Biotechnology Drugs-1 PDF Fall 2023

Biotechnology Drugs-1 PCOL825A/Fall 2023 Biotechnology drugs Aikseng Ooi, Ph.D. Skaggs Room 204 [email protected] 1 1 Sample question Erythropoietin (EPO) is a glycoprotein cytokine. Select a viable method to produce EPO using biotechnology A. Amplify EPO gene by PCR > Clone it into a bac...

Biotechnology Drugs-1 PCOL825A/Fall 2023 Biotechnology drugs Aikseng Ooi, Ph.D. Skaggs Room 204 [email protected] 1 1 Sample question Erythropoietin (EPO) is a glycoprotein cytokine. Select a viable method to produce EPO using biotechnology A. Amplify EPO gene by PCR > Clone it into a bacterial expression plasmid > Express it in bacteria host > purification. B. Amplify EPO cDNA by PCR > Clone it into a bacterial expression plasmid > Express it in bacteria host > purification. C. Amplify EPO cDNA by PCR > Clone it into a mammalian expression plasmid > Express it in bacteria host > purification. D. Amplify EPO gene by PCR > Clone it into a mammalian expression plasmid > Express it in bacteria host > purification. E. Amplify EPO cDNA by PCR > Clone it into a mammalian expression plasmid > Express it in mammalian cells culture > purification. 2 2 Ooi/Department of Pharmacology & Toxicology/The University of Arizona College of Pharmacy 1 Biotechnology Drugs-1 PCOL825A/Fall 2023 Biotechnology Biotechnology Drugs 1 1. 2. 3. 4. 5. Definition of Biotechnology Basic biochemistry of DNA The central dogma of molecular biology Recombinant DNA technology Other emerging technologies Biotechnology Drugs 2 1. Insulin production 2. Cytokines 3. Antisera 4. Antibodies 3 3 Biotechnology > 8000 years history The manipulation of living organism or their components to produce useful commercial products – Merriam Webster Dictionary Broader definition encompasses domestication of animals and plants 4 4 Ooi/Department of Pharmacology & Toxicology/The University of Arizona College of Pharmacy 2 Biotechnology Drugs-1 PCOL825A/Fall 2023 DNA as genetic database • DNA consists of 2 purines (A & G), and 2 pyrimidines (T and C) bases. • A pairs with T through 2 hydrogen bonds. G pairs with C through 3 hydrogen bonds. • Base pairing give rise to double helix structure that enhances stability. • DNA is organized into chromosomes through its interactions with histone proteins. • DNA encode protein in a degenerate triplet code • DNA repair mechanisms are in place to fix some but not all errors • Encoding errors ! variation ! evolution 5 5 The Central Dogma of Molecular Biology 6 6 Ooi/Department of Pharmacology & Toxicology/The University of Arizona College of Pharmacy 3 Biotechnology Drugs-1 PCOL825A/Fall 2023 Figure 2.1 Central Dogma of molecular biology. 7 Textbook of Biochemistry with Clinical Correlations, 7e edited by Thomas M . Devlin © 2011 John W iley & Sons, Inc . 7 Retroviruses counter the central dogma 8 8 Ooi/Department of Pharmacology & Toxicology/The University of Arizona College of Pharmacy 4 Biotechnology Drugs-1 PCOL825A/Fall 2023 Reverse Transcription Figure 2.1 Central Dogma of molecular biology. 9 Textbook of Biochemistry with Clinical Correlations, 7e edited by Thomas M . Devlin © 2011 John W iley & Sons, Inc . 9 Recombinant DNA technology 10 10 Ooi/Department of Pharmacology & Toxicology/The University of Arizona College of Pharmacy 5 Biotechnology Drugs-1 PCOL825A/Fall 2023 11 11 12 12 Ooi/Department of Pharmacology & Toxicology/The University of Arizona College of Pharmacy 6 Biotechnology Drugs-1 PCOL825A/Fall 2023 13 13 Recombinant DNA technology Recombinant DNA – joining of two pieces of DNA from different sources to form a new DNA segment that do not naturally exist in the genome. Recombinant DNA technology – Tools and techniques for creating recombinant DNA. Reagents that enable recombinant DNA technology: 1. Restriction endonucleases 2. Plasmid DNA 3. DNA modifying enzymes 4. Reverse Transcriptase 5. E. coli 6. Several types of viruses 14 14 Ooi/Department of Pharmacology & Toxicology/The University of Arizona College of Pharmacy 7 Biotechnology Drugs-1 PCOL825A/Fall 2023 Restriction endonucleases 15 15 Type II restriction endonuclease recognizes palindromic sequences Figure 2.44 Types of products generated by type II restriction endonucleases. 16 Textbook of Biochemistry with Clinical Correlations, 7e edited by Thomas M . Devlin © 2011 John W iley & Sons, Inc . 16 Ooi/Department of Pharmacology & Toxicology/The University of Arizona College of Pharmacy 8 Biotechnology Drugs-1 PCOL825A/Fall 2023 Recognizing palindromic sequences 5’-G-A-A-T-T-C-3’ 3’-C-T-T-A-A-G-5’ Palindromic 5’-G-A-T-T-G-C-3’ 3’-C-T-A-A-C-G-5’ Non-Palindromic 17 17 Plasmid DNA as a vector 18 18 Ooi/Department of Pharmacology & Toxicology/The University of Arizona College of Pharmacy 9 Biotechnology Drugs-1 PCOL825A/Fall 2023 Plasmid DNA Plasmids are small circular extra-chromosomal DNA molecule found in bacteria. Naturally occurring or wild type plasmids are used by bacteria cells to pass on antibiotic resistance genes. Recombinant DNA technology uses synthetic plasmid DNA. 19 19 Example of a classical synthetic bacterial plasmid DNA bla(ApR) – beta-lactamase gene, confers resistance to ampicillin and other beta-lactam ring containing antibiotics rep(pMB1) – origin of replication. This site is essential for plasmid DNA replication MCS – Multiple cloning site. This site is designed for the insertion of gene-of-interest. lacZ – bacteria lac operon, carring inducible beta-galactosidase expression 20 20 Ooi/Department of Pharmacology & Toxicology/The University of Arizona College of Pharmacy 10 Biotechnology Drugs-1 PCOL825A/Fall 2023 Blue white colony selection with lacZ DNA fragment cloned into the MCS will cause a frameshift mutation to the lacZ gene, resulting in non-functional betagalactosidase. Screening uses Isopropyl β-D-1thiogalactopyranoside (IPTG) as the lac operon inducer, and 5-bromo-4-chloro3-indolyl-beta-D-galactopyranoside (xgal) as beta-galactosidase substrate. X-gal ! blue compound by betagalactosidase. Bacteria carrying recombinant DNA will show up white. 21 21 Mammalian plasmids Pcmv – cytomegalovirus promoter. BGH pA – Poly A signal SV40 ori – simian virus 40 origin of replication. For plasmid replication in mammalian cells Neomycin – Neomycin resistance gene. For selection of mammalian cells carrying the plasmid. 22 22 Ooi/Department of Pharmacology & Toxicology/The University of Arizona College of Pharmacy 11 Biotechnology Drugs-1 PCOL825A/Fall 2023 Virus vectors Use to generate virus carrying recombinant DNA. The resulting virus can deliver the recombinant DNA into mammalian cells’ genome Shown here is lentivirus vector – Derived from HIV 23 23 Other DNA modifying enzymes 24 24 Ooi/Department of Pharmacology & Toxicology/The University of Arizona College of Pharmacy 12 Biotechnology Drugs-1 PCOL825A/Fall 2023 Other DNA modifying enzymes DNA ligase – catalyzes the formation of phospho-diester bond. The enzyme that binds two pieces of DNA together DNA phosphatase – catalyzes the removal of 5’ phosphate from DNA Polynucleotide kinase – catalyzes the addition of 5’ phosphate onto DNA DNA dependent DNA polymerase – catalyzes the synthesis of new stand of DNA from a DNA template DNA dependent RNA polymerase (Transcriptase) – catalyzes the synthesis of RNA from a DNA template RNA dependent DNA polymerase (reverse transcriptase) – catalyzes the synthesis of DNA from a RNA template 25 25 Restriction endonuclease Cloning DNA ligase Antibiotic selection 26 26 Ooi/Department of Pharmacology & Toxicology/The University of Arizona College of Pharmacy 13 Biotechnology Drugs-1 PCOL825A/Fall 2023 Cloning of a mammalian gene 27 27 Mammalian genes contain introns AAAAAAAAAAAA(A)n 28 28 Ooi/Department of Pharmacology & Toxicology/The University of Arizona College of Pharmacy 14 Biotechnology Drugs-1 PCOL825A/Fall 2023 Generating and cloning cDNA Reverse transcriptase cDNA = complementary DNA 29 29 Amplifying specific DNA fragment using polymerase chain reaction PCR 30 30 Ooi/Department of Pharmacology & Toxicology/The University of Arizona College of Pharmacy 15 Biotechnology Drugs-1 PCOL825A/Fall 2023 Discoveries that enable recombinant DNA technology --- Polymerase chain reaction 31 31 Cloning of human gene through reverse transcription Cap AAAAAAAAA Reverse transcription cDNA PCR to amplify the cDNA Digest with restriction endonuclease and clone into plasmid 32 32 Ooi/Department of Pharmacology & Toxicology/The University of Arizona College of Pharmacy 16 Biotechnology Drugs-1 PCOL825A/Fall 2023 Site directed mutagenesis Changing a specific DNA sequence 33 33 34 34 Ooi/Department of Pharmacology & Toxicology/The University of Arizona College of Pharmacy 17 Biotechnology Drugs-1 PCOL825A/Fall 2023 Virus vectors Viral genome Carrier plasmid 35 35 Producing retrovirus in vitro 36 36 Ooi/Department of Pharmacology & Toxicology/The University of Arizona College of Pharmacy 18 Biotechnology Drugs-1 PCOL825A/Fall 2023 Synthetic biology techniques Synthetic biology techniques like Gibson assembly allows for the construction of custom sequences without needing restriction nuclease sites. Creating DNA fragments of any sequence without detectable genetic engineering foot print 37 37 Gene Editing Technology 38 38 Ooi/Department of Pharmacology & Toxicology/The University of Arizona College of Pharmacy 19 Biotechnology Drugs-1 PCOL825A/Fall 2023 Genome editing 1. Changing a specific sequence in the genome. 2. Sequence can be changed in stem or progenitor cells and then transplanting the cells. 3. Direct editing of somatic cells. 4. Tools include: Zinc finger nucleases, TALEN, CRISPR 39 39 CRISPR gene editing technology • Clustered regularly interspaced short palindromic repeat (CRISPR) • A bacterial adaptive immune system. • Cas9 (CRISPR associated protein 9) is an RNA guided DNA endonuclease 40 40 Ooi/Department of Pharmacology & Toxicology/The University of Arizona College of Pharmacy 20 ACCTCCAATGACTAGGGTGGGCAACCAC.. 3 ||||||||||| TGGAGGTTACTGATCCCACCCGTTGGTG.. 5 ||||||||||||||||| ACCTCCAATGACTAGGGGUUUUAGAGCUAG A •|||||• |||| A CUAUUGCCUGAUCGGAAUAAAAUU CGAUA GAA GCACCGA |||||||G CGUGGCU Cas9 Biotechnology Drugs-1 9 nuclease. The Cas9 nuclease from mic DNA (shown for example is the g of a 20-nt guide sequence (blue) airs with the DNA target (blue bar isite 5 -NGG adjacent motif pstream of the PAM (red triangle). and functional validation of sgRNAs and finally the use of the Cas9 nuclease to mediate both NHEJ- and HDR-based genome modifications in human embryonic kidney (HEK 293FT) and human stem cell (HUES9) lines (Fig. 3). The Cas9 system can similarly be applied to other cell types and organisms, including humans22,23,25, mice22,41,45, zebrafish45, Drosophila46 and Caenorhabditis elegans47. PCOL825A/Fall 2023 CRISPR genewith editing technology Comparison other genome editing technologies © 2013 Nature America, Inc. All rights reserved. As with other designer nuclease technologies such as ZFNs and PROTOCOL TALENs, Cas9 can facilitate targeted DNA DSBs at specific loci of interest in the mammalian genome and stimulate genome editing Here we explain in detail Genomic locus via NHEJ or HDR. Cas9 offers several potential advantages over optimized, nuclear localizati ZFNs and TALENs, including the ease of customization, higher (WT) Cas9 nuclease or mu targeting efficiency and the ability to facilitate multiplex genome eukaryotic gene editing. We de editing. As custom ZFNs are oftenTarget difficult engineer, we will ing the 20-nt guide sequence, (20 bp) to PAM ifferent PAM requirements, primarily compare Cas9 with TALEN. and functional validation of s 5 ..AATGGGGAGGACATCGATGTCACCTCCAATGACTAGGGTGGGCAACCAC.. 3 -NNAGAA22,26 for CRISPR1 DNA target |||||||||||||||||| ||||||||||| Cas9 nuclease to mediate both 3 ..TTACCCCTCCTGTAGCTACAGTGGAGGTTACTGATCCCACCCGTTGGTG.. 5 ) and Neisseria meningiditis • Ease of customization. Cas9 can|||||||||||||||||||| be easily retargeted to new DNA modifications in human emb 5 GTCACCTCCAATGACTAGGGGUUUUAGAGCUAG A sequences by simply purchasing a pair of oligos encoding the •|||||• |||| A human stem cell (HUES9) lin sgRNA GUUCAACUAUUGCCUGAUCGGAAUAAAAUU CGAUA on of CRISPR-Cas is reconA |||| 20-nt guide sequence. In contrast, retargeting of TALEN for a similarly be applied to other c GAA A gh the heterologous expresnew DNA sequence requires AAAGUGGCACCGA the construction of two new TALEN ing humans22,23,25, mice22,41, •|||||||G 3 UUUUUUCGUGGCU Cas9 for TALEN conCas9 and the requisite RNA genes. Although a variety of protocols exist Caenorhabditis elegans47. 14,17,48,49 crRNA and tracrRNA can be struction , it takes substantially more hands-on time to 1 | Schematic of the RNA-guided Cas9 nuclease. The Cas9 nuclease from single-guide RNA (sgRNA)27 Figure construct a new pair of TALENs. natureDNA protocols | VOL.8 NO.11 | 2013 | 2281 S. pyogenes (in yellow) is targeted to genomic (shown for example is the 41 Comparison with other genom d toward almost any target of human • Cleavage pattern. WT S. pyogenes Cas9 (SpCas9) is known EMX1 locus) by an sgRNA consisting of a 20-nt guide sequence (blue) to As with other designer nuclea he PAM sequence by altering make a blunt cut the 17th bases in(blue the target and a scaffold (red). Thebetween guide sequence pairsand with 18th the DNA target bar TALENs, Cas9 can facilitate tar 41 27. Mutating onsequence top strand), of a requisite 5 -NGG adjacent e sgRNA. (3directly bp 5 upstream of the PAM) catalyticmotif residues in interest in the mammalian geno pink). mediates a DSB ~3 bpnuclease upstream domain of the PAMof (red triangle). n and multiplexing capacity, (PAM; either theCas9 RuvC or the HNH SpCas9 con- via NHEJ or HDR. Cas9 offers 22,27 ineered eukaryotic cells carverts the enzyme into a DNA nicking enzyme . In contrast, ZFNs and TALENs, including 22–25,40 HEJ and HDR . Direct TALENs cleave nonspecifically in the 12–24-bp linker between targeting efficiency and the abi 50. oding Cas9 into embryos has Cas9 the pair of orthologs TALEN monomer-binding sitesPAM nuclease create stranded break at editing. As custom ZFNs are o other Cas9 may double have different requirements, ansgenic mice with multiple such as those of S. thermophilus (5 -NNAGAA22,26 for CRISPR1 primarily compare Cas9 with T target site hold enormous promise for and 5 -NGGNG28,37 for CRISPR3) and Neisseria meningiditis • Ease of customization. Cas9 ca e genetically intractable. (5 -NNNNGATT)39. sequences by simply purchas d-specific cleavage by using The RNA-guided nuclease of CRISPR-Cas is recon20-nt guide sequence. In con Cas9 function DSB nuclease domains, which Non-homologous 3 5 stituted in mammalian cells through the heterologous expresend Homology directed repair new DNA sequence requires th 3 5 for additional function37. joining sion of human codon–optimized Cas9 and the requisite RNA genes. Although a variety of NHEJ sgRNA HDR utation in the RuvC catalytic components22–25. Furthermore, the crRNA and tracrRNA can be struction14,17,48,49, it takes sub 27 Genomic 5 3 ||| ase mutant (Cas9n) to nick fused together to create a chimeric, single-guide RNA (sgRNA) 5 construct a new pair of TALEN DNA 3 5 3 1). Cas9 can thus be re-directed toward almost any target of3 • Cleavage pattern. WT S. pyog single-stranded breaks, and (Fig. 3 5 Repair 5 template 3 22 make a blunt cut between the through HDR can poten- interest in immediate vicinity of the PAM sequence by altering5 Prematurewithin the sgRNA. the 20-nt guide sequence sequence (3 bp 5 of the PAM wanted indel mutations from stop Precise gene editing Indelease mutation codon Given its of implementation and multiplexing capacity, 3 either the RuvC or the HNH fset sgRNA pairs can guide 5 3 5 3 5 3 Cas9 has been used to generate engineered eukaryotic cells car- 5 verts the enzyme into a DNA h strands of the target locus specific mutations via both NHEJ and HDR22–25,40. Direct increasing the specificity of rying Figure 2 | DSB repair promotes gene editing. DSBs induced by Cas9 (yellow) TALENs cleave nonspecificall of sgRNA mRNA Cas9 into embryos the pair of TALEN monomerCas9 mutant with both DNA- injection can be repaired in one and of two ways. encoding In the error-prone NHEJ pathway,has the rapid transgenic mice with multiple the ends of a DSB aregeneration processed byof endogenous DNA repair machinery and has been adapted to enable enabled 41,42. These results hold enormous promise for 42 modified alleles rejoined, which can result in random indel mutations at the site of junction. 44 richia coli , demonstrating editing organisms that are otherwise genetically Indel mutations occurring within the coding region of aintractable. gene can result in as9 for diverse applications, 42 frameshifts and the creation of a premature stop codon, resulting gene Cas9 nucleases carry out strand-specific cleavage by inusing Cas9 protein labels or chromatin- knockout. Alternatively, a repair template in the form of a plasmid or ssODN the conserved HNH and RuvC nuclease domains, which 5 3 nomic loci for reporting or can 37.and can bebesupplied to leverage the HDR pathway, which allows high fidelity mutated and exploited for additional function NHEJ precise editing. Single-stranded nicksmutation to the DNAin can also induce HDR. An aspartate-to-alanine (D10A) the RuvC catalytic 27,28 21 Genom Ooi/Department of Pharmacology & Toxicology/The of Arizona College of Pharmacy domain allows theUniversity Cas9 nickase mutant (Cas9n) to nick DN 5 3 rather than cleave DNA to yield single-stranded breaks, and 3 5 R Biotechnology Drugs-1 PCOL825A/Fall 2023 Stem cell technology 43 43 Stem cell hierarchy 44 Wobus and Boheler. Physiological Reviews. 2005.Vol. 85 no. 2, 635-678 44 Ooi/Department of Pharmacology & Toxicology/The University of Arizona College of Pharmacy 22 Biotechnology Drugs-1 PCOL825A/Fall 2023 Proposed scheme of cell therapy 45 Wobus and Boheler. Physiological Reviews. 2005.Vol. 85 no. 2, 635-678 45 The promise of induced pluripotent stem cells Transplantation of genetically matched healthy cells Treatment with drugs Patient Disease-specific drugs cMYC OCT4 Healthy cells KLF4 SOX2 Screening ening for therapeutic apeutic compounds pounds In vitro differentiation Skin biopsy Affected cell type Repaired iPS cells REVIEW INSIGHT Figure 2 | Medical applications of iPS cells. Reprogramming technology and iPS cells have the potential to be used to model and treat human disease. In this example, the patient has a neurodegenerative disorder. Patient-specific iPS cells — in this case derived by ectopic co-expression of transcription factors in cells isolated from a skin biopsy — can be used in one of two pathways. In cases in which the diseasecausing mutation is known (for example, familial Parkinson’s disease), gene targeting could be used to repair the DNA sequence (right). The gene-corrected patient-specific iPS cells would then undergo directed differentiation into the affected neuronal subtype (for example, midbrain dopaminergic neurons) and be transplanted into the patient’s brain (to engraft the nigrostriatal axis). Alternatively, directed differentiation of the patient-specific iPS cells into the affected neuronal subtype (left) will allow the patient’s disease to be modelled in vitro, and potential drugs can be screened, aiding in the discovery of novel therapeutic compounds. Use gene targeting to repair disease-causing mutation In vitro differentiation Patient-specific iPS cells 46 Given the number of drugs that have notoriously been withdrawn from the market because of their tendency to induce arrhythmias, it is highly Robinton and Daley. Nature. 2012 likely that the current inadequate approaches for assessing cardiotoxicity will be complemented by iPS-cell-based assessments of drug effects. A study from our laboratory explored dyskeratosis congenita, a disorder of telomere maintenance, and provided an unanticipated insight into the basic biology of telomerase that has therapeutic implications73. In its most severe form, dyskeratosis congenita is caused by a mutation in the dyskerin gene (DKC1), which is X linked, leading to shortened telomeres and premature senescence in cells and ultimately manifesting as the degeneration of multiple tissues. Because the reprogramming of cells to an induced pluripotent state is accompanied by the induction of the gene encoding telomerase reverse transcriptase (TERT), we investigated whether the telomerase defect would limit the derivation and maintenance of iPS cells from individuals with dyskeratosis congenita. Although the efficiency of iPS-cell derivation was poor, we were able to successfully this study, we showed that a high expression level of multiple telomerase components was characteristic of the pluripotent state more generally, Jan 18;481(7381):295-305 illustrating how iPS cells can 46 reveal fundamental aspects of cell biology. An independent study of the reprogramming of cells from patients with dyskeratosis congenita confirmed the general transcriptional upregulation of multiple telomerase components and the maintenance of telomere lengths in clones74; however, in this study, no clones with elongated telomeres were identified. The different outcomes of these studies highlight the limitations of iPS-cell-based disease models that are imposed by clonal variation as a result of the inherent technical infidelity of reprogramming75. This point also introduces an additional important consideration. Before a given iPS-cell disease model can be claimed to be truly representative of the disease, how many patients must be involved, and how many iPS cell lines must be derived from each patient? Although the answers to these questions are unclear, it is crucial to keep these issues in mind when generating disease models and making claims based on these models. Ooi/Department of Pharmacology & Toxicology/The University of Arizona College of Pharmacy 23 Biotechnology Drugs-1 PCOL825A/Fall 2023 Summary 1. Biotechnology – manipulation of living system to produce useful products 2. Basic biochemistry of DNA and DNA organization 3. Basic cytogenetic - The ISCN 2009 4. The central dogma of molecular biology and exceptions 5. Introduction to basic recombinant DNA technology 6. Genome editing technology 1. Stem cell techology 47 47 Sample question Erythropoietin (EPO) is a glycoprotein cytokine. Select a viable method to produce EPO using biotechnology A. Amplify EPO gene by PCR > Clone it into a bacterial expression plasmid > Express it in bacteria host > purification. B. Amplify EPO cDNA by PCR > Clone it into a bacterial expression plasmid > Express it in bacteria host > purification. C. Amplify EPO cDNA by PCR > Clone it into a mammalian expression plasmid > Express it in bacteria host > purification. D. Amplify EPO gene by PCR > Clone it into a mammalian expression plasmid > Express it in bacteria host > purification. E. Amplify EPO cDNA by PCR > Clone it into a mammalian expression plasmid > Express it in mammalian cells culture > purification. 48 48 Ooi/Department of Pharmacology & Toxicology/The University of Arizona College of Pharmacy 24