DNA: The Genetic Material PDF

10/14/2024 School of Arts and Sciences Department of Biological and Chemical Sciences Chapter 2 p.9 DNA: The Genetic Material BIOL 365 – Genetics 1 General background...

10/14/2024 School of Arts and Sciences Department of Biological and Chemical Sciences Chapter 2 p.9 DNA: The Genetic Material BIOL 365 – Genetics 1 General background 2 1  10/14/2024 Composition and structure of DNA DNA is a polymer: large molecule that consist of many similar smaller molecules, called monomers, linked together Monomer = Nucleotide Polymer = DNA 3 Composition and structure of DNA What is a DNA Nucleotide ? Nucleoside PO42- Pentose – 5C H Nucleotide = Nucleoside phosphate 4 2  10/14/2024 Composition and structure of DNA 5 Composition and structure of DNA What are the Nitrogenous bases ? Six-membered Single range structures Nine-membered Double range structures 6 3  10/14/2024 Composition and structure of DNA 7 Names of Base, Nucleoside and Nucleotide 8 4  10/14/2024 Composition and structure of DNA What are the types of bonds ? Monophosphate * Covalently linked by N-glycosidic bond Covalently linked by at N9: purine base Phosphodiester bond at N1: pyrimidine base (5’-3’ bond) 9 Composition and structure of DNA The phosphodiester bonds are relatively strong, so the repeated sugar-phosphate-sugar-phosphate backbone of DNA is stable structure Polynucleotide chains have polarity, meaning that the 2 ends are different: there is a 5’ carbon (with a phosphate group on it) at one end, and a 3’ carbon (with a hydroxyl group on it) at the other end The end of a polynucleotide are referred to as the 5’ end and the 3’ end 10 5  10/14/2024 Composition and structure of DNA One strand of Polynucleotide DNA chain Double strand of Polynucleotide DNA chain “Complementary base pairs” Hydrogen Bond * 5’ end Phosphate group 3’ end Hydroxyl group 11 Composition and structure of DNA A-T and G-C are called complementary base pairs A bonded with T => 2 hydrogen bonds G bonded with C => 3 hydrogen bonds Hydrogen bonds are relatively weak chemical bonds This makes easy to separate the 2 strands of DNA, for ex. by heating 12 6  10/14/2024 Composition and structure of DNA 13 Composition and structure of DNA DNA: Double helix anti-parallel 5’ end 3’ end 3’ end 5’ end 14 7  10/14/2024 Features of the DNA X-ray crystallography Watson and Crick’s have developed the double helix model of DNA based on the X-ray crystallography data 15 Features of the DNA Double helix model DNA molecule is 2 polynucleotide chains wound around each other in a right-handed double helix The 2 chains are anti-parallel with opposite polarity The sugar-phosphate backbones are on the outside of the double helix, with the bases oriented toward the central axis The bases are flat structures oriented perpendicularly to the long axis of the DNA The complementary base pairs are bounded together by Hydrogen bonds The base pairs are 0.34 nm apart in the DNA helix A complete (360°) turn of the helix takes 3.4 nm The external diameter of the helix is 2 nm The results of the unequal space between the backbones: Major groove and Minor groove 16 8  10/14/2024 Features of the DNA Double helix model DNA molecule is 2 polynucleotide chains wound around each other in a right-handed double helix 2 chains are anti-parallel with opposite polarity The sugar-phosphate backbones are on the outside of the double helix, with the bases oriented toward the central axis The bases are flat structures oriented perpendicularly to the long axis of the DNA The complementary base pairs are bounded together by Hydrogen bonds The base pairs are 0.34 nm apart in the DNA helix A complete (360°) turn of the helix takes 3.4 nm The external diameter of the helix is 2 nm The results of the unequal space between the backbones: Major groove and Minor groove 17 Features of the DNA 3’ 5’ Double helix model DNA molecule is 2 polynucleotide chains wound around each other in a right-handed double helix The 2 chains are anti-parallel with opposite polarity The sugar-phosphate backbones are on the outside of the double helix, with the bases oriented toward the central axis The bases are flat structures oriented perpendicularly to the long axis of the DNA The complementary base pairs are bounded together by Hydrogen bonds * The base pairs are 0.34 nm apart in the DNA helix A complete (360°) turn of the helix takes 3.4 nm The external diameter of the helix is 2 nm 3’ 5’ The results of the unequal space between the backbones: Major groove and Minor groove ❖If one chain has the sequence 5’-TATTCCGA-3’ then the opposite, antiparallel chain must bear the sequence 3’-ATAAGGCT-5’. 18 9  10/14/2024 Features of the DNA Double helix model DNA molecule is 2 polynucleotide chains wound around each other in a right-handed double helix The 2 chains are anti-parallel with opposite polarity The sugar-phosphate backbones are on the outside of the double helix, with the bases oriented toward the central axis The bases are flat structures oriented perpendicularly to the long axis of the DNA The complementary base pairs are bounded together by Hydrogen bonds The base pairs are 0.34 nm apart in the DNA helix A complete (360°) turn of the helix takes 3.4 nm * The external diameter of the helix is 2 nm The results of the unequal space between the backbones: Major groove and Minor groove 19 Features of the DNA Double helix model DNA molecule is 2 polynucleotide chains wound around each other in a right-handed double helix The 2 chains are anti-parallel with opposite polarity The sugar-phosphate backbones are on the outside of the double helix, with the bases oriented toward the central axis The bases are flat structures oriented perpendicularly to the long axis of the DNA The complementary base pairs are bounded together by Hydrogen bonds The base pairs are 0.34 nm apart in the DNA helix A complete (360°) turn of the helix takes 3.4 nm The external diameter of the helix is 2 nm The results of the unequal space between the backbones: Major groove and Minor groove * 20 10  10/14/2024 Different DNA structures Three major types of DNA determined by analyzing DNA fibers and crystals in vitro (X-ray crystallography analysis) : “ B, A and Z ” B-DNA A-DNA - Right-handed - Right-handed - It forms under conditions - It is seen in condition of of high humidity low humidity - It is the structure that - It is present in DNA- most closely corresponds protein complexes to that of DNA in the cell B-DNA is thinner and longer than A-DNA for the same number of base pairs 21 Different DNA structures Z-DNA - It is a left-handed helical structure - It has a zigzag arrangement of the sugar- phosphate backbone (it is formed by alternating purines and pyrimidines, like GCGCGC) - A small amount of the DNA in a cell exists in the Z form - This different structure is involved in some way in regulation of some cellular function, but conclusive evidence for or against this proposal is not available yet. Z-DNA is thin and elongated 22 11  10/14/2024 Different DNA structures B-DNA : wide major groove / narrow minor groove (same depth) A-DNA : narrow and very deep major groove / wide and shallow minor groove Z-DNA : deep minor groove and not distinct major groove 23 DNA in the Cell DNA in the cell is in solution, which is a different state from the DNA used in X-ray crystallography experiments. DNA in solution has 10.5 base pairs per turn, which is a little less twisted than B-DNA. ❖Structure-wise, DNA in the cell most closely resembles B-DNA, and most of the genome is in that form. ❖In certain DNA–protein complexes, though, the DNA assumes the A- DNA structure. ❖Whether Z-DNA exists in cells has long been a topic of debate among scientists. In those organisms where there is some evidence for Z-DNA, its physiological significance is unknown. 24 12  10/14/2024 DNA versus RNA DNA RNA 25 DNA versus RNA DNA and RNA: types of nucleic acid, polymers of nucleotides, same configuration Both are found in all living things, DNA in nucleus and RNA in cytoplasm 26 13  10/14/2024 DNA versus RNA 27 RNA in the cell RNA: ✓ Single-stranded molecules ✓ RNA can fold up on itself (in a secondary structure) to produce region of anti-parallel double-stranded mRNA RNA separated by segments of unpaired RNA (this is the genome of tRNA certain viruses) * ncRNA RNA rRNA Hydrogen Loop bonding siRNA miRNA 28 14  10/14/2024 29 The Organization of DNA in Chromosomes Chromatin fiber (30 nm) Fiber loops (200 nm) 30 15  10/14/2024 The Organization of DNA in Chromosomes The Structure of Chromatin: Chromatin is the stainable material in a cell nucleus: DNA and proteins. Histones and nonhistones are two major types of proteins associated with DNA in chromatin. Both types of proteins play an important role in determining the physical structure of the chromosome. I- The histones are the most II- Nonhistones are all the proteins abundant proteins in chromatin. associated with DNA, apart from the They are small basic proteins histones. with a net positive charge that Nonhistones are far less abundant than facilitates their binding to the histones. negatively charged DNA. Many nonhistones are acidic proteins— Five main types of histones are proteins with a net negative charge. associated with eukaryotic Nonhistones include proteins that play a nuclear DNA: H1, H2A, H2B, role in the processes of DNA H3, and H4. replication, DNA repair, transcription ❖Histones play a crucial role in (including gene regulation), and chromatin packing recombination. The structure of Chromatin Non-histones proteins are less abundant than histones. Many non-histones are acidic proteins (negative charge). They include proteins that play a role in the processes of : DNA replication DNA repair Transcription (including gene regulation) Recombination In contrast to the histones, the non-histone proteins differ in number and type from cell type to cell type within an organism, at different times in the same cell type, and from organism to organism. 32 16  10/14/2024 The structure of Chromatin The amino acid sequences of histones H2A, H2B, H3, and H4 are highly conserved (even between distantly related species). Evolutionary conservation = strong indicator that histones perform the same basic role in organizing the DNA in the chromosomes of all eukaryotes. Histones play a crucial role in chromatin packing. Several levels of packing enable chromosomes that would be several millimeters or even centimeters long to fit into a nucleus that is a few micrometers in diameter. 33 The structure of Chromatin With the electron microscope, different chromatin structures are seen. The least compact form seen is the 10-nm chromatin fiber, which has a characteristic “beads-on-a-string” morphology; the beads have a diameter of about 10 nm. The beads are nucleosomes, the basic structural units of eukaryotic 34 chromatin. 17  10/14/2024 The structure of Chromatin A nucleosome is about 11 nm in diameter and consists of a core of 8 histone proteins (two each of H2A, H2B, H3, and H4). Around the nucleosome, a 147-bp segment of DNA is wound about 1.65 times. This configuration serves to compact the DNA by a factor of about 6. 35 The structure of Chromatin Individual nucleosomes are connected by strands of linker DNA (variable length). The next level of chromatin condensation is done by histone HI. The binding of HI causes the nucleosomal DNA to assume a more regular appearance with a zigzag arrangement. The nucleosomes themselves then compact into a structure about 30 nm in diameter, called the 30-nm chromatin fiber. 36 18  10/14/2024 The structure of Chromatin One possible model for the 30-nm fiber : the solenoid model. It is an irregular zigzag of nucleosomes. Chromatin packing beyond the 30-nm chromatin filaments is less well understood : loops of DNA attached to a protein “scaffold” with the characteristic X shape of the paired sister chromatids. Scaffold-associated regions = SARs = bind to the non-histone proteins to determine the loops (spiral fashion). 37 The structure of Chromatin Chromatin fiber (30 nm) Fiber loops (200 nm) 38 19  10/14/2024 Organization of Genetic material p arm q arm 39 Euchromatin and Heterochromatin The degree of DNA packing changes throughout the cell cycle. The most dispersed state = during duplication = beginning of S phase The most highly condensed = within mitosis and meiosis. Two forms of chromatin are defined, each on the basis of chromosome-staining properties. Euchromatin and Heterochromatin 40 20  10/14/2024 Euchromatin and Heterochromatin Euchromatin is the chromosomes or regions that show the normal cycle of chromosome condensation and decondensation in the cell cycle. Most of the genome of an active cell is in the form of euchromatin. Euchromatic DNA is actively transcribed, meaning that the genes within it can be expressed. Euchromatin is devoid of repetitive sequences. 41 Euchromatin and Heterochromatin Heterochromatin = chromosomal regions that usually remain condensed, more darkly staining than euchromatin—throughout the cell cycle, even in interphase Genes within heterochromatic DNA are usually transcriptionally inactive. 42 21  10/14/2024 Euchromatin and Heterochromatin There are 2 types of heterochromatin : (1) Constitutive heterochromatin = present in all cells at identical positions = consists mostly of repetitive DNA (centromeres and telomeres). (2) Facultative heterochromatin = varies in state in different cell types and at different developmental stage (The Barr body , an inactivated X chromosome). Chromosome material that can be either heterochromatin or euchromatin. 43 Dosage Compensation (Xist gene) Male Female X Y X X 1 Dose (X) 2 Doses (2X) XX XX XX All generations All generations 22  10/14/2024 Telomere and Centromere A telomere, a specific set of sequences at the end of a linear chromosome, stabilizes the chromosome and is required for replication. A centromere is the region of a chromosome containing DNA sequences to which mitotic and meiotic spindle fibers attach. It is responsible for the accurate segregation of replicated chromosomes to the daughter cells during mitosis and meiosis. 45 Organization of Genetic material p arm q arm 46 23  10/14/2024 Classes of DNA sequence In the genome, we find: Unique-sequences DNA * Moderately repetitive DNA Highly repetitive DNA They are present in They appear from few They appear from 105 one to just a few to about 105 copies to about 107 copies copies in the genome Repetitive-sequences DNA They are most of the genes we know Dispersed (or about (the proteins- Tandemly repeated coding genes) interspersed) repeated DNA: clustered together DNA: distributed at and repeated in a row irregular intervals They are estimated to make up approximately 55- 60% of the genome 47 Classes of DNA sequence GAAAATAGGGTATCATGCGCGAAAGTAACATTGACAGACAGGGTATCC Dispersed repeated DNA: - DNA sequence from 2 nucleotides - DNA sequence from 7 nucleotides GAAAATGCAAATGCAAATGCGACAGTACAATTGACAGACAGGGCATCC Tandemly repeated DNA: - DNA sequence from 6 nucleotides 48 24  10/14/2024 Classes of DNA sequence In the genome, we find: Unique-sequences DNA * Moderately repetitive DNA Highly repetitive DNA They are present in They appear from few They appear from 105 one to just a few to about 105 copies to about 107 copies copies in the genome Repetitive-sequences DNA They are most of the genes we know Dispersed (or about (the proteins- Tandemly repeated coding genes) interspersed) repeated DNA: clustered together DNA: distributed at and repeated in a row irregular intervals They are estimated to make up LINE SINE approximately 55- - Length vary (1000-7000 (100-400 bp 60% of the genome - Gene or not * bp long) long) 49 Classes of DNA sequence In prokaryotes, all of the genome is present as unique-sequence DNA (with the exception of the rRNA, tRNA and a few other sequences). In contrast, eukaryotic genomes consist of both unique-sequence and repetitive-sequence DNA We have sketchy information about the distribution the various classes of repetitive sequences in the genome. All eukaryotic organisms have LINE and SINE, with a wide variation in their relative proportions Tandemly repeated DNA is common in eukaryotic genomes, but with different sequences, number of copies and number of types 50 25