roles: they make the cell wall of plant cells (cellulose), and the exoskeleton of some animals (chitin)  Carbohydrates: Structure Monosaccharides Depending on the functional group they harbor, carbohydrates fall into two categories: aldoses (carbonyl aldehyde) and ketoses (carbonyl ketone) Depending on the number of sugar units they have, carbohydrates are monosaccharides, disaccharides, or polysaccharides Monosaccharides are made of one sugar unit Monosaccharides  Carbohydrates: Structure Linear and Ring Forms In aqueous solutions, glucose molecules, as well as most other sugars, form rings In a ring, each corner represents a carbon  Carbohydrates: Structure Disaccharides A disaccharide consists of two monosaccharides joined by a glycosidic linkage, a covalent bond formed between two monosaccharides through a dehydration reaction Lactose  Polysaccharides: starch, glycogen, cellulose Large chains of sugar units The majority of sugars found in nature exist in the form of polysaccharides  This molecule is a … 1. monosaccharide 25% 25% 25% 25% 2. disaccharide 3. trisaccharide 4. polysaccharide e e e e id rid rid rid ar ha ha ha ch cc cc cc ac sa a sa s is ly di o tr on po m  Carbohydrates: Structure Polysaccharides Starch (plants) and glycogen (animals) function as energy storage Cellulose (plants) functions as a polysaccharides structural polysaccharide Lipids  Lipids Lipids are organic molecules insoluble in water. They constitute the main reservoir of stored energy Fats also make cell membranes and coatings (i.e. fruit coats) The basic structure of fats is a hydrocarbon backbone with a carboxyl group attached Fats (fatty acids and triglycerides), phospholipids, and steroids are the three main categories of lipids  Lipid Structure Fatty Acids A fatty acid molecule has two distinct regions: a long, not very reactive, hydrophobic hydrocarbon chain, and a carboxylic acid group, extremely reactive and hydrophilic Molecules such as fatty acids — with two distinct hydrophobic and hydrophilic regions — are termed amphipathic.  Lipid Structure Types of Fatty Acids  Lipid Structure Triglycerides Fatty acids are very efficient sites of energy storage; they are stored in the cytoplasm of many cells in the form of droplets of triacylglycerol molecules — compounds made of three fatty acid chains bonded to a glycerol molecule. When a carboxylic acid and an alcohol react, a water molecule is removed, and an ester linkage is formed Triglycerides make “the fat” of our bodies. In animals, they are stored as droplets in fat cells or adipocytes.  This molecule is a … 1. unsaturated fat 50% 50% 2. saturated fat t t fa fa d d te te ra ra tu tu sa sa un  Lipid Structure Phospholipids Phospholipids stand as the main components of cell Adipocytes membranes  Lipid Structure Steroids Steroids are made by a carbon skeleton consisting of four fused rings Cholesterol is a common component of animal cell membranes. It is also the precursor of many steroids are synthesized — i.e. hormones like sex hormones of vertebrates Proteins  Proteins Proteins are present in the cells in large amounts; they may determine cellular size, shape, and function. DNA stores in its genes the information to make all the proteins an organism requires for living A protein is a stretch of an assortment of 20 different amino acids (aa) joined together by peptide bonds General structure of an amino acid  Proteins The 20 Amino Acids  Proteins The 20 Amino Acids  Proteins How Proteins Are Made Amino acids are joined together when a dehydration reaction removes a hydroxyl group from the carboxyl end of one amino acid and a hydrogen from the amino group of another amino acid The resulting covalent bond is called a peptide bond (C-N)  Proteins How Proteins Are Structured Primary structure of proteins is constituted by its sequence of amino acids The first amino acid makes the amino end, while the last amino acid of the stretch makes the carboxyl end  Proteins How Proteins Are Structured What Does It Happen When The Primary Structure Is Altered? Sickle Red Blood Cells  Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) functions as a channel protein Cystic Fibrosis: a deletion of phenylalanine (Phe) at position 508 in the cystic fibrosis trans- membrane conductance regulator (CFTR) protein produces a functionally defective protein CFTR delta F508, which causes cystic fibrosis. - Phe CFT - R 1 507 508 509 1450 CFTR delta F508 1 507 508 1449 Enzymes and Metabolism Metabolism: Exergonic and Endergonic Reactions  Chemical Reactions: Activation Energy (EA) Every chemical reaction involves bond breaking and bond forming A chemical reaction generally involves the transformation of a molecule (reactant) into another (product) after the transition state has been overcome Activation energy is the energy required for such transformation  Chemical Reactions: Enzymes Lower the Activation Energy Barrier  Enzymes: What Are They? Enzymes are catalysts, molecules that lower the activation energy barrier required for a reaction to occur. Thus, catalysts speed up chemical reactions Enzymes are proteins or nucleic acids (RNA). Enzymes made of RNA are called ribozymes Enzymes carry the suffix ase Enzymes are substrate specific Bacillus licheniformis α-amylase (1BLI)  Enzymes: Specificity of Substrate The reactant an enzyme acts on is referred to as the enzyme’s substrate The enzyme binds to the substrate, thus forming α-amylase the enzyme-substrate complex The reaction catalyzed by the enzyme produces end products Substrate + Enzyme End Product (s) starch Enzymes: Specificity of Substrate Enzymes: Specificity of Substrate Sucrase catalyzes the hydrolysis of sucrose into glucose and fructose  In the reaction below, ___ is sucrase’s substrate. sucrase 33% 33% 33% 1. sucrose 2. glucose 3. fructose e se e s os to o uc cr uc su gl fr  How Enzymes Work: The Active Site An enzyme recognizes its substrate through a restricted region of its molecular structure, the active site The active site fits tightly the substrate’s conformation. After fitting, the enzyme-substrate complex forms Disrupting the active site’s molecular composition or conformation results in the enzyme’s inactivation How Enzymes Work: An Enzymatic Reaction  Factors Influencing Enzyme Activity Concentration: In general, the more concentration of substrate, the more frequently the enzyme’s active site interact. However, high concentrations of substrate can saturate the enzyme Temperature and pH: Enzymes are very sensitive to slight changes of pH and temperature. Each enzyme has an optimal value of pH and temperature to which is most active Enzyme regulation  Enzyme Regulation Competitive Regulation Competitive Inhibition of enzyme activity is carried out by a competitive inhibitor that binds to the active site, thus blocking the access of the substrate to it  Enzyme Regulation Non- Competitive or Allosteric Regulation Non-competitive or allosteric regulation is carried out by a non- competitive inhibitor that binds to a site in the enzyme other than the active site, the so called allosteric site Non-competitive or allosteric regulators do not compete with the substrate for the active site. They alter the enzyme’s conformation Allosteric regulation can render rearrangement of the active site (end products are produced), or change of the active site’s conformation (blocking of enzyme activity; release of end products ceases)  Enzyme Regulation Feedback Inhibition In feedback inhibition, a metabolic pathway is switched off by molecules that regulate the activity of the enzyme or enzymes intervening in the pattern. In feedback inhibition, the regulatory molecules are the end product(s). They can perform competitive or allosteric inhibition upon the enzyme  A competitive inhibitor binds to the enzyme’s active site. Do you agree? 50% 50% 1. Yes 2. No s o Ye N A non-competitive inhibitor binds to the enzyme’s active site. Do you agree? 50% 50% 1. Yes 2. No s o Ye N Allosteric regulation involves a non- competitive inhibitor. Do you agree? 50% 50% 1. Yes 2. No s o Ye N  Nucleic Acids: DNA & RNA DNA: The cookbook RNA: The Cook DNA Structure and DNA Replication DNA and Chromosomes DNA and Chromosomes How many chromosomes do humans have? 20% 20% 20% 20% 20% 1. 46 2. 46 pairs 3. 23 4. 23 pairs rs rs 4 46 23 5. 1 and 4 d i i pa pa an 46 23 1  Genes Are Stretches of DNA (deoxyribonucleic acid) Genes are instructions for producing a trait Locus is the spot each genes has on a chromosome A gene is a stretch of DNA DNA as Hereditary Material The Structure of DNA Is Revealed Rosalind Franklin James Watson and Francis Crick RNA and DNA are Nucleic Acid: Nucleic Acids Are Made of Nucleotides RNA is a single-stranded molecule DNA is a double-stranded molecule  DNA Structure DNA is a stretch of nucleotides made each of a deoxyribose, a nitrogen containing base (A, T, G, C), and a phosphate group The molecule is structured as a double helix constituted by two strands.  A nucleotide is made of: 33% 33% 33% 1. phosphate group + nitrogenous base 2. phosphate group + nitrogenous base + sugar.... n. n.... 3. nitrogenous base + sugar + + + p p se ou ou ba gr gr s te te ou a a en ph ph g os os tro ph ph ni DNA Structure: The Double Helix  How Is the Helix Held? Hydrogen bonds establish between complementary nitrogen containing bases (A-T, C-G) Purines (A, G) bond to pyrimidines (T, C) A establishes two hydrogen bonds with T G establishes three hydrogen bonds with C Let’s Do the Complementary Strand To: 5’ AATCGTAGTGCCATTAGTGTACACT 3’ A–T G–C Adenine establishes two hydrogen bonds with thymine. Do you agree? 50% 50% 1. Ye s 2. No s o Ye N Guanine establishes three hydrogen bonds with thymine. Do you agree? 50% 50% 1. Ye s 2. No s o Ye N How many cytosines will be found in a molecule of DNA that has 422 guanines? 25% 25% 25% 25% 1. 422 2. 211 3. 844 4. 1,688 88 2 1 4 42 21 84 16 DNA Replication DNA Replication: When Does It Happen? During S Phase Chromosomes Duplicate (DNA Replication) DNA Replication DNA Replication  Let’s Replicate DNA 5’ AATCGTAGTGCCATTAGTGTACACT 3’ DNA Replication: Replication Forks  Enzymes and Proteins Involved in DNA Replication Helicase: unwind double helix Single-strand binding proteins Primase: adds RNA primer DNA Polymerase: adds nucleotides 5’ to 3’ DNA Ligase: joints Okazaki fragments  Replication of The Leading Strand DNA polymerase copy the leading strand in a 5’ to 3’ direction The elongation of the leading strand is continuous, and towards the direction of opening of the replication fork DNA Replication: How Does It Happen?  Replication of The Lagging Strand Primase initiates multiple RNA primers in order to duplicate the entire lagging strand The replication of the lagging strand is discontinuous, through multiple segments (Okazaki fragments). It proceeds away from the direction of opening of the replication fork DNA ligase joints Okazaki fragments  continuous replication : 5’ to 3’: DNA 1. DNA lagging 33% 33% 33% strand 2. DNA leading strand 3. RNA d A d n n N ra ra R st st ng n g di gi a g le la A A N N D D  discontinuous replication : 3’ to 5’: DNA: Okazaki fragments 1. DNA lagging 33% 33% 33% strand 2. DNA leading strand 3. Replication does not occur 3’ to 5’ d d n n. t.. ra ra no st st ng g es n do di gi a g n le la io A A at N N lic D D ep R Protein Synthesis  Protein Synthesis How Genes Become Constituent Molecules  Protein Synthesis How Genes Become Constituent Molecules  Protein Synthesis: What Is It? All proteins are synthesized according to instructions contained in the DNA nucleotide sequence, which is unique to every individual Protein synthesis is a two step process that consists of transcription and translation.  Protein Synthesis: Steps During transcription a molecule of messenger RNA (mRNA) is synthesized according to instructions provided by the DNA During translation, a polypeptide chain will be produced according to instructions provided by the mRNA  Protein Synthesis in Prokaryotes In prokaryotes, transcription and translation occur in the same cellular compartment — the cytosol. Ribosomes are the site of translation  Protein Synthesis in Eukaryotes In eukaryotes, mRNA is synthesized in the nucleus from pre-messenger RNA (pre- mRNA) molecules, and then shipped to the cytoplasm, where translation occurs RNA processing (or post- transcriptional modification) refers to the molecular mechanisms that lead to the production of mRNA from pre- mRNA.  The main difference between protein synthesis in eukaryotes and in prokaryotes is: 33% 33% 33% 1. where the process happens........ th h. pr 2. what the process produces in s ss es s nt e oc oc pa 3. the participants in the process pr pr i ic e he th rt pa tt re ha he e th w w  This cartoon represents: 33% 33% 33% 1. protein synthesis in eukaryotes......... in 2. translation in prokaryotes in ar s ok s si si pr he he 3. protein synthesis in in nt nt sy n sy prokaryotes io n n at ei ei sl ot ot an pr pr tr  Protein Synthesis: From Gene to Protein Genes are stretches of nucleotides organized in triplets Different arrangements or DNA triplets encode for each one of the 20 amino acids that make proteins During transcription, a DNA triplet will produce an mRNA codon. During translation, a codon will constitute an amino acid Protein Synthesis: From Gene to Protein DNA Transcription mRNA Translation Protein  Transcription: Eukaryotic Promoters In eukaryotes, promoters are activated by DNA binding proteins or transcription factors TATA boxes are segments of about 30 base pairs to which RNA polymerase binds  Transcription: What Is It Transcribed? RNA polymerase binds to the gene’s promoter region and starts making a molecule of mRNA until it finds a “mark” in the gene or termination sequence. The term transcription unit refers to the segment of DNA between the sites of initiation and termination of transcription by RNA polymerase. More than one gene may reside in a transcription unit. Transcription: Initiation Nascent mRNA: RNA transcript Transcription: Elongation  Transcription: Elongation RNA is synthesized according to DNA/RNA base pairing rules: A (DNA) — U (RNA) G (DNA) — C (RNA) T (DNA) — A (RNA) C (DNA) — G (RNA  The Making of an mRNA DNA 5’ ATTGCGTAGTGGGATTAT 3’ RNA Transcription: Termination  RNA polymerase : RNA transcript : unwound DNA 33% 33% 33% 1. transcription’s initiation n 2. transcription’s.. tio. g. i.. rm on a iti el te in elongation s s s n’ n’ n’ tio tio tio r ip r ip r ip sc sc sc 3. transcription’s an an an tr tr tr termination  RNA polymerase : promoter : transcription unit 33% 33% 33% 1. transcription’s initiation n 2. transcription’s.. tio. g. i.. rm on a iti el te in elongation s s s n’ n’ n’ tio tio tio r ip r ip r ip sc sc sc 3. transcription’s an an an tr tr tr termination  This cartoon illustrates: 33% 33% 33% 1. transcription’s initiation n 2. transcription’s.. tio. g. i.. rm on a iti el te in elongation s s s n’ n’ n’ tio tio tio r ip r ip r ip sc sc sc 3. transcription’s an an an tr tr tr termination  Transcription in Eukaryotes. Post- transcriptional Modifications: RNA Capping and Splicing Eukaryotic transcripts (pre-mRNA) contains exons (coding sequences) and introns (non coding sequences) Post-transcriptional modifications (i.e. splicing) remove introns before shipping the final mRNA to the cytoplasm and label RNA for export into the cytoplasm (RNA capping)  Transcription in Eukaryotes: Splicing of pre-mRNA Molecules Spliceosomes are organelles in which the excision and splicing reactions that remove introns from pre-mRNA occur Ribozymes and small nuclear RNAs (snRNA) are contained in spliceosomes Transcription in Eukaryotes: Splicing of pre-mRNA Molecules Introns are not translated. 50% 50% 1. True 2. False ue e ls Tr Fa Splicing only occurs in eukaryotes. 50% 50% 1. True 2. False ue e ls Tr Fa Translation: Production of Polypeptide Chains  Translation: transfer RNA (tRNA) Every transfer RNA (tRNA) has a specific sequence of nucleotides, complementary to an mRNA codon — the anticodon. Opposite to the anticodon, there is an attachment site specific for each of the 20 amino acids. Translation: transfer RNA (tRNA)  Translation: mRNA/tRNA Interaction The recognition of codon (mRNA) and anticodon (tRNA) occurs in the ribosomes. Ribosomes have sites of tRNA anchorage and exiting A growing polypeptide will be produced following instructions in the mRNA  Translation: Initiation and Elongation of the Polypeptide Chain A start codon (AUG) complements with the Methionine (Met) tRNA in the ribosome, constituting the translation initiation complex A new anticodon will land in the A site, and its amino acid will join Met. The tRNA will slide to the P site leaving the A site free for another anticodon Translation: Initiation and Elongation of the Polypeptide Chain  Translation: Termination A stop codon (UAG, UAA, or UGA) signals the end of the mRNA molecule. A release factor triggers the disassembling of the two ribosomal units and the mRNA molecule. Gene Expression Cell Structure and Function Eukaryotic Cell: Neuron Cell Structure and Function Eukaryotic Cells: Blood Cells  Cell Structure and Function All living organisms are made of cells. A cell is a small, membrane enclosed structure filled with an aqueous solution where organelles and other subcellular structures are found. Cells are of different size and shape The cell’s size and shape can be related to its specific function. From Prokaryotes to Eukaryotes  From Prokaryotes to Eukaryotes It is thought that all organisms living now on Earth are derived from a single cell born 3,500 millions of years (my) ago. This primordial cell was defined by an outer membrane ― one of the crucial events leading to the establishment of life on Earth Simple organic molecules are likely to have been produced in the conditions that existed on the Earth in its infant state (approximately during its first billion years)  Structural Features of Cells: Outside Covers All cells have a plasma or cell membrane, which contains the cell Plant cells and most bacteria have an Adipose Cells (Ad) outermost additional layer, the plant cell wall and the bacterial cell wall respectively Plant Cell Wall  Outside Covers: The Plant Cell Wall The plant cell wall is the outermost layer of plant cells It provides extra protection to the plant and cohesiveness among neighbor plant cells. Why do plants need these extra features? Cell walls of adjacent plant cells are in close communication through plasmodesmata Structural Features of Cells: Prokaryotic Cells Electron Micrograph of Bacteria (Cross and Longitudinal Sections) Structural Features of Cells: Inner Structures of Prokaryotic Cells No nucleus or membrane-enclosed organelles in prokaryotic cells. Ribosomes present.  Which one of these would not be found in a prokaryotic cell? 1. ribosomes 25% 25% 25% 25% 2. cell membrane 3. nucleus 4. DNA e A es s an eu N om D br cl os nu em r ib m ll ce Structural Features of Cells: Inner Structures of Eukaryotic Cells Pancreatic Cell: In Eukaryotic Cells, Nucleus, Cytoplasm, and Membrane- bounded Organelles Are Present  Inner Structures of Eukaryotic Cells: The Nucleus The nucleus of eukaryotic cells is contained by the nuclear envelope, which is made of two membranes (inner and outer) decorated with pore complexes Inside the nucleus, chromatin (DNA + DNA associated proteins) and a nucleolus are present The nuclear lamina (made of intermediate filaments) covers the inner nuclear membrane, helping in the maintenance of nuclear shape The nucleus hosts the genetic material (DNA and RNA) Inner Structures of Eukaryotic Cells: The Nucleus Transmission Electron Micrograph (TEM) of Freeze Fracture Replica of a Nucleus: Outer Hemocyte Nucleus Membrane and Pore Complexes Some Eukaryotic Cells Lose Their Nucleus as They Mature TEM of Human Enucleated Erythrocytes (Er)  “Nuclear envelope” refers to: 25% 25% 25% 25% 1. outer nuclear membrane 2. nuclear pore complexes e es e an ov. 3. outer and inner nuclear l.. ex br uc ab pl em membrane and pore rn m e th co rm ne of complexes in e ea or ne nd cl rp no nu ra 4. none of the above ea te r cl te ou nu ou Inner Structures of Eukaryotic Cells: Cytoplasmic Membrane- bounded Organelles Animal Cell Plant Cell  Different Cytoplasmic Organelles Perform Distinct Cell Functions Production, circulation, storage, and delivery of substances produced or taken by the cell (those organelles constitute the endomembrane system) Production of energy Movement and maintenance of the cell’s shape Chloroplasts in Plant Cells Different Cytoplasmic Organelles Perform Distinct Cell Functions Organelles of Animal Cells Different Cytoplasmic Organelles Perform Distinct Cell Functions Organelles of Plant Cells  Organelles of the Endomembrane System  Organelles of the Endomembrane System: Endoplasmic Reticulum (ER) Pancreatic Cell: In Eukaryotic Cells, Nucleus, Cytoplasm, and Organelles Are Present. ER, Endoplasmic Reticulum  Organelles of the Endomembrane System: Endoplasmic Reticulum (ER) The ER is constituted of smooth (SER) and rough (RER) regions. Both animal and plant cells have SER and RER  Organelles of the Endomembrane System: Endoplasmic Reticulum (ER) The ER is a membrane bounded organelle. The smooth and rough regions of the ER are interconnected Smooth ER lacks ribosomes. It is a network of pipe-like interconnected tubes. Functions of the SER include synthesis of lipids, processing of sugars, and detoxification of drugs and poisons Rough ER has bound ribosomes attached to the outside. The RER is in fact an extension of the outer nuclear membrane. Functions of the RER include anchorage of newly synthesize proteins, and the finishing of proteins Organelles of the Endomembrane System: Golgi Apparatus The Golgi Apparatus is a single membrane-bounded organelle constituted of piled sac-like cisternae. Both animal and plant cells have Golgi Apparatus  Organelles of the Endomembrane System: Golgi Apparatus The Golgi Apparatus receives, packs, and ships vesicles coming from the ER, or from other parts of the cell back to the ER Vesicles arriving from the ER (on cis side) coalesce in the Golgi apparatus, where they mature and form new vesicles that would be shipped (from trans side) to other cell locations Organelles of the Endomembrane System: Vesicles and Lysosomes Transport and Secretory Vesicles (single membrane- bounded organelles). Both animal and plant cells have transport vesicles Organelles of the Endomembrane System: Vesicles Pancreatic Secretory Cell: Basal and Apical Parts Organelles of the Endomembrane System: Vesicles and Lysosomes Lysosomes are typical of animal cells; lysosomes are vesicles that contain hydrolytic enzymes. Tay-Sachs is an autosomal recessive disease caused by mutations in lysosomal enzymes How Do Vesicles, Lysosomes, and Vacuoles Move? Cytoskeletal elements and motor proteins interact with the vesicle’s surface receptor proteins. Such interaction leads to vesicle movement.  Organelles of the Endomembrane System: Central Vacuole Mature plants generally contain a large central vacuole that may occupy 50-90% of the cell’s interior The central vacuole is a single membrane- bounded organelle. Such cell membrane is termed tonoplast The central vacuole stores a variety of organic and inorganic compounds  Organelles of the Endomembrane System Plasma Membrane and Nuclear Envelope Endoplasmic Reticulum (SER, RER) Golgi Apparatus Transport, Secretory Vesicles, and Vacuoles Lysosomes (only in animal cells) Central Vacuole (only in plant cells) Energy- Producing Organelles Energy- Producing Organelles: Mitochondria Mitochondria are double membrane- bounded organelles present in nearly all eukaryotic cells (plant, animals, fungi, etc.). Mitochondria process macromolecules to obtain energy through a process termed aerobic respiration. Mitochondria have their own DNA (mitochondrial DNA, mDNA) and ribosomes in their matrix.  Energy- Producing Organelles: Chloroplasts Chloroplast are plastids that contain the green pigment chlorophyll along with other photosynthetic pigments. Chloroplasts perform photosynthesis Chloroplasts are double membrane-bounded organelles present in plant cells. In the stroma, chloroplast DNA and ribosomes can be found Energy- Producing Organelles: Chloroplasts If a cell did not have mitochondria, it would be unable to: 25% 25% 25% 25% 1. move 2. produce energy 3. synthetize lipids and ve e gy ov... o er move vesicles ab an m en he s e id uc ft 4. all of the above lip lo od e al tiz pr he nt sy  Shape Maintenance and Movement- Producing Organelles  Movement- Producing Organelles and Cytoskeleton Motion of vesicles provided by cytoskeleton Motion produced by cilia or flagella Amoeboidal movement provided by cytoskeleton Movement- Producing Organelles and Cytoskeleton Skeletal Muscle and Cardiac Muscle Shape Maintenance and Movement- Producing Organelles and Cytoskeleton: The Cytoskeleton  Movement- Producing Organelles and Cytoskeleton: The Cytoskeleton Microtubules grow out from a centrosome, a microtubule- organizing region. In animal cells, the centrosome contains a pair of centrioles Centrioles are made of nine triplets of microtubules  Movement- Producing Organelles and Cytoskeleton: Cilia and Flagella Cilia and flagella are extensions of the plasma membrane that contain an array of nine pairs of peripheral microtubules and a central one (9+2 array). Cilia and flagella are rooted on the basal body, constituted of nine peripheral triplets of microtubules. Cilia are shorter than flagella  Movement- Producing Organelles and Cytoskeleton: Flagella Flagella propel the cell (flagellated cell) in a whip-like motion Sperm cells of animals, plants, and algae are flagellated Sperm Cells in Seminiferous Tubules  Movement- Producing Organelles and Cytoskeleton: Cilia Cilia provide movement to free-swimming eukaryotic unicellular organisms (i.e. Paramecium) In multicellular organisms, they generally constitute ciliated epithelia (i.e. trachea and oviducts). What is the function of these ciliated epithelia? Ciliated Cells in Tracheal Epithelia This organelle belongs to the endomembrane system. Do you agree? 50% 50% 1. Yes 2. No s o Ye N This organelle belongs to the endomembrane system. Do you agree? 50% 50% 1. Ye s s o Ye 2. No N This organelle belongs to the endomembrane system. Do you agree? 50% 50% 1. Yes 2. No s o Ye N Membrane Structure and Function Eukaryotic Cell: Neuron Membrane Structure and Function All cells have a plasma or cell membrane, which contains the cell. Scanning electron micrograph (SEM) of adipocytes (Ad) The Formation of Cell Membranes is Essential to Life  Functions of the Cell Membrane Contains the cell Regulates the traffic of molecules and substances in and out of the cell (semi- permeable membrane) Structural and molecular support for cell communication  Major Components of the Cell Membrane The major constituents of the cell membrane are proteins and lipids Membrane proteins and lipids are arranged in a particular fashion, both contributing to containing the cell and to selectively allowing or blocking the traffic of certain substances through the cell Such arrangement of molecules provides fluidity (elasticity) to the cell membrane  Major Components of the Cell Membrane: Lipids Phospholipids are amphipathic molecules (with hydrophobic tails and a hydrophilic head) One of the phospholipid tails exist mostly in a trans configuration, providing more fluidity to the membrane Cholesterol is a rigid molecule that makes membranes less fluid Cholesterol  How Are Phospholipids Organized in the Cell Membrane? Phospholipids constitute two mirror-image oriented layers — the lipid bilayer The hydrophilic heads are exposed to the high- content water regions, while the hydrophobic tails constitute a barrier impenetrable to almost all substances  Major Components of the Cell Membrane: Membrane Proteins Membrane proteins are embedded in the fluid matrix of the lipid bilayer More than 50 types of proteins have been found in the plasma membrane. Membrane proteins determine most of the membrane specific functions Transport proteins, enzymes and receptor proteins (membrane proteins that interact with other cells or molecules) include the vast majority of membrane proteins Major Components of the Cell Membrane: Organization  Functions of the Cell Membrane Contains the cell Regulates the traffic of molecules and substances in and out of the cell (semi- permeable membrane) Structural and molecular support for cell communication  Traffic of Substances Across the Plasma Membrane Selective: only a few molecules can go through the lipid bilayer. Transport proteins mostly determine what substances cross the cell membrane, as they carry out the majority of membrane transport  Traffic of Substances Across the Plasma Membrane Bidirectional: only a few molecules can go through the lipid bilayer. Transport proteins determine what substances cross the cell membrane. Transport can occur in/out or out/in  Traffic of Substances Across the Plasma Membrane Depending Upon Differences of Concentration Inside and Outside of the Cell: Osmosis and diffusion are the two main processes by which molecules move across the cell membrane  Traffic of Substances Across the Plasma Membrane: Diffusion Diffusion is the movement of substances from an area of high concentration of solutes to an area of low solute concentration (down to a concentration gradient)  Traffic of Substances Across the Plasma Membrane: Diffusion Draw a situation where a molecule of NaCl will enter the cell. Assume that a transport protein is needed Is the extracellular environment hypo-, hyper-, or isotonic? Direction of water? In this situation, will a molecule of NaCl enter the cell? 50% 50% [NaCl] = 1.1 mg/ml [NaCl] = 1.9 mg/ml s o Ye 1. Ye N s 2. N  Traffic of Substances Across the Plasma Membrane: Osmosis Osmosis is the movement of water and some small molecules through a semi-permeable membrane from areas of low concentration of solutes to areas of high concentration of solutes Why does water move in that particular direction?  Traffic of Substances Across the Plasma Membrane: Osmosis Draw a situation where the extracellular environment is such that water flows out of the cell Is the extracellular environment hypo-, hyper-, or isotonic? In this situation, will water flow out of the cell? 50% 50% [NaCl] = 1.1 mg/ml [NaCl] = 0.03 mg/ml s o Ye 1. Ye N s 2. N  Traffic of Substances Across the Plasma Membrane: Osmotic Shock  Traffic of Substances Across the Plasma Membrane: Facilitated Diffusion Facilitated diffusion is a protein-mediated passive (no energy required) diffusion of molecules across the cell membrane Transport proteins carry out facilitated diffusion; facilitated diffusion is very selective, as each transport protein transports just one type of molecule  Traffic of Substances Across the Plasma Membrane: Active Transport Active transport is a protein- mediated transport of molecules across the cell membrane against a concentration gradient (low to high solute concentration areas). It requires a boost of energy (ATP) to occur. As facilitated diffusion, is very selective Glucose is actively transported through the plasma membrane of intestinal cells  Bulk Transport of Substances Across the Plasma Membrane: Exocytosis and Endocytosis Pancreatic Secretory Cell: TEM Types of Endocytosis: Phagocytosis In phagocytosis (“cell eating”), a cell engulfs a particle or another cell through the emission of pseudopodia, and packs it into a vacuole. The contents of the vacuole is digested after the vacuole fuses with a lysosome Phagocytosis of erythrocytes (Er) by blood macrophages (Ma).  Types of Endocytosis: Pinocytosis In pinocytosis (“cell drinking”), the cell takes in droplets of extracellular fluid into small vesicles. Many molecules enter the cell dissolved in the droplets in a non-specific manner  Types of Endocytosis: Receptor- Mediated Endocytosis Receptor-mediated endocytosis requires of specific receptor proteins located in the cell membrane. Cell receptors interact with the molecule to be transported into the cell through a ligand — a molecule that binds specifically to the receptor Receptor-mediated endocytosis is highly specific. Human cells use receptor-mediated endocytosis to take in cholesterol. Some viruses (i.e. HIV virus) enters the cell through receptor- mediated endocytosis Mutations in receptor proteins involved in receptor-mediated endocytosis usually block the entrance of substances meant to be transported by this process (i.e. natural HIV immunity, familial hypercholesterolemia) The arrows point to a process of: 33% 33% 33% is is os s... to yt d y te oc oc ia ex ag ed ph m r- p to ce re 1. receptor-mediated endocytosis 2. exocytosis 3. phagocytosis The arrows point to a process of: 33% 33% 33% is is os s... to yt d y te oc oc ia ex ag ed ph m r- p to ce re 1. receptor-mediated endocytosis 2. exocytosis 3. phagocytosis Energy and Cellular Work Eukaryotic Cell: Neuron  Energy and Metabolism All Living Organisms Require Energy Sources  The Flow of Energy or How Organisms Relate Consumers or Heterotrophs Producers or Autotrophs (Photoautotrophs) Decomposers  The Flow of Energy or How Organisms Relate Photoautotrophs synthesize high energy organic molecules during photosynthesis Both photoautotrophs and heterotrophs use such organic molecules to obtain energy (ATP) through cellular respiration for fueling cellular work  Participants in Metabolic Pathways Substrate: Intermediate Product(s): End Product(s): Enzymes: Energy Carriers:  Adenosine 5’-triphosphate (ATP) What part of the molecule is the most electronegative? Hydrolysis of ATP into ADP Energy and inorganic phosphate are released. What for?  The ATP/ADP Cycle From Degradative Pathways For Synthetic Pathways Phosphorylation  Energy Releasing Pathways Anaerobic Respiration Anaerobic Respiration: 2 ATP’s produced. Commonly known diseases caused by anaerobic bacteria include gas gangrene, tetanus, and botulism. Nearly all dental infections are caused by anaerobic bacteria. Anaerobic bacteria can cause an infection when a normal barrier (such as skin, gums, or intestinal wall) is damaged due to surgery, injury, or disease. Body sites that have tissue destruction (necrosis) or a poor blood supply are low in oxygen and favor the growth of anaerobic bacteria. Anaerobic organisms perform anaerobic respiration Energy Releasing Pathways Fermentation Fermentation (alcoholic and lactic): 2 ATP’s produced. www.schmohz.com/beerinfo1.html Energy Releasing Pathways Fermentation Yeast  Energy Releasing Pathways Aerobic Respiration Aerobic Respiration: approximately 36 ATP molecules produced Aerobic organisms perform aerobic respiration Which one of the following is the most effective pathway for producing ATP? 33% 33% 33% 1. fermentation 2. anaerobic respiration 3. aerobic respiration n n n tio tio tio ira ra ta en pi sp s rm re re fe ic ic b b ro ro ae ae an  Depending on their oxygen needs, organisms are Strictly Aerobic: require oxygen Facultative Aerobic Strictly Anaerobic: do not tolerate oxygen Facultative Anaerobic Steps of Aerobic Respiration Where does aerobic respiration occur?  Steps of Aerobic Respiration: Glycolysis All organisms (anaerobic and anaerobic) break down glucose trough the process of glycolysis, which occurs in the cell’s cytoplasm Only aerobic organism process the products of glycolysis to obtain further amounts of ATP Glucose is actively transported into the cell and phosphorylated (step 1), process that turns on glycolysis  Steps of Aerobic Respiration: Glycolysis 2 molecules of pyruvate are produced per molecule of glucose A net of 2 ATP per molecule of glucose are produced in glycolysis  Steps of Aerobic Respiration: Krebs Cycle The Krebs cycle accomplishes two important functions: the production of multiple intermediate products, and of electron donors (NADH, FADH2)  Steps of Aerobic Respiration: Krebs Cycle The Krebs Cycle occurs in the mitochondrial matrix It is initiated when one molecule of pyruvate is transported into the mitochondrion by an oxygen dependent transport protein Upon entering the mitochondrion, pyruvate is turned into acetyl CoA, which initiates the cycle CO2 is produced and will eventually leave the mitochondrial matrix and collect in blood vessels  Steps of Aerobic Respiration: Krebs Cycle Per molecule of pyruvate, 1 ATP, 1 FADH2, 3 CO2, and 4 NADH are produced NADH and FADH2 will initiate the last step of aerobic respiration, the electron transport phosphorylation system (ETPS).  Steps of Aerobic Respiration: ETPS ETPS consists of a series of proteins located in the inner mitochondrial membrane NADH and FADH2 link glycolysis and the Krebs cycle to the machinery that produces large amounts of ATP NADH and FADH2 turn on the ETPS. Electrons cascade down the chain from one protein to the next until they finally reach the molecule of oxygen, the final acceptor As electrons cascade down, protons are released  Steps of Aerobic Respiration: ETPS As proteins release H+ in the intermembrane space, they produce a gradient of H+, which activates ATP synthase, the enzyme that produces about 32-34 ATP molecules. Chemiosmosis refers to the activation of ATP synthase by a H+ gradient. Steps of Aerobic Respiration: ETPS Plants need to burn sugars and fats to obtain ATP. Do you agree? 50% 50% s o Ye N 1. Yes 2. No Other molecules other than sugars undergo aerobic respiration Photosynthesis  Photosynthesis: What is it? Photosynthesis is the production of organic molecules utilizing light energy Photoautotroph organisms do photosynthesis Photosynthesis: When Did It Start? What Organisms First Did Photosynthesis? Photosynthetic Bacteria: http://www-micro.msb.le.ac.uk/video/Cyanobacteria.html  What Organisms Do Photosynthesis? Photosynthetic Bacteria Plants Algae  The Flow of Energy or How Organisms Relate Consumers or Heterotrophs Producers or Autotrophs (Photoautotrophs) Decomposers  The Flow of Energy or How Organisms Relate Photoautotrophs synthesize high energy organic molecules during photosynthesis Both photoautotrophs and heterotrophs use such organic molecules to obtain energy (ATP) through cellular respiration for fueling cellular work Plants need to burn sugars and fats to obtain ATP. Do you agree? 50% 50% s o Ye N 1. Yes 2. No  What is Photosynthesis? Photosynthesis is:  Where Does Photosynthesis Occur? Photosynthesis is carried out by pigments located in the thylakoid membranes of chloroplasts The plant organs that contain the largest amount of chloroplasts are the leaves  What Molecules Perform Photosynthesis? Photosynthetic pigments (chlorophyll a, chlorophyll b, and several different types of carotenoids) are the molecules that transform light energy into chemical energy. Chlorophyll a is the most efficient photosynthetic pigment Pigments absorb different wavelengths. The amount of energy absorbed is inversely related to the wavelength of light; the shorter the wavelength is, the greater the energy of each photon in that wavelength  Photosynthetic Pigments: How Do They Work? When a molecule absorbs a photon (unit of energy light), one of the molecule’s electrons is pushed from its ground state to an orbital more distant from the nucleus – to the excited state. As the electron goes back to its original orbital, it releases energy that can be used to turn on photosynthesis Reactions in Photosynthesis: Light Reactions and Dark Reactions Light Reactions are also referred to as Light Dependent Reactions Dark Reactions are also referred to as Light Independent Reactions  Light Dependent Reactions: Photoexcitation of Chlorophyll a Light harvesting complexes consist of many pigments that function together to transfer light energy and excited electrons to chlorophyll a, located in the reaction center A primary acceptor receives the electron and turns on the light reactions of photosynthesis Photolysis of water molecules also release excited electrons that contribute to the light reactions  Light Dependent Reactions: Production of ATP and NADPH Pq: Plastoquinone; Pc: Plastocyanin; Fd: Ferredoxin  Light Dependent Reactions: Production of ATP and NADPH  Light Dependent Reactions: Production of ATP and NADPH Light Independent Reactions: Production of Glucose Production of Glucose: The Calvin Cycle During photosynthesis, ATP is produced in: 25% 25% 25% 25% e 3... cl.. d a. cy an re re nt n 2 nt vi de de al en n C pe ep de d in t gh t gh 1. Light dependent reactions Li Li 2. Light independent reactions 3. Calvin cycle 4. 2 and 3  During photosynthesis, glucose is produced in: 33% 33% 33% e... cl.. a. cy re re nt n nt vi de de al en n C pe ep de 1. Light dependent reactions d in t gh t gh Li 2. Light independent reactions Li 3. Calvin cycle Cell Cycle and Cell Division  Why Do Cells Divide? Reproduction Growth and Development Tissue Renewal The Cell Cycle  Chromosomes Duplicate During the S Phase During the S phase all the chromosomes duplicate When a chromosome duplicates, it produces a replica chromosome referred to as chromatid or sister chromat