DNA Replication and Protein Synthesis Study Guide PDF

Unit 2: Molecular Biology and Genetic Engineering Lesson 2.2 DNA Replication and Protein Synthesis Contents Introduction 1 Learning Objectives 2 Warm Up...

Unit 2: Molecular Biology and Genetic Engineering Lesson 2.2 DNA Replication and Protein Synthesis Contents Introduction 1 Learning Objectives 2 Warm Up 3 Learn about It! 4 The Replication of DNA 5 The Semiconservative Nature of DNA Replication 5 The General Mechanism of Replication 8 The Origin of Replication 9 Initiation of Replication 10 The Action of Polymerase during Elongation 12 Termination of Replication 14 DNA Proofreading and Repair 15 Eukaryotic Replication 15 The Central Dogma of Molecular Biology 16 Types of RNAs 17 The General Mechanism of Transcription 18 Initiation of Transcription 19 Elongation in Transcription 21 Termination of Transcription 22 Post-transcriptional Modifications 22 Overview of Translation and the Genetic Code 23 The Players during Translation 25 Mechanism of Translation 26 Post-translational Modifications 28 Key Points 29 Check Your Understanding 32 Challenge Yourself 34 Bibliography 34 Unit 2: Molecular Biology and Genetic Engineering Lesson 2.2 DNA Replication and Protein Synthesis Introduction Have you had any form of bacterial or viral infection? Did you seek your doctor for a consultation? In many cases, conditions can get better even without medications. However, for more serious cases such as in herpes and HIV infection, further proliferation of the viruses must be controlled. The mechanism of action of antivirals targets one crucial aspect of life—reproduction. Reproduction entails various modes that allow the genetic material to be transmitted from parents to offspring or progenitors. For cellular entities, reproduction begins with the division of a cell. For a cell to divide, part of its preparation is 2.2. DNA Replication and Protein Synthesis 1 Unit 2: Molecular Biology and Genetic Engineering the creation of copies of its genetic material to ensure that all successive generations of cells will have a complete set of genetic information. This is when antivirals come into action—they prevent the synthesis of the genetic material. For example, acyclovir, a type of antiviral drug against herpes simplex virus, targets the molecular machinery that creates copies of DNA. This then prevents further proliferation and spread of the virus in the affected individual. The genetic information in cells is highly conserved and protected. Just as bacteria and viruses perform an efficient way of creating copies of their genetic information to reproduce, so are the cells of more complex organisms. In addition to the importance of DNA duplication, the information must also be expressed as the traits of organisms required for maintenance and survival. Similar to the file conversion we usually perform in our computers, the information in DNA must be copied in an alternate version first before finally producing the functional products. It is not used directly when synthesizing polypeptides. In this chapter, we will look at the intricate molecular machinery that performs the replication and expression of genetic information. Learning Objectives DepEd Competency In this lesson, you should be able to do the Diagram the steps in DNA following: replication and protein synthesis Explain the process of DNA replication. (STEM_BIO11/12-IIIa-b-5). Explain the processes involved in transcription and translation. 2.2. DNA Replication and Protein Synthesis 2 Unit 2: Molecular Biology and Genetic Engineering Warm Up Decoding the Message: 15 minutes The Polypeptide Puzzle The expression of the information in DNA requires a series of steps that involve the production of its alternate copy or a transcript and the translation of this molecular transcript into an amino chain that will constitute a protein. In this activity, you will be given an overview of the correspondence between the mRNA and the sequence of amino acids. Materials a device with an internet connection or printed translation worksheet blank sheet of paper (if the worksheet is only accessed in a device) pen Procedure 1. Access the provided link to the translation worksheet for this activity. Polypeptide Puzzle Worksheet Quipper, “Polypeptide Puzzle Worksheet,” Google Docs (2019), shorturl.at/vEHL6, last accessed on January 03, 2020. 2. The worksheet is divided into four sections labeled A, B, C, and D. Section A contains an mRNA sequence. Section B consists of the guide to the correct matching between triplets of mRNA letters and amino acids. Section C consists of the amino acids and their corresponding words. Lastly, section D provides you a guide to the correct order of the words to decode the message. 3. In section A, divide the mRNA sequence consecutively (without gaps) into groups of three nucleotides or triplets. Thereafter, label each triplet with numbers from 1 to 16. For example, if the following is the given mRNA: AUGGCCGCGGAGAGGACC, you can divide it into 1AUG|2GCC|3GCG|4GAG|5AGG|6ACC. 4. Look for the amino acid that matches each of the triplets in section B. For example, if the triplet is AAU, it corresponds to the amino acid asparagine (Asn). 2.2. DNA Replication and Protein Synthesis 3 Unit 2: Molecular Biology and Genetic Engineering 5. Upon identifying an amino acid, look for the corresponding word in section C. Write the identified word in the appropriate number in section D to decode the message. 6. Look for a partner in class to compare your decoded message and discuss other observations regarding the activity. 7. Answer the guide questions that follow. Guide Questions 1. What is the decoded message after translating the mRNA sequence? 2. How would you describe the correspondence between the amino acids and the information in mRNA? 3. If a letter is replaced with a different nucleotide in one of the triplets, will the resulting amino sequence change? Why or why not? 4. How do you think can a change in the nucleotide of the provided sequence become harmful to an organism? 5. How do you think genotypes and phenotypes are connected via the central dogma of molecular biology? Learn about It! How is it possible for thousands of cells in cell culture to have almost identical genetic material? Reproduction is one of the key characteristics of living organisms, from unicellular prokaryotic cells to complex multicellular eukaryotic animals. Multicellular organisms grow and increase in complexity via extensive and repetitive division of cells. Humans are examples of complex multicellular organisms that began as an approximately 0.1 mm unicellular entity and ended up being complex, further manifesting and magnifying the other properties of life. For cells to survive and reproduce every generation, they highly rely on their ability to duplicate their genetic material in a process called DNA replication. 2.2. DNA Replication and Protein Synthesis 4 Unit 2: Molecular Biology and Genetic Engineering The Replication of DNA DNA replication, as previously discussed, is one of the major events that take place during the cell cycle. It takes place during the S phase (synthesis phase) of the cell cycle. A cell cannot proceed to the process of division without checking if its genetic material is properly duplicated. DNA replication, being a prerequisite for cell division, ensures that there are copies of the chromosomes that can be distributed to the resulting daughter cells. On average, DNA replication in human cells occurs at a rate of approximately 3 000 nucleotides per minute. In addition to the ability of cells to replicate DNA at great speed, they also perform it with enormous accuracy. A cell usually commits an error of only one mistake per billion nucleotides. Furthermore, the genetic material is also susceptible to various changes such as chemicals and radiation in the environment, as well as reactive cellular byproducts. In response, the cell also has repair mechanisms to minimize these changes from being inherited by the succeeding cell generations. Generally, almost all major biological processes that require division of cells also benefit from the capacity of the DNA to be replicated as in Fig. 2.2.1. A B C Fig. 2.2.1. DNA replication, being a major event of the cell cycle, is an active process in various biological activities such as (A) growth and development, (B) wound healing, and (C) asexual reproduction. The Semiconservative Nature of DNA Replication Initially, it was unknown how cells create copies of DNA, whether or not the original strands are maintained in the succeeding cell generations. In response, three models were proposed to describe the general mechanism of how cells duplicate their genetic material—the conservative, semiconservative, and dispersive models. Fig. 2.2.2 shows the differences between the resulting DNA molecules in each replication model. 2.2. DNA Replication and Protein Synthesis 5 Unit 2: Molecular Biology and Genetic Engineering According to the conservative model of replication, the whole double-stranded DNA molecule serves as the template for duplication to produce an entirely new DNA molecule while fully conserving the original copy. The dispersive model, by contrast, shows that the DNA strands separate and break down or disperse into fragments for them to serve as templates to synthesize new sequences. Thereafter, these copies reassemble, but with the new and old fragments interspersed in the resulting DNA molecules. Lastly, the semiconservative model, which is the accepted mechanism of replication, states that each of the DNA strands will serve as a template to synthesize new DNA molecules. Thus, each of the products of this mechanism shall consist of an old and a new strand. Fig. 2.2.2. There are three major models of DNA replication. Semiconservative replication produces DNA molecules each consisting of an old and a new strand. Conservative replication uses parental DNA as a template but still fully conserves it. Dispersive DNA replication utilizes fragments of the parental strand as the template but eventually, these pieces become interspersed in the resulting molecules. The semiconservative model is supported by the findings of Watson and Crick, particularly the specificity in the base pairing of the nucleotides. A few weeks after they published their paper on the double-helix structure of DNA, they arrived at the proposal that the DNA strands separate, and each strand guides the synthesis of new nucleotide chains. Through the semiconservative mechanism of replication, the original DNA molecule is partially conserved, with each strand present in the two resulting DNA molecules. 2.2. DNA Replication and Protein Synthesis 6 Unit 2: Molecular Biology and Genetic Engineering Fig. 2.2.3. The experiment of Meselson and Stahl involving E. coli grown in N-15 and N-14 isotopes and subsequent centrifugation of samples proved the semiconservative nature of DNA replication. In 1958, Matthew Meselson and Franklin Stahl provided solid proof as to the semiconservative mechanism of DNA replication. To demonstrate this, they performed an experiment that utilized the bacterium Escherichia coli, which is initially grown in the heavier nitrogen isotope (N-15) until all cells have the isotope in their bases. Thereafter, some cells were grown in the lighter nitrogen isotope (N-14), and after a few generations, some cells were obtained for analysis. Eventually, they were able to compare the DNA from the cells via equilibrium density gradient centrifugation. This technique utilizes the difference in densities of the DNA molecules of the bacterial cells via the bands that will appear in the 2.2. DNA Replication and Protein Synthesis 7 Unit 2: Molecular Biology and Genetic Engineering tubes. Light bands will correspond to the N-14, whereas the dark bands will correspond to the N-15. Fig. 2.2.3 shows the bands formed after centrifugation. After growing the N-15 bacterial cells in a medium with N-14, intermediate bands were formed, which proves the semiconservative nature of the replication. Thereafter, growing these cells with hybrid DNA in N-14 culture allows the formation of DNA with exclusively N-14 isotope alongside hybrid DNA, which further proves the model. The General Mechanism of Replication The general mechanism for DNA to be replicated, as Watson and Crick specified, is for each strand to serve as a template or mold to synthesize the new nucleotide chain. The specificity of the base-pairing in nucleic acids gives each strand this property. Labeling each of the two strands of DNA with D1 and D2 (as in Fig. 2.2.4), the mechanism of replication allows a new D2 strand to be synthesized from the D1 template (parental template 1). Likewise, a new D1 strand can be produced from the D2 template (parental strand 2). The cell performs an extraordinary capacity to accurately produce identical copies of the genetic material at an incredible rate with the help of certain proteins that make up the replication machine. Fig. 2.2.4. The base-pairing specificity of DNA allows each of the strands of the original molecule to serve as templates. In this figure, the old D1 and D2 strands aid in the synthesis of their corresponding new complementary strands. Prokaryotic models are usually used to describe the basic processes in the replication of DNA. Studies usually involve E. coli as their model organism. For replication to take place, 2.2. DNA Replication and Protein Synthesis 8 Unit 2: Molecular Biology and Genetic Engineering three major groups of molecules are needed—(a) the DNA template, (b) the deoxyribonucleotides that will be polymerized into a new nucleotide strand, and (c) enzymes and other proteins that help recognize the template and assemble the subunits. One general feature of replication is the formation of the replication bubble. This structure is formed when proteins create a DNA loop by unwinding it. When unwound, both the single strands of DNA can be used as templates, while further unwinding takes place on both ends of a bubble. These ends of the bubble are called replication forks. Another feature of replication is its bidirectionality. This means that once the DNA molecule is unwound for replication, it proceeds in two opposite directions. This property was first demonstrated in the late 1600s by Maria Schnos and Ross Inman in a bacteriophage (bacterial virus). Specifically, DNA synthesis proceeds only in the 5′ to the 3′ direction. This implies that nucleotides can only be added to the 3′ end of a growing chain. Fig. 2.2.5 below shows the site of the replication of DNA in cells. Fig. 2.2.5. Once the DNA molecule is unwound, the replication bubble will serve as the site for the process, which proceeds in both directions. The left-hand and right-hand replication forks indicate the site where proteins continuously unwind the double-stranded molecule. The Origin of Replication The point in the genome where replication begins is called the origin of replication. The presence of these sites was determined by John Cairns in the circular chromosome of E. coli. In bacterial cells and other unicellular organisms, the origins of replication consist of approximately 100–200 nucleotide pairs. They are found to have a high affinity to initiator proteins that promote the start of replication. The single origin of replication in E. coli, which is called the oriC, is well characterized. It is 245 bp long. Because replication is initiated in 2.2. DNA Replication and Protein Synthesis 9 Unit 2: Molecular Biology and Genetic Engineering this region, the first few actions of the proteins involve breaking of the H bonds between the nucleotides. The A-T regions are easier to break because of their fewer H bonds (i.e., 2 H bonds compared to the C-G regions (i.e., 3 H bonds). Once the DNA helix has been locally opened up, the complex will be further formed by attracting other replication proteins. Eukaryotic cells, unlike most prokaryotic cells, have multiple replication origins. Despite having relatively large, linear chromosomes, their replication can still proceed at a great speed because these cells can have as many as thousands of origins. Organisms in which the approximate number of replication origins are determined to include yeast cells (3 500), fruit fly (3 500), toad (15 000), and mouse (25 000). Despite the fact that there are thousands of origins in the eukaryotic genome, they are still relatively not well characterized because evidence shows that replication origins in higher eukaryotes consist of thousands of base pairs. Initiation of Replication The primary function of the initiator proteins in DNA replication is to bind to the replication origin and unwind a short segment of DNA. The unwinding of the helix allows the DNA helicase and single-strand-binding proteins to attach to the DNA. DNA helicase is the enzyme that further breaks the hydrogen bonds between the double-stranded polynucleotide chains. This allows each of the two strands to be used as a template for replication. Also, helicase cannot initiate the breaking of H bonds; the initiator proteins are still responsible for it by first separating a short DNA sequence where helicase can then bind. After forming separate DNA segments, the nucleotide may spontaneously reform H bonds. To provide stability to the single-stranded chains, the single-stranded-binding proteins (SSBPs) attach to these exposed sites to make them available for replication. Together, these proteins can cover a range of 35 to 65 nucleotides. Another enzyme that is important for the initiation of replication is DNA gyrase. This protein helps relieve the supercoiling of the twisted DNA molecule by reducing the strain that builds up in the replication fork. One can visualize trying to separate two threads that are wounded. If the two threads are pulled apart, they will end up entangled. During replication, gyrase prevents this from happening. Humans do not have gyrase, but instead, have the topoisomerase II which essentially has the same function as gyrase. Key replication proteins during initiation are shown in Fig. 2.2.6. 2.2. DNA Replication and Protein Synthesis 10 Unit 2: Molecular Biology and Genetic Engineering Fig. 2.2.6. Some enzymes play key roles in the initiation of replication. Helicase unwinds the DNA helix by breaking the hydrogen bonds between the base pairs. This step makes each of the strands available for use as templates. Gyrase helps relieve the tension that builds up ahead of the replication fork. The synthesis of new nucleotide chains cannot begin with the template alone, because the enzymes require a nucleotide with a free 3’-OH group where a new one can be added. To address this, the enzyme primase (see Fig. 2.2.7) synthesizes small nucleotide segments called RNA primers or simply primers. These are usually 10–12 nucleotides long that provides the 3’-OH where the major polymerizing enzyme can initiate synthesis later on. Fig. 2.2.7. To provide the DNA polymerase later on with an available 3’-end for deoxynucleotide polymerization, the enzyme primase synthesizes a short ribonucleotide sequence called the RNA primer. 2.2. DNA Replication and Protein Synthesis 11 Unit 2: Molecular Biology and Genetic Engineering The Action of Polymerase during Elongation As the process progresses, the replication bubble increases in size with the replication forks moving in opposite directions. Fig. 2.2.8. shows the active synthesis of DNA by using each strand as a template. It is mentioned earlier that the synthesis of new strands proceeds in the 5’ to 3’ direction. Given the antiparallel nature of DNA, one of the strands will have an exposed 3’ end of primers facing the direction of the fork, while the other strand has a primer with an exposed 5’ end facing the same replication fork. For the strand with the exposed 3’-OH, replication will occur continuously in the 5’ to 3’ direction. This is called the leading strand. Also, replication will be continuous because the DNA is unwound in this direction of the fork. Fig. 2.2.8. An active replication machine consists of the DNA polymerase III that synthesizes new DNA strands in both the leading and the lagging strands. Continuous replication occurs in the leading strand, while replication in the lagging strand involves the formation of smaller polynucleotide segments in the opposite direction. 2.2. DNA Replication and Protein Synthesis 12 Unit 2: Molecular Biology and Genetic Engineering On the other hand, for the other strand (also called the lagging strand) with an exposed 5’ end, replication must take place in the opposite direction. To accomplish this, short segments of DNA are synthesized discontinuously. These small sequences are called the Okazaki fragments (named after Reiji Okazaki and his wife Tsuneko Okazaki). For prokaryotic cells, these segments can range from 1 000 to 2 000 nucleotides, whereas eukaryotic cells usually have 100 to 200 nucleotides. DNA polymerase is the primary enzyme that catalyzes the elongation of the new nucleotide chains in both the leading and the lagging strands. In E. coli, the main polymerizing enzyme is DNA polymerase III. As previously mentioned, DNA polymerase functions by adding new nucleotides in the 3’ end of the elongating chain. In addition to the 5’ → 3’ polymerizing activity of the DNA polymerase III, it simultaneously works for repair by acting like a 3’ → 5’ exonuclease. In general, nuclease function involves the removal of incorrect nucleotides, thus imparting greater accuracy to the replication process. The process continues with the alternating functions of DNA polymerase III and polymerase I—polymerase III synthesizes polynucleotide strand in the 5’ to 3’ direction by starting with the 3’-end of the primer and polymerase I removes the RNA primer and replaces them with DNA nucleotides. However, after the polymerases replace the last nucleotide of the primer, a gap still remains, because the last nucleotide by polymerase I is not connected to the first nucleotide of the polymerase III. This is when another enzyme, the DNA ligase, comes into action by sealing this gap or nick through catalysis of a phosphodiester bond. This bond is formed between the 3’-OH of a sugar and the phosphate of the first nucleotide synthesized by the DNA polymerase III. Table 2.2.1. summarizes the different proteins that play important roles during replication. 2.2. DNA Replication and Protein Synthesis 13 Unit 2: Molecular Biology and Genetic Engineering Table 2.2.1. Summary of the roles of replication proteins Replication Protein Function Attaches to the origin of replication and creates an initial Initiator protein separation between the two DNA strands DNA helicase Continuously unwinds the DNA at the replication fork Single-strand DNA-binding Bind to the single-stranded DNA to prevent them from proteins reforming hydrogen bonds Moves ahead of the DNA helicase at the replication fork DNA gyrase (or and relieves the tension that builds up as the DNA strands topoisomerase II) are being unwound Synthesize short ribonucleotide segments called RNA DNA primase primers to provide a 3’-OH for the DNA polymerase III Synthesizes deoxynucleotide chains from the 3’-OH end of DNA polymerase III the RNA primers and performs DNA proofreading via its exonuclease activity Catalyzes the removal of the RNA primers and replaces DNA polymerase I them with DNA nucleotides Seals the nicks between the Okazaki fragments through DNA ligase phosphodiester bond formation Termination of Replication The termination of DNA replication varies from one cell to another. In some DNA helices, replication stops when two replication forks meet. Some cells, by contrast, require specific proteins to signal the termination of replication. For example, the Tus protein in E. coli binds to a certain sequence to block and prevent the movement of helicase. 2.2. DNA Replication and Protein Synthesis 14 Unit 2: Molecular Biology and Genetic Engineering How do cells minimize the errors that occur during DNA replication? DNA Proofreading and Repair DNA replication is an extremely accurate process. Cells usually commit an average of less than one error per billion nucleotides. As mentioned, DNA polymerase I has the ability to correct errors in nucleotide selection in a process that is termed as proofreading. DNA polymerase I is able to detect this error because an improper nucleotide will have an incorrectly positioned 3’-OH; thus, further polymerization is temporarily stopped. Consequently, the polymerase performs its exonuclease activity to remove the incorrect nucleotide and replace it with a new one. Another process is performed by the cell to correct errors, and this is called mismatch repair. Unlike proofreading, this process is performed after replication because some errors are found to have escaped initial proofreading. The errors in replication will manifest themselves as deformities in the secondary structure of the DNA, and these will eventually be detected and replaced by certain enzymes. One of the challenges of mismatch repair is for the enzymes to determine which of the bases is part of the old and the new strands. This is addressed in E. coli by adding methyl groups to a particular sequence of the template DNA to distinguish it from the newly synthesized strand. Eukaryotic Replication Eukaryotic DNA replication is not as well understood as the prokaryotic replication. Some of their striking differences include the number of replication origins, the number of types of DNA polymerases, and the assembly of nucleosomes after replication. As earlier stated, eukaryotes have multiple origins of replication, whereas most prokaryotes such as E. coli has only one. One well-studied organism in terms of replication origins is the budding yeast. Their replication origins are named autonomously replicating sequences (ARS). As the name implies, they have the ability to initiate replication when inserted into bacterial plasmids. Eukaryotic cells also have at least 13 types of DNA polymerases, and the primary enzymes that carry out the polymerization in the leading and lagging strands are called polymerases alpha and delta. Furthermore, another obvious difference of eukaryotic replication of 2.2. DNA Replication and Protein Synthesis 15 Unit 2: Molecular Biology and Genetic Engineering prokaryotic replication is that the nucleosomes immediately reform on the resulting DNA molecules. Apparently, these nucleosomes disintegrated as preparation for replication. Upon reassembly, each core consists of a mixture of old and new histone proteins. The Central Dogma of Molecular Biology How can cells from different species produce proteins with identical amino acid sequences? The heritable information in cells is in the form of the linear sequences of nucleotides contained in DNA. Immense variation is generated by using thousands to millions of combinations of four different nucleotides that make up this nucleic acid. The control of DNA in organisms ranges from their physical characteristics up to their behavior, and this is achieved through the synthesis of proteins, which eventually serve as phenotypic determiners through the enormous diversity of their functions. However, the DNA, in itself, cannot synthesize proteins. If a certain protein is needed to drive a cell’s function, an instruction or a segment of the DNA must first be copied into an RNA sequence. The copied sequence of the DNA is called a gene. Thereafter, the information in the RNA is used to synthesize the chain of amino acids that will make up a protein. This set of processes, as shown in Fig. 2.2.9, that entails the flow of information, from the DNA to RNA (transcription), and RNA to proteins (translation), make up the central dogma of molecular biology. Fig. 2.2.9. The central dogma of molecular biology is a collection of processes that allows for the expression of genes in cells. These processes serve as the connection between the genotype and phenotype of organisms. 2.2. DNA Replication and Protein Synthesis 16 Unit 2: Molecular Biology and Genetic Engineering Types of RNAs Gene expression is facilitated by not just one but five types of RNA molecules, all of which are synthesized via the process of transcription. Messenger RNA (mRNA) is an intermediate molecule during gene expression. It contains a copy of the information in DNA that must be translated into proteins. Transfer RNAs (tRNA) serve as adaptor molecules during protein synthesis. Each of them conveys amino acids to the ribosome corresponding to the information in the mRNA molecule. Ribosomal RNAs (rRNAs), alongside some proteins, are structural and functional components of the ribosomes. They help recognize the information in the mRNA so that it can be accurately expressed into polypeptides. Fig. 2.2.10 shows the RNA molecules that participate during translation. Small nuclear RNAs (snRNA) function during the post-processing of the mRNA after transcription. They are components of spliceosomes, structures in the nucleus that help remove sequences that will not be translated into an amino acid sequence. Micro RNAs (miRNA) are small RNAs that are essential in the regulation of gene expression. It should be emphasized that, though all of these molecules are products of transcription, only mRNA is translated into a polypeptide. Table 2.2.2. shows a summary of the location and function of the RNA classes in eukaryotic cells. Fig. 2.2.10. General structures of the major RNA molecules in cells. Despite having different final structures, all of them are products of transcription and are composed of the ribonucleotides A, U, G, and C. 2.2. DNA Replication and Protein Synthesis 17 Unit 2: Molecular Biology and Genetic Engineering Table 2.2.2. Summary of the location and function of the RNA classes in eukaryotic cells RNA Class Location in Cells Function Messenger RNA Serves as the transcript for the Nucleus and cytoplasm (mRNA) amino acid sequence Transfer RNA Carries amino acids to the Cytoplasm (tRNA) ribosomes for protein synthesis Ribosomal RNA Structural and functional Cytoplasm (rRNA) component of ribosomes Small nuclear RNA Processing of pre-mRNA to Nucleus (snRNA) mature mRNA Small nucleolar RNA Processing of rRNA for Nucleus (snoRNA) ribosomes The General Mechanism of Transcription Transcription, or the process of synthesizing RNA from DNA, only concerns itself on the genes that are needed by the cell. Unlike replication which involves the entire genome (if it precedes cellular division), transcription conserves cellular resources by only transcribing genes as needed by the cell. Because only selected DNA sequences are being transcribed at a particular time, the transcription process has the impressive ability to recognize the concerned gene sequences. In addition, only one of the DNA strands is transcribed. In this case, the transcribed sequence is called the template strand, and its counterpart is termed as the non-template strand. These are also called sense and antisense strands, respectively. However, similar to replication, transcription requires certain components to successfully produce an mRNA transcript: (1) the DNA template, (2) the ribonucleotide subunits, and (3) the proteins and enzymes that facilitate transcription. Similar to replication, RNA synthesis also forms its transcription bubble. This bubble runs through the concerned sequences during transcription. This sequence of the DNA involved 2.2. DNA Replication and Protein Synthesis 18 Unit 2: Molecular Biology and Genetic Engineering in RNA synthesis is called the transcription unit. Each transcription unit consists of (a) the promoter sequence, (b) the coding sequence, and (c) the terminator sequence. The transcription units may correspond either to a single gene or to several adjacent genes. Furthermore, the enzyme that will catalyze RNA synthesis in the transcription unit is the RNA polymerase. This holoenzyme conformation (as in Fig. 2.2.11) of this protein comprises a sigma factor subunit and the core enzyme, the functions of which will be further elaborated in this lesson. Fig. 2.2.11. The RNA polymerase holoenzyme consists of two major components, the core enzyme and the sigma factor. Initiation of Transcription Transcription in prokaryotic cells begins when the RNA polymerase holoenzyme binds to a promoter region or sequence of the DNA template strand (as shown in Step 1 of Fig. 2.2.12). Nucleotide sequences before and after this site (at a 5’ to 3’ direction) are called the upstream sequences and downstream sequences, respectively. This is simply to standardize convention in labeling the sequences of transcription units. In addition, it has been found that the promoter sequences of various genes of E. coli have almost similar segments called the consensus sequence. Specifically, there are two identified consensus sequences in their promoter region. The first consensus sequence in the non-template strand is TATAAT (also called the Pribnow box) and the second is TTGACA. These sequences, together, are important in the initiation of transcription. The sigma factor 2.2. DNA Replication and Protein Synthesis 19 Unit 2: Molecular Biology and Genetic Engineering subunit of the holoenzyme is responsible for the recognition of the promoter sequence of the gene to be transcribed. Specifically, it recognizes the region where TTGACA is (the second consensus sequence). Fig. 2.2.12. The transcription process involves a series of events that include the recognition of the promoter sequence, elongation of the mRNA transcript, and the dissociation of the complex when a terminator sequence is encountered. Eukaryotic transcription is different from prokaryotic transcription in many respects. First, 2.2. DNA Replication and Protein Synthesis 20 Unit 2: Molecular Biology and Genetic Engineering the RNA polymerase alone cannot recognize the promoter sequence. A group of proteins, particularly called transcription factors, shall first bind to the promoter sequence before the RNA polymerase initiates transcription. In addition, eukaryotes have five sets of polymerases that will catalyze RNA synthesis. Specifically, RNA polymerase II is responsible for the synthesis of the mRNA transcript that will, later on, be translated into proteins. The promoter sequence also consists of conserved sites such as the TATA box, which contains the consensus sequence TATAAAA (again, reading the non-template strand) and the CAAT box, which comprises the consensus sequence GGCCAATCT. The TATA box of eukaryotes is equivalent to the Pribnow sequence of prokaryotes. Elongation in Transcription The core enzyme of the sole RNA polymerase of prokaryotes is responsible for the polymerization of the RNA nucleotides. Simultaneously, it also unwinds the DNA molecule. As this enzyme moves along the transcription bubble (as in Steps 2 and 3 of Fig. 2.2.12), it performs both unwinding and rewinding (reforming of the hydrogen bonds of DNA strands) of the double helix. Rewinding of the DNA involves the automatic displacement or dissociation of the elongating RNA chain from the template. The region where there is a transient base pairing between RNA and DNA is very short—approximately three base pairs long. Eukaryotic RNA chain elongation generally is similar to that of prokaryotes. However, a distinct process occurs early (when RNA is approximately 30 nucleotides in length) in the elongation of RNA in eukaryotes. The 5’ ends of their pre-mRNA (primary transcript which will undergo further post-processing) are methylated by the addition of 7-methyl guanosine (7-MG) caps as shown in Fig. 2.2.13. This methyl group is important in the initiation of protein synthesis and in imparting protection against nuclease degradation. In addition to the 5’ capping, eukaryotic transcription is also different by virtue of the nucleosomes where the DNA helix is organized. RNA polymerase II has the capacity to move through the nucleosomes containing the histone proteins with the aid of a protein complex called FACT (facilitates chromatin transcription). This is accomplished via the temporary removal of the H2A and H2B histones from the core. Termination of Transcription Similar to the initiation of transcription, a certain signal is required to end transcription. 2.2. DNA Replication and Protein Synthesis 21 Unit 2: Molecular Biology and Genetic Engineering Prokaryotic transcription ends when the transcription complex encounters a termination signal (the red segment in Step 4 of Fig. 2.2.12) followed by the consequent dissociation of the entire complex and releasing the synthesized transcript. E.coli has two groups of termination signals. The first group triggers termination when the protein rho is present (hence called rho-dependent terminators). The terminators of the second group do not rely on this protein (hence called rho-independent terminators). The latter group consists of an inverted repeat, which when transcribed, results in an RNA strand that can form hairpin (a stem-loop structure discussed in the last chapter) and impede the further movement of RNA polymerase. Unlike in prokaryotic termination, eukaryotes do not form a hairpin structure to impede further transcription by the RNA polymerase II. Instead, transcription continues up to the termination sequence that is almost 1 000 to 2 000 nucleotides away (downstream) from the actual 3’ end of the final transcript. This excess sequence or segment is only removed via an endonucleolytic reaction. A certain signal is required to determine the site where the excess segment will be cut. This signal consists of a consensus sequence AAUAAA which is located upstream of the 3’ end of the final transcript. After the removal of the extra segment, the enzyme poly(A) polymerase adds poly(A)tail, in a process called polyadenylation, to the 3’ end (shown in Fig. 2.2.13). This tail is a chain of approximately 200 adenosine monophosphate residues. This modification of the pre-mRNA imparts stability and facilitates their transport to the ribosomes. Post-transcriptional Modifications Modifications of the mRNA transcript in the form of methylation and polyadenylation have already been discussed earlier. In addition to these chemical changes, the transcript also undergoes a process called RNA splicing (also shown in Fig. 2.2.13). For prokaryotic cells, the resulting mRNA sequence directly corresponds to the sequence of amino acids that will make up the proteins. There is no interruption present among the ribonucleotides, and no further processing is needed to translate the sequence. By contrast, most of the genes of eukaryotes have their expressed sequences called exons, which are interrupted by noncoding, intervening sequences called introns. Exons are usually shorter than the introns, thus they only represent a small proportion of the entire gene. RNA splicing involves the removal of the introns and retention of the exons. 2.2. DNA Replication and Protein Synthesis 22 Unit 2: Molecular Biology and Genetic Engineering Fig. 2.2.13. Three forms of chemical modifications occur in the mRNA transcript: 5’ capping with methyl, intron splicing, and addition of a poly-A tail. RNA splicing takes place after 5’ capping and as the polymerase II continues to transcribe a specific gene. Recognition of the introns involves a few common nucleotide sequences among them. These sequences that serve as cues are found at the beginning and end of each intron. Furthermore, the splicing process is performed primarily by RNA molecules called small nuclear RNAs or snRNAs mentioned earlier including other proteins to form the larger structure called the spliceosome. After a series of modifications, the mature mRNA can already be exported to the cytosol for translation. What do you think are the possible consequences if a cell fails to perform one of the chemical modifications to the mRNA transcript? Overview of Translation and the Genetic Code A gene, as previously discussed, is a sequence of DNA nucleotides that code for a specific protein. Translation is the process that allows the information in the mRNA transcript to be translated into the amino sequence in proteins. The genetic control of enzymatic pathways was elaborated by the Nobel-prize winning study of George Beadle and Edward Tatum. Their experiment involving the bread mold Neurospora crassa led to the one gene-one 2.2. DNA Replication and Protein Synthesis 23 Unit 2: Molecular Biology and Genetic Engineering enzyme concept, which became a foundation of the study of molecular genetics. However, this concept has been further modified because many proteins consist of more than one polypeptide, with each polypeptide encoded by a different gene, resulting in a more accurate version, the one gene-one polypeptide concept. Fig. 2.2.14. The genetic code provides a common set of instructions for the translation machinery of living cells. The correspondence between the mRNA nucleotide sequence and the amino acids is dictated by the genetic code (shown in Fig. 2.2.14.). Particularly, the mRNA sequence is read consecutively in three nucleotides called codons. Since there are four types of nucleotides in an mRNA, a total of 64 codons are possible (43 = 64 combinations). Below are the different properties of the genetic code, which also show how translation is initiated and terminated. 1. Triplet: The genetic code is read in nucleotide triplets or codons. Each codon codes for one amino acid in the resulting polypeptide. 2.2. DNA Replication and Protein Synthesis 24 Unit 2: Molecular Biology and Genetic Engineering 2. Start and stop signals: The code consists of one type of start signal or start codon, which is AUG. This signals the initiation of translation. By contrast, there are three stop signals or stop codons, which include UAA, UAG, and UGA. 3. Nonoverlapping: In an mRNA sequence, a nucleotide is part of only one codon. 4. Comma-less or comma-free: When reading the mRNA sequence, there is no punctuation among the codons. Once translation starts, each of the codons are read continuously without any pauses or interruptions. 5. Degeneracy: The code is degenerate because an amino acid can be coded by more than one codon. 6. Unambiguity: The code is unambiguous because of one codon codes for only one amino acid. 7. Polarity: There is a fixed direction in reading the code, i.e., 5’ --> 3’ direction. This also implies that each of the codons has its polarity. 8. Near universal: With minor exceptions, the code has the same correspondence between codons and amino acids in all living organisms. The Players during Translation The essential molecules required for translation to proceed consist of the mature mRNA transcript, the tRNA molecules each carrying an amino acid, and the ribosomes that each consists of three to five types of rRNA molecules. The ribosomes, which are approximately half proteins and half RNA, consist of large and small subunits that assemble during the start of translation. In E. coli, these subunits are labeled as 50S and 30S RNAs, respectively. The unit S stands for Svedberg, and it refers to the sedimentation rate during centrifugation. The tRNAs convey amino acids into the ribosomes. Each tRNA consists of a sequence, the anticodon, that is complementary to that of the codon of the mRNA. The enzyme aminoacyl-tRNA synthetase catalyzes the addition of the amino to the 3’ hydroxyl end of the tRNA. Furthermore, the tRNA is very specific as to binding to different sites of the ribosome. The aminoacyl site (A site) receives the incoming tRNA. The peptidyl site (P site) holds the tRNA with the elongating polypeptide chain. The exit site (E site) binds the departing tRNA that holds no amino acid. Mechanism of Translation Similar to replication and transcription, translation also consists of initiation, elongation, and termination. Initiation starts with the small ribosomal subunit interacting with the mRNA 2.2. DNA Replication and Protein Synthesis 25 Unit 2: Molecular Biology and Genetic Engineering and some proteins called initiation factors. These initiation factors help recognize the location of the start codon AUG. The first tRNA carrying the amino acid methionine then enters and binds to the mRNA via the anticodon UAC. Thereafter, the large ribosomal subunit joins the complex and positions the first tRNA at the P site. One important aspect of the complex is the binding between the small ribosomal subunit and the mRNA via the Shine-Dalgarno sequence (AGGAGG). This sequence which is located upstream the start codon forms complementary base pairing with the small ribosomal subunit. Initiation ends with a complex consisting of the small and large ribosomal subunits, the mRNA transcript, and a tRNA at P site. Translation involves the recognition of the sequences by the ribosomes, temporary binding of tRNAs to the mRNA via anticodons, and the elongation of the amino acid chain. During elongation, a new tRNA molecule carrying the amino that corresponds to the next codon enters the A site. After binding, a peptide bond is formed between the amino acid at A site and to that of at P site. This results in the uncoupling of the elongating chain at P site, 2.2. DNA Replication and Protein Synthesis 26 Unit 2: Molecular Biology and Genetic Engineering which eventually bonds to the tRNA at A site. This reaction is catalyzed by a built-in enzyme at the ribosome, the peptidyl transferase. Thereafter, the ribosome moves towards the 3’ direction of the mRNA resulting in the translocation of the tRNA at A site towards P site, and the tRNA at P site towards E site. The A site then is unoccupied, and the tRNA leaves via the E site. New tRNA enters the A site, and the cycle continues. This process occurs at a very rapid rate. For example, a 300-amino-acid-long polypeptide can be synthesized by E.coli in 15 seconds. The translation of the mRNA has fixed starting points and endpoints. AUG is the sole start codon, while UAA, UAG, or UGA codon terminates translation. Termination of translation occurs if any of the three stop codons or chain-termination codons (UAA, UAG, UGA) is encountered by the A site of the ribosome. This codon is recognized by the proteins called release factors. These proteins trigger the dissociation of 2.2. DNA Replication and Protein Synthesis 27 Unit 2: Molecular Biology and Genetic Engineering the entire translation complex, which also frees the synthesized polypeptide chain. What do you think will happen if an error during DNA replication ultimately results in the change of UGA codon to UGG? Post-translational Modifications The polypeptide products of translation undergo further chemical modification to enhance the diversity of the function of proteins. Most of the polypeptides do not attain their full function yet without undergoing these modifications. Some forms of post-translational modification include the following phosphorylation (addition of phosphate group), methylation (addition of methyl group), glycosylation (addition of sugar group), lipidation (attachment of lipid group), nitrosylation (addition of nitrogen-containing group), and proteolysis (the breakdown of proteins into component polypeptides). The various modifications may involve enhancement of enzymatic function, facilitate transport to other cell compartments or through the plasma membrane, or impart efficiency of folding into larger protein structures. Remember When translating an mRNA sequence, identify first the location of the start codon AUG. From this, divide the succeeding sequence into segments of three nucleotides until you encounter any of the three stop codons (UAA, UAG, UGA). For example, the given mRNA sequence below can be divided correspondingly. GUCAAUGGCGCCGUUUCGUUAGCGUCCACCA GUCA|1AUG(START)|2GCG|3CCG|4UUU|5CGU|6UAG(STOP)|CGUCCACCA You can already disregard the rest of the mRNA after the stop 2.2. DNA Replication and Protein Synthesis 28 Unit 2: Molecular Biology and Genetic Engineering codon when looking for the corresponding amino acids in the genetic code. The Early Evolution of the Genetic Code R D Knight and L F Landweber, “The Early Evolution of the Genetic Code,” PubMed.gov (June 9, 2000), https://www.ncbi.nlm.nih.gov/pubmed/10892641, last accessed on January 3, 2020. Mechanism of Replication (Advanced) “Mechanism of Replication (Advanced),” DNA Learning Center (nd), https://dnalc.cshl.edu/resources/3d/04-mechanism-of-replica tion-advanced.html, last accessed on January 3, 2020. Key Points ___________________________________________________________________________________________ The semiconservative DNA replication involves the formation of a replication bubble consisting of two replication forks on opposite ends. New strands are synthesized in the 5’ to 3’ direction. At the replication origin, initiator proteins, DNA helicase, DNA gyrase (or topoisomerase II in humans), and single-stranded binding proteins cooperate in unwinding the DNA helix and maintaining each of the strands available for replication. After the synthesis of primers, the DNA polymerase III synthesizes new nucleotide chains in the 5’ to 3’ direction. Synthesis is continuous in the leading strand because the polymerase moves in the direction similar to that of the unwinding of DNA. By contrast, synthesis occurs in segments called Okazaki fragments in the lagging strand because of the antiparallel nature of the helix. DNA polymerase I performs proofreading mechanisms during replication. For errors that are bypassed during replication, mismatch repair is performed by 2.2. DNA Replication and Protein Synthesis 29 Unit 2: Molecular Biology and Genetic Engineering proteins before further proceeding to the G2 phase of the cell cycle. The central dogma of molecular biology involves a series of processes that involve the expression of genes into proteins. It serves as the link between the genotype and phenotype. Transcription is the process that produces RNA from the information in DNA. There are different types of RNA molecules, but only mRNA is translated into an amino acid sequence. The other RNAs participate in either the transcription and protein synthesis without being further translated. The core enzyme of the RNA polymerase then synthesizes the RNA nucleotide chain in the 5’ to 3’ direction. Particularly, it only transcribes the sense or template sequence of the gene. The RNA polymerase also has the ability to unwind and rewind the DNA as it moves through the helix. The resulting mRNA molecule undergoes a series of chemical modifications such as methylation (5’ capping), polyadenylation (addition of poly-A tail), and intron splicing. Translation is the synthesis of the polypeptide by using the information in mRNA. mRNA is read in triplets of nucleotides called codons. The genetic code serves as the basis of correspondence between the codons of mRNA and the 20 essential amino acids. During translation, the large and small ribosomal subunits, mRNA, and tRNAs assemble to form the translation complex. The tRNAs convey the individual amino acids as they correspond to each of the codons. The ribosomes recognize the mRNA sequence and catalyze the elongation of the peptide chain. 2.2. DNA Replication and Protein Synthesis 30 Unit 2: Molecular Biology and Genetic Engineering Summary of the central dogma of the cell ___________________________________________________________________________________________ 2.2. DNA Replication and Protein Synthesis 31 Unit 2: Molecular Biology and Genetic Engineering Check Your Understanding A. Arrange the following steps in DNA replication from the first process by labeling with numbers from 1 to 10. 1. DNA polymerase I replaces the RNA primers with DNA nucleotides. 2. In case of errors, DNA polymerase III performs a 3’ to 5’ exonuclease activity. 3. Primase synthesizes short RNA primers in both the leading and the lagging strands. 4. DNA polymerase III performs the majority of the DNA nucleotide polymerization in both the leading and lagging strands in 5’ to 3’ direction. 5. The initiator proteins unwind a short sequence at the replication origin. 6. DNA helicase performs the rest of the unwinding of the DNA helix by breaking hydrogen bonds. 7. The initiator proteins recognize the location of the replication origin. 8. The single-stranded binding proteins attach to and stabilize the single strands of DNA. 9. DNA gyrase relieves the tension that builds up as the helicase unwinds the DNA. 10. DNA ligase seals the nick between the nucleotides that are synthesized by polymerase I and III. B. Arrange the following steps in gene expression from the first process by labeling with numbers from 1 to 10. 1. The mature mRNA binds with the small and large ribosomal subunits, where the start codon is recognized and the first tRNA is positioned at the P site. 2. The second tRNA enters the A site and peptidyl transferase then catalyzes the peptide formation between the amino acids of the adjacent tRNAs. 3. Transcription factors recognize and bind to the promoter sequence of the DNA. 4. The ribosomal subunits move and one of the tRNAs leaves the E site. 5. The translation machinery encounters the stop codon. The ribosome, tRNAs, and the polypeptide then dissociate. 6. The sigma subunit of the RNA polymerase holoenzyme recognizes TTGACA of the promoter. 2.2. DNA Replication and Protein Synthesis 32 Unit 2: Molecular Biology and Genetic Engineering 7. New tRNAs enter via the A site and the amino acid chain continues to elongate. 8. The RNA polymerase unwinds the DNA helix and forms the transcription bubble. 9. The pre-mRNA undergoes methylation, polyadenylation, and intron splicing to produce mature mRNA for transport into the cytoplasm. 10. RNA nucleotides are assembled via complementary base pairing into an elongating pre-mRNA by the RNA polymerase core enzyme. C. In each of the following DNA sequences, write the corresponding mRNA transcript and use the genetic code to determine the resulting amino acid sequence. You may proceed even without the start codon. Note that the given strands are in the 3’ to 5’ direction. 1. TTTTACCATCCCACAATTTA 2. ACTACTTTCAGAGCTATATTCAG 3. CATTACGGAGCCTGATGCACTTAC 4. TACGCCGCAACTCCGTATGGC 2.2. DNA Replication and Protein Synthesis 33 Unit 2: Molecular Biology and Genetic Engineering 5. GCTACAGCCCTAGCATTTACCCG Challenge Yourself Answer the following questions. 1. How will you describe the resulting DNA molecules if replication is not semiconservative? 2. Why cannot nucleotide polymerization take place continuously for both strands of the DNA? 3. What are the possible consequences if the cell fails to perform all post-transcriptional modifications? 4. If a codon will consist of four nucleotides instead of three, how will this affect the genetic code? 5. What do you think will happen if the translation of an mRNA sequence becomes overlapping? Bibliography Alberts B., Bray D., Hopkin K., Johnson A., and Lewis J. Essential cell biology (4th ed). New York, NY: Garland Science. 2014. Klug, W.S, and Cummings, M.R. Concepts of genetics (6th ed). Upper Saddle River, N.J: Prentice Hall. 2003. Pierce, Benjamin. Genetics: a conceptual approach (8th ed). New York: W.H. Freeman. 2012. Simmons, M.J. and Snustad, D.P. Principles of genetics (9th ed). Hoboken, NJ. Wiley. 2012. Turner, P.C., McLennan, A.G., Bates, A.D., and White M.R.H. BIOS Instant Notes in Molecular Biology (3rd ed). Garland Science, Taylor and Francis Group, LLC. 2005. 2.2. DNA Replication and Protein Synthesis 34