Genetic Diseases and Disorders PDF

GENETIC BASIS OF DISEASE AND DISORDERS DR M.P. OKEMWA GENETIC DISORDERS ⚫ Illness caused by one or more abnormalities in the genome. ⚫ Some are heritable and passed down from parents genes. ⚫ Others are caused by new mutations or defects in DNA. In such they will be heritable if...

GENETIC BASIS OF DISEASE AND DISORDERS DR M.P. OKEMWA GENETIC DISORDERS ⚫ Illness caused by one or more abnormalities in the genome. ⚫ Some are heritable and passed down from parents genes. ⚫ Others are caused by new mutations or defects in DNA. In such they will be heritable if affecting germ cells. ⚫ Hence same disease like cancer may be caused by an inherited condition in some, by new mutations in others and non genetic causes in still others. Image source: www.biotec.or.th/Genome/whatGenome.html Chromosomes ⚫ DNA is packaged into individual chromosomes (along with proteins) ⚫ DNA + associated chromosomal proteins = chromatin ⚫ prokaryotes (single-celled organisms lacking nuclei) have a single circular chromosome ⚫ eukaryotes (organisms with nuclei) have a species-specific number of linear chromosomes DN ~3.2 billion base pairs in every cell build A the genome human genes form only 1,5% of the human genome a gene is a segment of the DNA, that encodes the constructon plan for a protein DNA ⚫ can be thought of as the “blueprint” for an organism ⚫ composed of small molecules called nucleotides ⚫ four different nucleotides distinguished by the four bases: adenine (A), cytosine (C), guanine (G) and thymine (T) ⚫ is a polymer: large molecule consisting of similar units (nucleotides in this case) ⚫ DNA is digital information ⚫ a single strand of DNA can be thought of as a string composed of the four letters: A, C, G, T ctgctggaccgggtgctaggaccctgactgcc cggggccgggggtgcggggcccgctgag…  GENES ⚫ A gene is a unit of DNA that codes for a specific protein. ⚫ Genes consist of exons and introns. The exons contain the DNA code for the protein, while intervening introns, which make up most of the size of a gene, have an unknown function. ⚫ The introns must be cut out and the exons spliced together in the mRNA before it leaves the nucleus. ⚫ The location of a gene on the chromosome is called the locus. GENOTYPE, PHENOTYPE ⚫ The alleles that are present represent the genotype of a person. ⚫ The expression of the genotype leads to the phenotype, or what is clinically apparent in the person. ⚫ Genetic heterogeneity refers to the appearance of a common phenotype for several genotypes. ⚫ Mutations refers to alteration from normal.  PROTOONCOGE ⚫ ANES proto-oncogene is a normal gene that can become an oncogene due to mutations. ⚫ Proto-oncogenes code for proteins that help to regulate cell growth and differentiation. ⚫ Proto-oncogenes are often involved in signal transduction and execution of mitogenic signals, usually through their protein products. ⚫ Upon activation, a proto-oncogene (or its product) becomes a tumor-inducing agent, an oncogene. Examples of proto-oncogenes include RAS, WNT, MYC, ERK, and TRK.  PROTOONCOGENES ⚫ There are two mechanisms by which proto-oncogenes can be converted to cellular oncogenes: ⚫ Quantitative: Tumor formation is induced by an increase in the absolute number of proto-oncogene products or by its production in inappropriate cell types. ⚫ Qualitative: Conversion from proto-oncogene to transforming gene (c-onc) with changes in the nucleotide sequence which are responsible for the acquisition of the new properties  MUTATIONS ⚫ Genetic mutations can involve autosomes or the sex chromosomes. ⚫ The effect depends on the function of the region affected. ⚫ A mutation involving a gene coding for an enzyme appears as a recessive trait because, in the heterozygote, one gene copy is present and enough enzyme is made to provide for sufficient metabolic function. ⚫ A mutation involving a gene coding for a structural protein appears as a dominant trait, because one copy of the abnormal gene leads to formation of an abnormal SINGLE GENE MUTATIONS ⚫ Mutations can occur in many forms: ⚫ Missense: Change in a single amino acid ⚫ Nonsense: Change in a stop codon ⚫ Deletion: Loss of a single base pair, with frameshift ⚫ Insertion: Gain of a single base pair, with frameshift ⚫ Duplication: An extra gene with more protein production ⚫ Splice site: Abnormalities at the intron-exon boundary ⚫ Triple repeats: Increased tandem repeats Chromosomal disorders ⚫ DNA is packaged into individual chromosomes (along with proteins) ⚫ Humans have 23 pairs- 22 autosomes and a pair of sex chromosomes (X,Y) ⚫ Haploid(N) –describes a cell that contains a single set of chromosomes usually gametes in human beings. ⚫ Normal eukaryotic organism is composed of diploid cells, one set of chromosomes from each parent hence 46 chromosomes in humans= 23N Chromosomal ⚫ Numerical disorders -euploid= multiple of haploid number (N) -aneuploid= trisomy or monosomy meaning one extra or one less number of chromosomes caused by a non disjunction during meiosis ⚫ Structural - translocation; movement of a segment of a chrom - deletion; removes a chromosome segment -inversion; reverse of a segment within a chromosome - duplication; repeat of a chromosome segment Chromosomal disorders ⚫ 50% of first trimester miscarriages ⚫ 5% of still births ⚫ 0.5% of live borns -Down’s syndrome- trisomy 21 - Fragile X syndrome ⚫ Somatic cell abnormalities in cancers Down syndrome (trisomy 21) ⚫ The result of an extra copy of chromosome 21. ⚫ 47, 21+ ⚫ characteristic facial features, short stature; heart defects, usually some degree of mental retardation. ⚫ often sexually underdeveloped and sterile. ⚫ susceptibility to respiratory disease, shorter lifespan ⚫ is correlated with age of mother but can also be the result of nondisjunction of the father's chromosome 21. Human Chromosomes karyotype(map) …. ⚫ Pataus syndrome- Trisomy 13 ⚫ Edwards syndrome- trisomy 18 ⚫ Turners-XO ⚫ Cri du chat- deletion of part of Chr 5 ⚫ Klinefelters-47 XXY ⚫ Prader –Willi syndrome (del 15)q11-13 -hyperphagia(compulsive overeating) -mild to moderate MR -short stature, small external genitalia, hypotonia PATTERNS OF INHERITANCE ⚫ This are often seen in mendelian disorders where whole chromosmes are affected. ⚫ Autosomal recessive ⚫ Autosomal dominant ⚫ X-linked recessive ⚫ X-linked dominant AUTOSOMAL RECESSIVE ⚫ This pattern is typically seen with a mutation in a gene encoding for an enzyme, resulting in loss of function. ⚫ Heterozygotes generally have enough gene product to get by. Homozygotes generally have too little, but the amount of product and severity of disease may vary. The standard recurrence risk is 25%. SICKLE CELL ANEMIA ⚫ An example of a common autosomal recessive condition is sickle cell anemia. Normal adult hemoglobin is comprised of four globin chains that bind iron. Two of the chains are alpha and two are beta. A point mutation in the beta globin chain gene leads to an abnormal globin that causes red blood cells to change shape (sickle) under low oxygen concentrations. The mutation causes a substitution of valine for glutamic acid at position 6 of the beta globin chain, leading to abnormal conformation of this protein. AUTOSOMAL DOMINANT ⚫ This pattern typically occurs when a mutation involves a gene encoding for a structural protein. ⚫ There can be a "dominant negative" effect in which the product interferes with formation of complex protein structures or a "gain of function" in which the product leads to appearance of abnormal features. MARFAN SYNDROME ⚫ Marfan syndrome is another example of an autosomal dominant condition involving a structural gene, in this case the fibrillin gene, ⚫ It encodes for a protein that is a component of microfibrils that form connective tissues, particularly in the aorta, eye, and skeletal system. ⚫ Affected persons are tall, with long fingers (arachnodactyly), loose joints, ocular problems, and a propensity for the aorta to rupture. X-LINKED RECESSIVE ⚫ In this pattern, females are typically carriers. ⚫ Because of X-inactivation that leaves some functional genes available to produce product, they do not display the phenotype. ⚫ Depending upon how much product is needed to be healthy, some females may be mildly affected HEMOPHILIA A ⚫ An example of an X-linked recessive condition is the blood clotting disorder known as hemophilia A. ⚫ In this condition, there is a mutation in the gene coding for the production of blood clotting factor VIII. ⚫ This disease illustrates the fact that the amount of product made can vary somewhat, and factor VIII activity determines the severity of the disease, so the phenotype varies from mild to severe, a phenomenon called variable expression. X-LINKED DOMINANT ⚫ Theoretically, both males and females will be affected, but a "double dose" of the abnormal gene product may be lethal in utero, so that virtually no males are seen with the disease. PENETRANCE ⚫ The pattern of transmission can be confounded by reduced penetrance and by variable expression. ⚫ Reduced penetrance means that the gene is present and can be transmitted to offspring but does not produce the phenotype in the parent, leading to a "skipped" generation in a pedigree. ⚫ Variable expression-where the disease is present (complete penetrance) but the severity of gene expression varies from mild to severe. MULTIFACTORIAL INHERITANCE ⚫ No one specific gene is involved. ⚫ Instead, multiple genes and environmental factors interact to produce a phenotype. ⚫ The recurrence risk is above the average 3%, but the amount is difficult to state precisely. ⚫ An example is non-insulin dependent diabetes mellitus where family history, dietary influence, smoking and obesity amongst others influence development of disease. Major events in the history of Molecular Biology 1952 - 1960 ⚫ 1952-1953 James D. Watson and Francis H. C. Crick deduced James Watson the double helical structure of and Francis Crick DNA ⚫ 1956 George Emil Palade showed the site of enzymes manufacturing in the cytoplasm is made on RNA organelles called ribosomes. George Emil Palade Major events in the history of Molecular Biology 1970 ⚫ 1970 Howard Temin and David Baltimore independently isolate the first restriction enzyme ⚫ DNA can be cut into reproducible pieces with site-specific endonuclease called restriction enzymes; ⚫ the pieces can be linked to bacterial vectors and introduced into bacterial hosts. (gene cloning or recombinant DNA technology) Major events in the history of Molecular Biology 1970- 1977 ⚫ 1977 Phillip Sharp and Richard Roberts demonstrated that pre-mRNA is processed by the excision of introns and exons are spliced together. Phillip Sharp Richard Roberts ⚫ Joan Steitz determined that the 5’ end of snRNA is partially complementary to the consensus sequence of 5’ splice junctions. Joan Steitz Major events in the history of Molecular Biology 1986 - 1995 ⚫ 1986 Leroy Hood: Developed automated sequencing mechanism ⚫ 1986 Human Genome Initiative announced ⚫ 1990 The 15 year Human Genome project is launched by congress Leroy Hood ⚫ 1995 Moderate-resolution maps of chromosomes 3, 11, 12, and 22 maps published (These maps provide the locations of “markers” on each chromosome to make locating genes easier) Major events in the history of Molecular Biology 2000-2001 ⚫ 2000 Complete sequence of the euchromatic portion of the Drosophila melanogaster genome ⚫ 2001 International Human Genome Sequencing:first draft of the sequence of the human genome published Major events in the history of Molecular Biology 2003- Present ⚫ April 2003 Human Genome Project Completed. Mouse genome is sequenced. ⚫ April 2004 Rat genome sequenced. Clinical applications ⚫ Identifying diseases like TB- NA probes can be used to detect genetic information of a pathogen in a sample. ⚫ Neoplastic conditions as leukemia- the surface markers may not be expressed in some cases or may be too small, hence the use of NA hybridization assays. ⚫ Identity testing-Include paternal disputes, organ transplant, determine whether a particular body fluid came from a particular individual ⚫ Genetic diseases-Include Philadelphia chromosome in CML.The abnormality is t(9;22). Specific probes can be used to detect the c- abl- bcr gene rearrangement Clinical applications A probe is a short relatively well characterized nucleic acid segment used to search an unknown sample for the presence of complementary sequences through the hybridization process is called nucleic acid probe. ⚫ IHC, FISH, CISH, PCR,Genetic mapping, DNA typing and many others are all in the pathologist’s realm. ⚫ Human Genome project is now being followed by Human Embryology Project. ⚫ Use of embryonic tisssues as spare parts in treatment of certain ailments. ⚫ Those ‘with good’ genes survive longer- evolution Gene therapy solutions ⚫ Cloning - reproductive cloning;constructing an egg using genetic material from another source - dna cloning; dna is extracted from a host and replicated using plasmids - therapeutic cloning; stem cells are extracted from embryo and used to treat host ⚫ Genetic silencing; technique with which geneticists can deactivate an existing gene ⚫ Gene splicing- dna from an organism is cut and some gene inserted. Useful in recombinant technology for production of insulin, vaccines etc forensics ⚫ Paternity dna testing- easy DNA, genemetrics ⚫ Crime scene trace evidence – blood , hair, secretions in sexual assault etc ⚫ Mass accidents- matching body parts or identifying the bodies that cant be identified visually ⚫ Decomposed or remains of tissues found during investigations to be matched to unknown or lost persons ⚫ Following lineages/ tribes- Jews for example have preserved portions that they use for mapping out