DNA & Proteins (Language of Life) PDF - SACE

DNA & Proteins Language of Life  SACE Key Ideas – by the end of this chapter you should know… Science Understandings A gene consists of a unique sequence of nucleotides that codes for a functional protein or an RNA molecule. Distinguish between exons and introns as coding and non-coding seg...

DNA & Proteins Language of Life  SACE Key Ideas – by the end of this chapter you should know… Science Understandings A gene consists of a unique sequence of nucleotides that codes for a functional protein or an RNA molecule. Distinguish between exons and introns as coding and non-coding segments of DNA found in genes in eukaryotes. Describe how both exons and introns are transcribed but only the information contained in exons is translated to form a polypeptide in eukaryotes. Protein synthesis involves transcription of a gene into messenger RNA (mRNA), and translation of mRNA into an amino acid sequence at the ribosomes. In eukaryotic cells, transcription occurs in the nucleus. Describe and illustrate the role of DNA, mRNA, transfer RNA (tRNA), and ribosomal RNA (rRNA) in transcription and translation. Describe the relationship between DNA codons, RNA codons, anticodons, and amino acids. Distinguish between coding (gene) and template strands of DNA. Recognise that DNA strands are directional and are read 5’ to 3’.  Prior knowledge! Structure Of The DNA Molecule DNA consists of two strands wrapped around each other to form a double helix. The backbone of each strand consists of alternating sugar and phosphate molecules. Attached to each sugar molecule is one of four bases (A, T, G and C). Each base pairs with its complementary base on the other DNA strand. ACGTCTC pairs with TGCAGAG DNA Replication: DNA Double stranded chromosome Before a cell divides it must first Replication consisting of 2 sister replicate the entire DNA in the chromatids, each either the nucleus or the nucleoid Single containing an region, so that each of the new cells stranded identical DNA (daughter cells) have identical chromosome molecule. copies. consisting of one DNA During cell division sister The process of DNA replication must molecule. chromatids are separated, one be completed before cell division chromatid going into each of the can occur. daughter cells. Base-pairing rules and method of DNA replication apply to all life of Earth – they are universal! Each strand of DNA has the information necessary to construct the other strand. Parent Cell DNA Replication Daughter cells  The steps involved in DNA Replication are: 1) Enzymes (Helicase) unzip and split the DNA double helix into two strands, exposing the bases. 2) The two strands act as templates for new strands of DNA 3) Free nucleotides in the nucleus bind to their complimentary base pair on both the template and complimentary strands of the DNA 4) DNA Polymerase (enzyme) joins free nucleotides together to form a growing DNA strands 5) The two pairs of DNA strands then re-twist into two separate (but identical) DNA molecules. 6) As each DNA molecule contains one old template strand and one new complementary strand, the process is called semi-conservative replication Enzymes involved in replication The replication of DNA occurs under the influence of more than a dozen enzymes including helicases, DNA polymerases and DNA ligases Enzyme Function Helicases Unwind/unzip the DNA double helix Primases Initiate replication Polymerases Catalyse the synthesis of new complementary DNA strands Ligase Joins DNA fragments together Topoisomerases Involved in the re-coiling of the DNA DNA Structure and replication Crash Course https://www.youtube.com/watch?v=8kK2zwjRV0M Anytime Education https://www.youtube.com/watch?v=V8y0Fsj4wZI#t=21.333762027 Role of DNA in Cells We have 2 copies of every gene (one from mum, one Genes make up approximately 10% of an organism’s DNA from dad). Genes are usually The information held in the genes is hundreds or thousands of determined by the base sequence of DNA bases long. (like the letters in a word e.g. STOP v POST) Genes have different base sequences (ATCG) resulting in different traits being evident in offspring (blue eyes or brown eyes? Depends on your ATCG sequence!) Genes are unique Each gene has a unique sequence of bases, this is how we can get such different organisms from just ATCG. Genes code for proteins (via mRNA) or structural RNA (tRNA and rRNA). All genes initially code for an RNA molecule - if mRNA is coded for then a polypeptide (protein) will eventually be formed A DNA molecule has instructions for the 100s (or 1000s) of proteins There are 3 types of RNA Prior knowledge! rRNA (ribosomal RNA) -associates with proteins to form ribosomes, the site of RNA is different from DNA for 3 protein synthesis. reasons: Oxygen in the sugar DNA is mainly double tRNA (transfer RNA) –specific carriers stranded, RNA is mainly single of amino acids during protein synthesis. stranded There is a base change in RNA, Uracil (U) not Thymine (T) mRNA (messenger RNA) –transcribed from DNA to carry the gene message DNA is the set of instructions, out to ribosomes for translation into an proteins are the materials and amino acid sequence. RNA are the tools! Link Between Genes & Proteins: A polypeptide is a single chain of amino acids. Genes code for the synthesis of specific proteins. Amino acids are the monomers (or building Many proteins are constructed from 2 or more blocks) of protein molecules. polypeptide chains, with each polypeptide being coded for by a different gene. Therefore, the unique DNA base sequence of a genes actually codes for the sequence of amino acids in Gene (1) Gene (2) a polypeptide chain. A-A-G-C-T-A-A C-T-T-G-C-A-T Proteins may be structural, or functional, eg transport proteins or enzymes Polypeptide A Polypeptide B How many bases code for one amino acid? There are 4 DNA bases, but 20 amino acids (therefore 1 base Triplets of DNA bases code cannot code for 1 for 1 amino acid (e.g. AAA amino acid – 4 bases codes for phenylalanine). could code for 4 amino acids!) 43 = 64 possible combinations of three bases Are 2 bases enough to code for 1 amino acid? More than 1 triplet can code 42 = 16 possible amino for an amino acid acids Codons The information coded in DNA is transcribed on to a mRNA molecule. On mRNA a triplet of bases (e.g.UUU) is called a codon. Part of one chain of nucleotides in a DNA molecule carries the following sequence of bases: TTATACATGGCATTATACGCAACC How many amino acids does this sequence code for? J. Four. K. Eight. L. Twelve. M. Twenty-four. Protein Synthesis Overview Transcription Translation DNA mRNA protein triplet codon amino acid (AAA) (UUU) (phenylalanine) DNA to Protein A copy, mRNA, of the segment of DNA is like an instruction manual for the DNA (gene) needed to construct building of all the different proteins a cell the desired polypeptide is made needs to operate and survive. within the nucleus and brought out to the cytoplasm. Remember, DNA is a long molecule and lies tangled within the nucleus of a cell. A nucleus is surrounded by a nuclear The information carried within this membrane which has small pores to copy of the gene is then translated selectively let molecules in/out. to direct the building of the desired polypeptide from free amino acids Synthesis of proteins occurs outside the in the cytoplasm. nucleus at organelles called ribosomes. How does the cell overcome this This whole process is called protein problem? synthesis  Antibiotics and Protein Synthesis Protein Synthesis Many antibiotics work by inhibiting a step in Protein synthesis is the process by protein synthesis in bacteria – therefore which the cell builds these specific bacteria will not function. proteins. Protein synthesis occurs in two stages: 1)Transcription (in the nucleus a temporary copy of a DNA segment is made = mRNA) 2)Translation (in the cytoplasm, the copy is decoded to construct a polypeptide) Transcription Transcription 1. Segment of DNA is unzipped (hydrogen bonds broken between bases) by RNA polymerase. 2. Free nucleotides inside the nucleus bind to the bases on the exposed template strand of the DNA (A → T / U → A / C → G / G → C) 3. RNA Polymerase (enzyme) joins free nucleotides together to form a mRNA strand Transcription The genetic information is carried on only one of the two strands of the DNA. This is known as the coding strand. The other strand is known as the template strand mRNA is a complementary copy of the template DNA segment. What will it be the same as? CODING STRAND! Only one strand of DNA is used to produce mRNA = TEMPLATE strand mRNA is required to synthesise a polypeptide at the ribosome Transcription 4. Once transcription is complete, mRNA strand is modified to remove non- coding regions. 5. The mRNA then moves out of the nucleus and into the cytoplasm through pores in the nuclear membrane. 6. Unzipped segment of the DNA strand re-joins to reform the double stranded helix. Hydrogen bonds reform. Introns and Exons Most bacteria lack introns – therefore need to be removed from human DNA Exons = coding sequences, expressed before it is transferred into bacteria. Introns = intervening (non-coding) sequences, interspersed between exons, cut out after transcription to produce mature mRNA Translation Translation Ribosomes: made of rRNA and is the site where amio acids are joined to form polypeptides tRNA: cloverleaf shaped molecule with 3 exposed bases (anticodon) and an amino acid attachment site. STEPS IN TRANSLATION Carries specific amino acids ▪ mRNA feeds through a ribosome 2 codons at a time. to the ribosome Translation A tRNA molecule brings a specific amino acid to the ribosome The tRNA has an anticodon that is complementary to the mRNA codon, and pairs up with the mRNA e.g. anticodon AAA pairs up with codon UUU and brings the amino acid phenylalanine with it Translation The amino acid bonds with the adjacent amino acid forming part of the polypeptide chain This process continues until a stop signal is reached on the mRNA https://www.youtu be.com/watch?v=g G7uCskUOrA Complete The Table DNA Codon Anticodon Amino Acid ACA Threonine CUU Glutamic Acid GTG Histidine CAA Valine Complete The Table DNA Codon Anticodon Amino Acid TGT ACA Threonine UGU CUU Leucine GAA GAA GTG Histidine CAC GUG CAA Valine CAA GUU The synthesis of protein within the cell involves a. the attachment of a molecule of DNA to the surface of a ribosome. b. the attachment of a molecule of mRNA to an amino acid molecule. c. the attachment of a molecule of amino acid to a molecule of transfer RNA. d. the attachment of a molecule of DNA to a molecule of amino acid. Which one of the following cellular processes involves the pairing of the bases cytosine, thymine, and adenine with the bases guanine, adenine, and uracil respectively? J. The replication of DNA. K. Translation. L. Transcription. M. The bonding of amino acids.  Websites CK-12 Biology https://www.ck12.org/biology/dna/ Khan Academy https://www.khanacademy.org/science/high-school-biology/hs-molecular-genetics/hs-rna-and-protein- synthesis/e/hs-rna-and-protein-synthesis Lumen Learning https://courses.lumenlearning.com/austincc-ap1/chapter/3-4-protein-synthesis/ Videos Bozeman – Transcription and Translation 11:56 https://www.youtube.com/watch?v=h3b9ArupXZg Anytime Education – Protein Synthesis (Part 1 of 2) – Transcription 10:26 https://www.youtube.com/watch?v=ngpqQv6djv8 Anytime Education – Protein Synthesis (Part 2 of 2) – Translation 12:34 https://www.youtube.com/watch?v=BFOYmvwUcKo Amoeba Sisters – Protein Synthesis 8:46 https://www.youtube.com/watch?v=oefAI2x2CQM Fuse School – Protein Synthesis 5:07 https://www.youtube.com/watch?v=x5ZXQo-xeMo Nova – Protein Synthesis in the Cellular Factory 3:55 https://www.youtube.com/watch?v=DuHAMkgT6B8