Epigenetics - Student Copy PDF

24/01/2024 XY3121 Molecular Medicine Epigenetics 29.01.24 SGM104 Dr Harry Potter [email protected] 1 *Available free online through UCLan Library Search Recommended...

24/01/2024 XY3121 Molecular Medicine Epigenetics 29.01.24 SGM104 Dr Harry Potter [email protected] 1 *Available free online through UCLan Library Search Recommended reading Textbook: Introduction to Epigenetics* by Paro, Grossniklaus, Santoro, and Wutz. Chapter 1 – Biology of Chromatin, p1-28. Review: Ren, L., et al. (2023). Recent advances in epigenetic anticancer therapeutics and future perspectives. Front. Genet. 13:1085391. Primary research: Hill, R. A., et al. (2023). Maternal SARS-CoV-2 exposure alters infant DNA methylation. BBI Health. 27:100572. 2 1  24/01/2024 01 Lecture aims 1. Define epigenetics and epigenetic modifications and describe the mechanistic link between epigenetics and disease risk. 2. Explain the molecular basis of epigenetic modifications including DNA methylation and histone modifications. 3. Describe how the main epigenetic modifications can be measured and the limitations of such strategies. 4. Associate epigenetic modifications with disease pathophysiology and treatment development. 3 02 What is epigenetics? (1) Discussion (pairs; 5 mins) Cell type 1: Cell type 2: Microglia You pick Compare & contrast: 1. Function(s) of cell? 2. Location(s) of cell? The same or different: 3. DNA content? 4. RNA expression? e.g. from XY2011 Immunology (semester 3) 5. Protein expression? 4 2  24/01/2024 02 What is epigenetics? (2) Pluripotent stem cell Waddington’s “epigenetic Gradual loss of landscape” generic functions (1942) Gradual gain of specific functions Microglia Kupffer cell Erythrocyte Neutrophil 5 02 What is epigenetics? (3) Why do twins, who How does exposure to share 100% of their Why do XX females environmental genes, have not express genes stressors (e.g. different risk for twice as much as XY inflammation, diet) developing chronic males? change my risk for diseases? developing diseases? 6 3  24/01/2024 02 What is epigenetics? (4) ‘Nature vs nurture’ argument can be expanded. - The interaction between genetic and environmental factors determines risk (or resilience) to disease. - Gene x environment interactions (GxE). - Environmental factors can be further split depending on critical developmental periods. - Epigenetics encompass the molecular Figure from H. Potter PhD thesis mechanisms that mediate this. 7 02 What is epigenetics? (5) – definitions ‘Epi’ – over, above, outer. Central dogma of molecular biology? Epigenetics – stable & heritable changes to gene expression without alterations in the DNA sequence. DNA Epigenomics – the study of the complete set of epigenetic alterations. RNA Epigenetic code – epigenetic features that maintain different phenotypes in different cells. Protein 8 4  24/01/2024 2 minute break 9 03 Gene expression (1) Determines cell function, following translation of mRNA to protein. What molecular factors affect gene expression? - Q: why don’t cardiomyocytes express proteins relating to synaptic function? - Is the genetic material physically accessible? - Can relevant enzymes bind? - Is protein translation possible? 10 5  24/01/2024 03 Gene expression (2) 11 04 Chromatin structure (1) DNA has several ‘levels’ of structure. - Basic structure is ‘naked’ DNA. - Histones = protein clusters. - Nucleosomes = histones + DNA. Euchromatin “open” DNA ‘availability’ is determined by Nucleosome how tightly DNA is wrapped around Heterochromatin histones. “closed” 12 6  24/01/2024 04 Chromatin structure (2) - histones Highly conserved protein complexes that allow DNA to be condensed. - Nucleosome = histone octamer, containing dimers of: - H2A, H2B, H3, H4 (core octameric protein). - Plus one H1 monomer acts to pack nucleosome more tightly. Forms a ‘beads DNA wraps on a string’ around histone structure octamer 146 bp wrap octamer (1.65 loops per nucleosome) 13 04 Chromatin structure (3) - histones 14 7  24/01/2024 04 Chromatin structure (4) - chromatin Tightness of packing determines ‘openness’ or ‘availability’ of DNA. Euchromatin Heterochromatin Euchromatin - Tightly packed - Loosely packed - Closed structure Nucleosome - Open structure - Decreased gene - Increased gene expression expression Heterochromatin Why does this matter? - Q: can relevant enzymes bind … to facilitate mRNA transcription? 15 04 Chromatin structure (5) - chromatin Q: can relevant enzymes bind … to facilitate mRNA transcription? A: determined by epigenetic modifications, largely* relating to: (*but not exclusively) 1. Modifications above/over (‘epi…’) 2. Modifications to histone the DNA structure (‘…genetics’) proteins (determines ‘openness’) 16 8  24/01/2024 05 Introduction to epigenetics – video (part 1) 17 06 DNA methylation (1) – what is it? methyl group Chemical modifications to the DNA structure. - Primarily methylation, but also others (e.g. hydroxymethylation). Does not change the base pair sequence. Mediated by DNA methyltransferase (DNMT) enzymes. CTGATCCGTGACTATCGAGTACG DNA methylation (by DNMTs) CTGATCCGTGACTATCGAGTACG Q: which cytosine residues can be methylated? 18 9  24/01/2024 06 DNA methylation (2) – where is it? Cytosines directly next to a guanine residue can be methylated. - CpG dinucleotides. - The cytosine is methylated. Some areas of the genome have lots of CpG sites: - CpG islands. Q: what does CpG methylation do? Key: yellow = CpG dinucleotide; black = any other nucleotides 19 06 DNA methylation (3) – where is it? 20 10  24/01/2024 06 DNA methylation (4) – where is it? 28 million CpG regions in the genome. - 60-80% are heavily methylated. CpG islands: - 100-2000bp enriched for CpG. - Often found at promoters to control gene expression. - Act as gene promoter ‘traffic lights’: 21 06 DNA methylation (5) – what does it do? Physically prevents RNA polymerase binding to DNA. - Prevents/reduces mRNA transcription. 22 11  24/01/2024 06 DNA methylation (6) – how can we measure it? Enzyme-linked immunosorbent assay (ELISA). - Specific antibodies that bind to CpG residues. - You will need to review ELISAs from XY2011! - Low sensitivity, low gene specificity. Bisulfite sequencing. - Chemical modification of DNA sample. - Converts unmethylated cytosines to uracil. - Methylated cysotine remains unchanged. - Quantify % cytosine in DNA samples. - Gene specific, but low throughput technique. 23 06 DNA methylation (7) – why does it matter? Whole genome (‘global’): - e.g. novel biomarker for adult ADHD and bipolar disorder comorbidities? - Blood sample global DNA methylation shows distinct phenotypic clusters. Gene-specific (e.g. RASSF1A): - Hypermethylation of CpG islands in some cancers. - CpG islands in promoters of tumor suppressor genes. - Tumor suppressor genes are inactivated. - Tumors are able to grow (e.g. carcinoma, melanoma). 24 12  24/01/2024 06 DNA methylation (8) – limitations Epigenetic modifications are cell-type specific and determine function. Accessibility of tissue samples is limited: - High accessibility, low invasiveness – blood, skin. - Low accessibility, high invasiveness – brain, heart. How well much information can epigenetic findings (e.g. in blood) tell us about e.g. brain disorders? - Mechanism? Correlation ≠ causation. 25 06 DNA methylation (9) – limitations Global DNA methylation vs gene-specific. - What effect do two treatments have on gene methylation ( ) for genes 1 and 2? Gene 1 Gene 2 Treatment 1 Treatment 2 Gene 1 Gene 2 Gene 1 Gene 2 No change in global methylation No change in global methylation Change in gene-specific methylation No change in gene-specific methylation 26 13  24/01/2024 10 minute break 27 07 Histone modifications (1) – what are they? Histones are subject to post-translational modifications. - N-termini histone tails. - E.g. phosphorylation (serine), acetylation (lysine), methylation (lysine, arginine). 28 14  24/01/2024 07 Histone modifications (2) – nomenclature High diversity in chemical modifications and sites on amino acid sequence. - Agreed nomenclature for precise identification of histone modifications. Q: what epigenetic mark does the following describe? (5 mins) Which histone protein? H3K27me2 How many modifications? Which position What type of Which AA? is the AA in? modification? A: histone H3 carrying di-methylation of lysine 27. 29 07 Histone modifications (3) – how are they made? e.g. N-termini lysine acetylation: Histone acetyltransferases (HAT) - Adds acetyl group. - Removes + charge. - Relaxes chromatin. DNA is negatively charged! Histone deacetylases (HDAC) - Removes acetyl group. - Adds + charge. - Condenses chromatin. 30 15  24/01/2024 07 Histone modifications (4) – what do they do? Delineation of precise role is more complicated than DNA methylation. - DNA methylation (in general) represses gene transcription. - Can one histone modification really affect gene transcription so much? - What if we have one modification that increases transcription and one that decreases? - E.g. reviewed by Shepard and Nugent (2020). ELS and VTA DA activity. 31 07 Histone modifications (4) – how can we measure them? e.g. chromatin immunoprecipitation (ChIP). - High-resolution technique. - Formaldehyde is used to chemically cross-link DNA to histones. - Fragments are sheared (e.g. by nucleases) and purified through antibody capture. - Measured by dot blot, PCR, or sequencing. 32 16  24/01/2024 08 Micro RNAs (miRNAs) (1) ~1% DNA is protein-coding genes. - Other: encodes RNA species. - Involved in transcriptional control of coding areas. miRNAs are single-stranded, 21- 23 nucleotides. - Transcribed, but not translated. - Complementary to one or more mRNAs. - Main function is to downregulate expression. 33 08 miRNAs (2) Transcribed by RNA polymerase II miRNA gene pri-miRNA Primary Main role: transcript Translational repression pre-miRNA Short stem- loop structure 34 17  24/01/2024 08 miRNAs (3) All genes have regulatory elements in their sequence. - Respond to macro- or microenvironment signals. miRNAs bind to complementary sequences on mRNA species. - Prevent them from being translated. Meets the definition for epigenetics: “Stable & heritable changes to gene expression without alterations in DNA sequence” 35 08 miRNAs (3) – clinical implications Huntington’s disease (HD) is caused by CAG expansions in the Huntingtin (HTT) gene. - If a single mutant gene (mHTT) causes the disease, what if we target mHTT mRNA? - miRNAs complementary to mHTT as a therapy? - Use of AAV vectors – constitutive expression? 36 18  24/01/2024 2 minute break 37 09 Parent-of-origin effects (1) Most genes have a biallelic expression pattern. - i.e. RNA is transcribed from both copies (alleles). - Maternal and paternal copy. A subset of mammalian genes have monoallelic expression: - Imprinted genes (not the same as developmental ‘imprinting’). - Dependent on parent of origin (i.e. above shows a paternally-expressed imprinted gene). - Why? Evolutionary mechanism for interparental genetic battle for use of maternal resources prenatally and postnatally. 38 19  24/01/2024 09 Parent-of-origin effects (2) – clinical case PWS Prader-Willi syndrome (PWS) Neurodevelopmental disorder. - Hyperphagia, hypotonia, learning disability, psychiatric symptoms. Mutations at the imprinted gene locus 15q11-q13. - Loss of paternally-expressed genes (PEG). - 75% have paternal deletion of locus. - 25% have maternal uniparental disomy of Ch15. 39 09 Parent-of-origin effects (3) – clinical case AS Angelman syndrome (AS) Neurodevelopmental disorder. - Severe developmental delay, intellectual disability, severe speech impairment, gait ataxia. Deficient expression of maternally- expressed UBE3A: - Deletion. - Uniparental disomy. - Imprinting defect. 40 20  24/01/2024 09 Parent-of-origin effects (4) – clinical cases Prader-Willi Angelman syndrome syndrome Loss of paternally-expressed Loss of maternally-expressed genes (PEG) UBE3A 41 10 Introduction to epigenetics – video (part 2) 42 21  24/01/2024 11 Wider reading & viewing – Nessa Carey PhD ‘What is Epigenetics?’ @ The Royal Institution 43 12 Activity – global DNA methylation (5 mins) Rat brain tissue (factors: treatment group, sex). Measured global DNA methylation by ELISA. Q: limitations with this methodology? Key α/* (p