Protein Synthesis 2022 PDF

Protein Synthesis Har Gobind Khorana Indian American Biochemist Won Nobel Prize for show how genetic information is translated into proteins His work unambiguously confirmed that the genetic...

Protein Synthesis Har Gobind Khorana Indian American Biochemist Won Nobel Prize for show how genetic information is translated into proteins His work unambiguously confirmed that the genetic code consisted of 64 distinct three-letter words. Created an artificial gene in 1972  One Gene – One Polypeptide Beadle and Tatum proposed that 1 gene codes for 1 polypeptide Example of 1 gene – 1 polypeptide In sickle cell anemia, one mutation in gene for hemoglobin changes the structure of the protein Central Dogma of Molecular Biology The central dogma explains that information is transferred from DNA to RNA to protein. Compare DNA & RNA Sugar in RNA is ribose RNA is single stranded RNA contains uracil instead of thymine Types of RNA The 3 main types of RNA are: What is protein synthesis? Protein synthesis is the process of making proteins using the genetic code found in DNA. It involves two processes: ◻ Transcription - synthesis of mRNA from DNA template ◻ Translation – reading the mRNA to create proteins  Transcription Overview Initiation- RNA polymerase binds to DNA at promoter (a site near beginning of gene) Elongation- RNA polymerase puts together complementary ribonucleotides using DNA as template Termination- recognizes stop signal at end of gene mRNA transcript is released and exits the nucleus Animation: Transcription Transcription: Initiation With the help of transcription factors RNA polymerase recognizes and binds to the promoter region (aka. TATA box). The promoter is upstream of gene to be transcribed. RNA polymerase unwinds DNA and exposed the template strand TATA box is high in A’s and T’s which are held by 2 Hydrogen bonds so RNA polymerase uses less energy to open of the DNA molecule at this site)  Transcription: Elongation RNA polymerase synthesizes single-stranded mRNA in 5’ to 3’ Promoter region is NOT transcribed coding strand No primer required (sense/ non template) 5’ to 3’ template strand (anti-sense strand) 3’ to 5’ Transcription: Termination RNA polymerase recognizes the termination sequence located at end of gene ◻ Termination sequence is different between prokaryotes and eukaryotes Termination causes mRNA strand to disassociate from the DNA template strand Post-Transcriptional Modifications The PRE-mRNA produced from transcription needs to be ‘modified’ before it can leave the nucleus 1. Capping - 7-methyl guanosine is added to the 5’ end; it’s called a 5’ CAP (modified guanine nucleoside triphosphate); protects the mRNA from digestion as it exits the nucleus and enters the cytoplasm 2. Poly-A Tailing - Approximately 200 adenine ribonucleotides are added to the 3’ end; it’s called a poly-A tail; added on by the enzyme poly-A polymerase 3. Introns (NON-CODING regions) are removed by splicesomes, so exons (CODING regions) get transcribed Animation: Spliceosomes Practice 1. A short fragment of a particular gene includes the following nucleotide sequence: 3′ - GGCATGCACCATAATATCTACCTTCGGCACGG - 5′ a. Identify the promoter region. How do you know? b. What is the purpose of the promoter during transcription? c. Transcribe this strand (create an mRNA). 2. Explain the ramifications to transcription if the following occurs: a. The termination sequence of a gene is removed. b. Poly-A polymerase is inactivated. c. The enzyme that adds the 5′ cap is non-functional. d. Spliceosomes excise exons and join the remaining introns together. 3′ - GGCATGCACCATAATATCTACCTTCGGCACGG - 5′  Translation Overview Initiation- occurs when a ribosome recognizes a sequence of mRNA and binds to it Elongation- ribosomes moves along three nucleotides at a time reading “codons”. Each codon codes for a particular amino acid that is delivered by tRNA Termination- three nucleotide sequence is reached that does not code for an amino acid. “stop signal” The Genetic Code: Codons The genetic code is read in codons. A codon is a group of three nucleotide bases in messenger RNA that specific a particular amino acid. The Genetic Code 20 different amino acids but only 4 bases Each triplet of nucleotides is called a codon. There are 61 different codons for amino acids (not including stop codons) More than one codon can code for a single amino acid indicating a redundancy in the code. Redundancy minimizes errors The start codon is always AUG. Ribosomal RNA (rRNA) Ribosomal RNA is made of 2 subunits – small and large rRNA moves along the mRNA is the 5’ to 3’ direction. rRNA has three tRNA sites  Transfer RNA (tRNA) tRNA delivers amino acids. Small single stranded, resembles cloverleaf. Anticodon arm recognizes codon of mRNA. Every tRNA carries a specific amino acid. When amino acid is attached it is called aminoacyl-tRNA Read the Genetic Code Translation: Initiation Small subunit recognizes and binds to 5’ cap upstream of AUG sequence with aid of initiation factors Initiator tRNA with anticodon UAC recognizes start codon AUG (note: aminoacyl-tRNA synthetase has already attached amino acid to tRNA) Large subunit attaches to complete translational complex First tRNA is sitting in the A site Translation: Elongation The initiator tRNA moves to P-site , while another tRNA comes into the A-site Peptide bonds are formed between the junction of the P-site and A-site tRNAs move to the E-site, where they exit Translation: Termination When a stop codon is encountered by the ribosome, there is no corresponding tRNA for that stop codon A release factor recognizes stalled ribosome and dismantles the ribosome/mRNA complex, releasing the polypeptide  Translation Animation: Translation Protein Synthesis – A Summary Practice 1. Label the diagram. Protein mRNA Amino Acid Codon DNA tRNA rRNA Anticodon  7 Practice 6 2. Label the diagram. 1 5 tRNA Amino Acid Large subunit small subunit 2 mRNA Protein 3 codon 4  Practice 3. Examine the following DNA sequence: Strand A 5’ ATA TAT ATG TAT GCT GGC TAA TGA ACC TGG 3’ Strand B 3′ TAT ATA TAC ATA CGA CGG ATT ACT TGG ACC 5’ a. Which strand is the template? How do you know? b. Circle the promoter region. c. Transcribe the template. d. Translate the mRNA. 4. Describe the consequences to protein synthesis if the following were inactivated: a. spliceosomes b. RNA polymerase c. tRNA d. ribosomes 5. Outline the difference between DNA replication and Protein synthesis Genetics of Sickle Cell Anemia DNA & Snorks mRNA Covid Vaccines What makes death cap mushrooms deadly? These mushrooms get their lethal effects by producing one specific toxin, which attaches to a crucial enzyme in the human body: RNA polymerase. Video: Death Cap Mushrooms Beadle and Tatum Beadle and Tatum’s experiment showed that a single gene determines the production of one enzyme. It has been now modified to one gene = one polypeptide they used bread mold (Neurospora crassa) Beadle and Tatum Additional Resources Animations/Videos ◻ Teacher's Pet: Protein Synthesis ◻ Bozeman: Transcription and Translation ◻ Crash Course: DNA, Hot Pockets, & The longest word ever ◻ Transcription and Translation Overview ◻ Khan: Differences between translation in Prokaryotes and Eukaryotes ◻ Khan: Transcription 1 ◻ Khan: Transcription2 ◻ Khan: Translation 1 ◻ Khan: Translation 2 ◻ Amoeba Sisters and the Lean Mean Ribosome Machine Review Games: ◻ Drag and Drop: Protein Synthesis ◻ Learn Genetics: Transcribe and Translate a Gene ◻ Transcription Worksheet ◻ Translation Worksheet ◻ Protein Synthesis race game (game pieces)