VCE Biology Year 11 PDF

Getting started with the Collaboration Space Thursday, June 9, 2022 12:56 PM The Collaboration Space is open to everyone in a class, and all class members can read or write on anything in this part of the notebook. Teachers and students can also create new sections and pages in ways that work bes...

Getting started with the Collaboration Space Thursday, June 9, 2022 12:56 PM The Collaboration Space is open to everyone in a class, and all class members can read or write on anything in this part of the notebook. Teachers and students can also create new sections and pages in ways that work best for them. For example, if a class splits up into group projects, each group could create a section where students can work together and share project-related materials. Educators can also create private sections in the Collaboration Space. Better than a document on a file share or shared drive With a Collaboration Space: Multiple people can edit a document at the same time. Changes are merged automatically. The Collaboration Space section group is available offline for everyone. Keep your class "on the same page." The Collaboration Space is great for storing: Class project vision and brainstorming ideas Supporting materials collected by group members To-do lists for students to mark off Using the Collaboration Space Page 1 11 Biology welcome Welcome to Year 11 Biology This content library is sorted into the two Units in Biology. Each unit will take approximately one semester. There will be 4 assessments for each unit, all require an 'S' to pass the Unit. You will also be required to complete weekly homework, quizzes and work requirements, as well as the SACs to pass the units. READ the VCAA study design and be aware of the Outcomes and Key Knowledge for each of the Areas of Study. Biology Admin Page 2 VCAA Study Design 2022BiologySD Biology Admin Page 3 Biology Admin Page 4 Biology Admin Page 5 Biology Admin Page 6 Biology Admin Page 7 Biology Admin Page 8 Biology Admin Page 9 Biology Admin Page 10 Biology Admin Page 11 Biology Admin Page 12 Biology Admin Page 13 Biology Admin Page 14 Biology Admin Page 15 Biology Admin Page 16 Biology Admin Page 17 Biology Admin Page 18 Biology Admin Page 19 Biology Admin Page 20 Biology Admin Page 21 Biology Admin Page 22 Biology Admin Page 23 Biology Admin Page 24 Biology Admin Page 25 Biology Admin Page 26 Biology Admin Page 27 Biology Admin Page 28 Biology Admin Page 29 Biology Admin Page 30 Biology Admin Page 31 Biology Admin Page 32 Biology Admin Page 33 Biology Admin Page 34 Biology Admin Page 35 Biology Admin Page 36 Biology Admin Page 37 Biology Admin Page 38 Biology Admin Page 39 Biology Admin Page 40 Biology Admin Page 41 Biology Admin Page 42 Biology Admin Page 43 Biology Admin Page 44 Biology Admin Page 45 Biology Admin Page 46 Study Design Tuesday, 19 November 2024 4:04 PM Here is a link to the Study design for all of VCE Biology https://www.vcaa.vic.edu.au/Documents/vce/biology/2022BiologySD.docx Biology Admin Page 47 SACs (TBC) REPORTABLE ASSESSMENT TASKS (RATs): Outcomes Assessment task Approx date TBC UNIT 2: Outcome 1 Data analysis of generated primary and/or On completion of this unit the student should be able to explain and compare chromosomes, collated secondary data - genetics and genomes, genotypes and phenotypes, and analyse and predict patterns of inheritance. inheritance. UNIT 2: Outcome 2 Report of a fieldwork activity including the On completion of this unit the student should be able to analyse advantages and disadvantages of generation of primary data. reproductive strategies, and evaluate how adaptations and interdependencies enhance survival of species within an ecosystem. UNIT 2: Outcome 3 Response to an investigation into a bioethical On completion of this unit the student should be able to identify, analyse and evaluate a bioethical issue relating to genetics or reproductive issue in genetics, reproductive science or adaptations beneficial for survival. science. End of Semester Examination Examination covering the components of Unit 2 Biology, including all Areas of Study Biology Admin Page 48 Study Design Sunday, 24 November 2024 4:29 PM Key knowledge From chromosomes to genomes the structure of DNA and chromosomes the role of DNA in protein synthesis. the distinction between genes, alleles and a genome the nature of a pair of homologous chromosomes carrying the same gene loci and the distinction between autosomes and sex chromosomes variability of chromosomes in terms of size and number in different organisms karyotypes as a visual representation that can be used to identify chromosome abnormalities the production of haploid gametes from diploid cells by meiosis, including the significance of crossing over of chromatids and independent assortment for genetic diversity Genotypes and phenotypes the use of symbols in the writing of genotypes for the alleles present at a particular gene locus the expression of dominant and recessive phenotypes, including codominance and incomplete dominance proportionate influences of genetic material, and environmental and epigenetic factors, on phenotypes Patterns of inheritance pedigree charts and patterns of inheritance, including autosomal and sex-linked inheritance predicted genetic outcomes for a monohybrid cross and a monohybrid test cross predicted genetic outcomes for two genes that are either linked or assort independently. From 1 Chromosomes to genomes Page 49 1.1 - The Nucleus Unit 2: How does inheritance impact on diversity? Area of Study 1: How is inheritance explained? DNA, genes, chromosomes, and protein synthesis. Mitosis and Meiosis Patterns of Inheritance Area of Study 2: How do inherited adaptations impact on diversity? Types of adaptations Interactions within ecosystems Area of Study 3: How do humans use science to explore and communicate contemporary bioethical issues? Study Design Key Knowledge the structure of DNA and chromosomes the role of DNA in protein synthesis. the distinction between genes, alleles and a genome Core Concept DNA contain information which a cell uses to function. Key Capabilities Students can: - draw diagrams and create models of nucleotides, a single strand and a double strand of DNA. - label a diagram of cell, nucleus, chromosome, DNA. Key Terminology Deoxyribonucleic Acid Nucleus Nuclear membrane Chromatin Cell Gene Chromosome Nucleotide Hydrogen bond Phosphodiester bond Nitrogen Base Adenine, Guanine, Thymine, Cytosine Phosphate Sugar Double Strand Timeline: The purpose of Headstart is to give you a taste for what Biology is all about, as well as to begin the course with some funda mental ideas. This time DNA and protein synthesis as we begin a unit on INHERITANCE. 1 Chromosomes to genomes Page 50 This time DNA and protein synthesis as we begin a unit on INHERITANCE. Day Topic Tasks Success Criteria Mon Intro to Biology PPT Intro to Biology Draw diagrams of a nucleotide, a single strand and a double strand of DNA. 25/11 Inheritance hook – what makes Label a diagram of cell, nucleus, chromosome, DNA. P5 us similar/different DNA and the genome.pdf What is DNA? DNA & the nucleus Chromosomes Mon DNA structure: nucleotides DNA model 25/11 DNA model activity P6 Tue Protein synthesis – Watch Learn Genetics: Describe the steps involved in transcription 25/11 transcription Transcribe and Translate Describe the steps involved in processing pre-m RNA to mRNA P3 DNA to RNA a Gene Wed Protein synthesis - translation Designer DNA Activity Describe the steps involved in translation. 27/11 Convert a DNA sequence to an mRNA sequence, and then, using a codon table, P1 to an amino acid sequence. Draw a schematic diagram showing all parts of protein synthesis Tue Taste test practical 3/12 DNA → protein → P1 enzymes Link DNA to inheritance Tue Review of protein synthesis Describe how information is encoded in DNA and instructs protein synthesis 3/12 Required homework for P2 holidays. Quiz Introduction: Resources 1 Welcome to biology... Activity 1: An Example Instructions Resources Often young people will report disliking What foods do you dislike the taste of? foods which have strong bitter flavours, such as: Artichoke Broccoli Coffee Dark Chocolate Mint Brussel Sprouts Grapefruit Ginger Green Tea Kale Dill Sweet Potatoes Cherries Seafood All Onion Black Liquorice Vegemite 1 Chromosomes to genomes Page 51  Vegemite Tofu Tomato Seaweed Mushrooms Olives Black Cat lollies Mint Raw fish Anchovies Resources https://www.youtube.com/watch?v=fqVSItNiWDTQU In 1931, a chemist named Arthur Fox was pouring some powdered PTC into a bottle. When some of the powder accidentally blew into the air, a colleague standing nearby complained that the dust tasted bitter. Fox tasted nothing at all. Curious how they could be tasting the chemical differently, they tasted it again. The results were the same. Fox had his friends and family try the chemical then describe how it tasted. Some people tasted nothing. Some found it intensely bitter, and still others thought it tasted only slightly bitter. Soon after its discovery, geneticists determined that there is an inherited component that influences how we taste PTC. Today we know that the ability to taste PTC (or not) is conveyed by a single gene. Key Question You probably know already that DNA acts as the 'instructions' to make you, and that 'genes' are parts of the DNA. But with what you know right now, how do you think that this one gene has such a big impact upon taste perception? It may affect the structure of your tastebuds It may affect the number of taste receptors on your tongue DNA --> RNA --> Amino acids --> Protein Activity 1.1: What are traits? Instructions Resources Watch Learn Genetics Traits What Are Traits? Activity 2: DNA Structure Introduction Instructions Resources PPT DNA 1 Chromosomes to genomes Page 52 Structure  PPT DNA Structure Watch this video on DNA structure which will help you to complete the https://youtu.be/C1CRrtkWwu0? Quiz and Activity 3 below. si=ISN9FQCgCHnWEW1- Quiz ` Activity 3: DNA Model Instructions Resources Here are some examples of completed DNA models. DNA Model 1 Chromosomes to genomes Page 53  DNA Model Colour in the components of DNA. Cut out all of the components and assemble a DNA molecule. You can decide on the order of the nitrogen base pairs in your DNA molecule. Combine your DNA molecule with the person next to you to create a longer chain. Activity 4: Nucleus, Chromosomes, and Genes. Instructions Resources Use the video to answer the following questions: 1. Outline the relationship between DNA, Genes, and Chromosomes. (Main Question) 2. Where is DNA found within a cell? 3. What are histones made from, and how do they relate to DNA? 4. How many chromosomes are in human cells, and where did they come from? 5. What is the name of the loose stringy like structure which DNA exists as for most of its time when its cell is not reproducing? https://www.youtube.com/watch?v=IePMXxQ-KWY Activity 5: DNA structure and the genome Instructions Resources Complete page 1 of the document. DNA and the Geno... 1 Chromosomes to genomes Page 54 What do you think now about how one gene can influence taste perception of bitterness? 1 Chromosomes to genomes Page 55 1.2 - Genes & Transcription Unit 2: How does inheritance impact on diversity? Area of Study 1: How is inheritance explained? DNA, genes, chromosomes, and protein synthesis. Mitosis and Meiosis Patterns of Inheritance Area of Study 2: How do inherited adaptations impact on diversity? Types of adaptations Interactions within ecosystems Area of Study 3: How do humans use science to explore and communicate contemporary bioethical issues? Study Design Key Knowledge the structure of DNA and chromosomes the role of DNA in protein synthesis. the distinction between genes, alleles and a genome Core Concept DNA contain information which a cell uses to function. Key Capabilities Students can: - draw diagrams of the steps involved in protein synthesis - Convert a section of DNA code to mRNA and protein using complementary base pairing rules and a codon table Key Terminology Deoxyribonucleic Acid Nucleus Nuclear membrane Chromatin Cell Gene Chromosome Nucleotide Hydrogen bond Phosphodiester bond Nitrogen Base Adenine, Guanine, Thymine, Cytosine Phosphate Sugar Double Strand Activity 1: DNA and Genes Instructions Resources 1 Chromosomes to genomes Page 56 Instructions Resources Watch the Stated Clearly video "What is DNA and how does it What is DNA and How Does it Work? work? Answer these questions in your workbook: What are amino acids? How many amino acids are there? What is a protein and why are they important in living things? What is DNA? How is DNA different to RNA? What happens on the ribosome? Activity 2: Protein synthesis ~10mins Information READ the information below or in the attached PPT: U2 0 Protein sy... Proteins are essential molecules for life on earth. They are long chains of amino acids. Proteins are the structural components of cells, they are the enzymes in your digestion, and help you to make ATP energy from your food. Photosynthesis is powered by enzymes, which are proteins. Without the process of protein synthesis, life would not function. Protein synthesis is the way cells produce proteins from DNA. It involves a number of steps: - Transcription - RNA processing (not in diagram below but does occur!) - Translation Once the polypeptide chain is made, there is modification and folding of the chain/s to make a protein. DNA is a double stranded nucleic acid, whereas RNA, ribonucleic acid, is single stranded. In eukaryotes, DNA stays in the nucleus, whereas RNA can travel from the nucleus, into the cytoplasm. Main Types of RNA RNA functions to transfer genetic instructions from the nucleus to the cytoplasm, where the information is decoded (by ribosomes). There are three main types of RNA which cooperate to complete this goal: Messenger RNA (mRNA) – a transcript copy of a specific DNA sequence (which encodes for the synthesis of a polypeptide) Transfer RNA (tRNA) – carries the polypeptide subunits (amino acids) to the organelle responsible for synthesis (ribosome) Ribosomal RNA (rRNA) – a primary component of the ribosome and is responsible for its catalytic activity 1 Chromosomes to genomes Page 57 Proteins are a class of molecules that are coded by DNA (the genetic instructions within a cell) and carry out a diverse array of functions. Proteins are also used in protein synthesis, such as DNA polymerase and RNA polymerase! Protein synthesis summary: 1 Chromosomes to genomes Page 58 1. DNA (in nucleus) is transcribed to mRNA 2. Some modifications are made to the mRNA strand to make it ready for travel 3. mRNA leaves nucleus 4. mRNA enters cytoplasm 5. mRNA hooks up with ribosomes 6. Ribosomes scroll through mRNA 7. tRNA delivers amino acids to mRNA/ribosome complex 8. Anticodons on the tRNA match up with complementary mRNA codons and tRNA delivers the amino acid 9. Amino acids are joined together to form a protein by the formation of peptide bonds between adjacent amino acids. Activity 3: Protein synthesis video ~ 3min Instructions Resources Watch the video From DNA to protein - 3D from "Your genome" From DNA to protein - 3D Activity 4: Bioman Biology Protein synthesis RACE ~25min Instructions Resources Use the interactive below to learn more about the steps in protein synthesis: BioMan Biology Whilst you complete the interactive, complete the questions on the worksheet. Protein Synthesis... Upload the worksheet to your onenote. Activity 5: Transcription Example Instructions Resources 1 Chromosomes to genomes Page 59 Instructions Resources Complete the worksheet: Transcription worksheet 1.pdf Transcriptio nWorkshe... 1 Chromosomes to genomes Page 60 1.3 - Translation Unit 2: How does inheritance impact on diversity? Area of Study 1: How is inheritance explained? DNA, genes, chromosomes, and protein synthesis. Mitosis and Meiosis Patterns of Inheritance Area of Study 2: How do inherited adaptations impact on diversity? Types of adaptations Interactions within ecosystems Area of Study 3: How do humans use science to explore and communicate contemporary bioethical issues? Study Design Key Knowledge the structure of DNA and chromosomes the role of DNA in protein synthesis. the distinction between genes, alleles and a genome Core Concept DNA contain information which a cell uses to function. Key Capabilities Students can: - draw diagrams of the steps involved in protein synthesis - convert a section of DNA code to mRNA and protein using complementary base pairing rules and a codon table Key Terminology Deoxyribonucleic Acid Nucleus Nuclear membrane Chromatin Cell Gene Chromosome Nucleotide Hydrogen bond Phosphodiester bond Nitrogen Base Adenine, Guanine, Thymine, Cytosine Phosphate Sugar Double Strand RNA tRNA mRNA rRNA Transcription Translation Plenary: Quick Review Label each feature of the DNA strand shown below. 1 Chromosomes to genomes Page 61  Plenary: Quick Review The central dogma of molecular biology explains the flow of genetic information within the cell. DNA codes for RNA via the process of transcription (which occurs within the nucleus of eukaryotic cells) RNA codes for protein via the process of translation (occurs at free ribosomes or at the rough ER) Answer the following questions: 1. What is the main purpose of transcription in protein synthesis? A. To replicate DNA B. To synthesize proteins C. To convert DNA into mRNA D. To transport amino acids to the ribosome 2. Where does transcription occur in the cell in eukaryotes? A. cytoplasm B. ribosome C. nucleus D. Mitochondria 3. Which enzyme is responsible for synthesizing mRNA during transcription? A. DNA polymerase B. RNA polymerase C. Helicase D. Ligase 4. Which of the following is NOT involved in the process of transcription? A. RNA polymerase B. DNA template C. Ribosome 1 Chromosomes to genomes Page 62  C. Ribosome D. Nucleotides Information REVIEW the information below Protein synthesis summary: 1. DNA (in nucleus) is transcribed to mRNA 2. Some modifications are made to the mRNA strand to make it ready for travel 3. mRNA leaves nucleus 4. mRNA enters cytoplasm 5. mRNA hooks up with ribosomes 6. Ribosomes scroll through mRNA 7. tRNA delivers amino acids to mRNA/ribosome complex 8. Anticodons on the tRNA match up with complementary mRNA codons and tRNA delivers the amino acid 9. Amino acids are joined together to form a protein by the formation of peptide bonds between adjacent amino acids. Activity 1: Protein synthesis TRANSLATION video ~ 3min Instructions Resources Watch the video "Translation" from ndsuvirtualcell Translation Answer the following questions: 1. What is the role of mRNA in the process of translation? 2. How do ribosomes contribute to protein synthesis during translation? 3. What are the key steps involved in the initiation phase of translation? 4. How do tRNA molecules assist in the elongation phase of translation? 5. What happens during the termination phase of translation, and how is the newly synthesized protein released? OPTIONAL: Alternate video with greater explanation TO SHOW IN CLASS: Protein Synthesis Part 2 - Transcription and Translation - GCSE Biology (9-1) 1 Chromosomes to genomes Page 63 Activity 2: Watch translation model Instructions Resources Watch this video: HHMI Translation (basic) https://youtu.be/waMKsvxgM1Y Activity 3: Transcription & Translation Instructions Copy the following diagram into your notes and label: Activity 4: Codons and translating the code Information Read the following Cells decode mRNAs by reading their nucleotides in groups of three, called codons. 1 Chromosomes to genomes Page 64 Cells decode mRNAs by reading their nucleotides in groups of three, called codons. Here are some features of codons: Most codons specify an amino acid Three "stop" codons mark the end of a protein One "start" codon, AUG, marks the beginning of a protein and also encodes the amino acid methionine A codon chart is a tool used to decode the sequence of nucleotides (A, U, C, G) in mRNA into a sequence of amino acids, which then form proteins. Each group of three nucleotides on the mRNA is called a codon. Steps to Use a Codon Chart: 1. Transcription: DNA is transcribed into mRNA. For example, if the DNA sequence is TAC, the mRNA sequence will be AUG. 2. Identify Codons: mRNA is read in sets of three nucleotides (codons). For example, AUG, GCU, UAA. 3. Use the Codon Chart: Find the first letter of your codon on the left side of the chart. Find the second letter at the top of the chart. Find the third letter on the right side of the chart. Where these three intersect, you will find the amino acid. OR 3. Use the Codon Wheel: Start at the Center: Find the first letter of your codon in the innermost circle. Move Outward: From the first letter, move to the next circle to find the second letter of your codon. Find the Third Letter: Continue to the outermost circle to find the third letter. Determine the Amino Acid: The outermost section where the third letter is located will indicate the amino acid. Example of translation: Anticodons on the tRNA match up with complementary mRNA codons and tRNA delivers the amino acid (tRNA not shown in this diagram!). 1 Chromosomes to genomes Page 65  CODON CHART CODON WHEEL Activity 5: Protein synthesis model Instructions Resources Complete the model as directed by your teacher. Protein synthesis... Activity 6: Translation Practice Instructions Resources Complete the worksheet: Protein Synthesis Overview worksheet.doc Protein Synthesis... Activity 7: PTC taste test Instructions Resources Complete the activity to see if you are a SUPERTASTER! ACT Bitter Taste Per... Activity 8: More Translation Practice Instructions Resources Complete the worksheet: Felix Fur Colour.pdf NOTE: there are two copies of the same worksheet in this document - please only do one! Felix Fur Color 1 Chromosomes to genomes Page 66 1.4 - Review Unit 2: How does inheritance impact on diversity? Area of Study 1: How is inheritance explained? DNA, genes, chromosomes, and protein synthesis. Mitosis and Meiosis Patterns of Inheritance Area of Study 2: How do inherited adaptations impact on diversity? Types of adaptations Interactions within ecosystems Area of Study 3: How do humans use science to explore and communicate contemporary bioethical issues? Study Design Key Knowledge the structure of DNA and chromosomes the role of DNA in protein synthesis. the distinction between genes, alleles and a genome Core Concept DNA contain information which a cell uses to function. Key Capabilities Students can: - Describe the process of transcription and translation. - Determine the amino acid sequence of a protein, using a DNA template. Key Terminology Deoxyribonucleic Acid Nucleus Chromosome Nucleotide Hydrogen bond Phosphodiester bond Nitrogen Base Adenine, Guanine, Thymine, Cytosine Phosphate Sugar Double Strand Protein Synthesis Helicase Protein Synthesis Transcription RNA Polymerase Translation mRNA Cytoplasm Ribosome tRNA Amino acid 1 Chromosomes to genomes Page 67 Amino acid Codon Start Codon Stop Codon Anticodon Peptide bond Protein Plenary: Quick Review (5 mins) Plenary: Labelling + Word Game Activity 1: Translation Practice Instructions Resources 1 Chromosomes to genomes Page 68 Complete the worksheet: Felix Fur Colour.pdf NOTE: there are two copies of the same worksheet in this document - please only do one! Felix Fur Color Activity 2: SWIFTY Translation Practice Instructions Resources Complete the activity: SWIFTY Synthesis Instructions will be given by the teacher. Complete your answers on the worksheet. Swiftie Synthesis... Swiftie Synthesis... Codon Table Activity 3: Mutations Instructions Resources There are many ways in which DNA can become DNA - accidentally altered. The result can include changes TACCGAGCTATGTCCCATGATGATATC to the sequence of DNA, which can have significant effects upon the proteins which are produced within mRNA - a cell. AUGGCUCGAUACAGGGUACUACUAUAG These accidental alterations are called mutations. AA - Met - Ala - Arg - Tyr - Arg - Val - Leu - Leu - Stop 1.. Make a mutation to the DNA shown on the right to change one of the amino acids to a different amino acid. 2.. Make a mutation to the DNA shown on the right to change one of the amino acids into a stop. 1 Chromosomes to genomes Page 69 to change one of the amino acids into a stop. 3.. Which of these mutations do you think would have a larger impact upon the functioning of the cell? Why? 1 Chromosomes to genomes Page 70 1.5 - DNA Replication Unit 2: How does inheritance impact on diversity? Area of Study 1: How is inheritance explained? DNA, genes, chromosomes, and protein synthesis. Mitosis and Meiosis Patterns of Inheritance Area of Study 2: How do inherited adaptations impact on diversity? Types of adaptations Interactions within ecosystems Area of Study 3: How do humans use science to explore and communicate contemporary bioethical issues? Study Design Key Knowledge the structure of DNA and chromosomes the distinction between genes, alleles and a genome the process of DNA replication. Key Capabilities Students can: - Describe the structure of chromosomes. - Outline the process of DNA replication. - Explain the effect of mutations during DNA replication upon proteins. Activity 1: Nucleus, Chromosomes, and Genes. Instructions Resources Use the video to answer the following questions: 1. Define the term chromosome. 2. Outline the relationship between DNA, Genes, and Chromosomes. 3. Describe the relationship between histones and DNA. 4. When are chromosomes packed tightly, and what is the purpose of this tight packing? https://www.youtube.com/watch?v=IePMXxQ-KWY 5. State the number of chromosomes in human cells, and where they came from? 6. What is the name of the loose stringy like structure which DNA exists as for most of its time when its cell is not reproducing? 1 Chromosomes to genomes Page 71 Chromoso me pics fo... Activity 2: DNA Replication Introduction Instructions Resources Note the main features of the DNA replication process. 2025 DNA Replication Activity 3: DNA Replication Activity Instructions Resources Work through the interact and learn section. There is too much detail in this interactive; however, often it is good to see how a cell uses different tools together to achieve a simple looking task. https://biomanbio.com/HTML5GamesandLabs/LifeChemgames/replicationi nteractivepage.html 1 Chromosomes to genomes Page 72  nteractivepage.html Activity 4: Instructions Resources DNA Replication (Updated) Watch the Amoeba sisters video: DNA Replication It has some reference to the cell cycle - more detail on this soon. For now focus on the main players of DNA replication. Complete the handout to summarise the main steps in DNA replication. video_reca p_of_dna... 1 Chromosomes to genomes Page 73 1.6 - Chromosomes & Karyotypes Unit 2: How does inheritance impact on diversity? Area of Study 1: How is inheritance explained? DNA, genes, chromosomes, and protein synthesis. Mitosis and Meiosis Patterns of Inheritance Area of Study 2: How do inherited adaptations impact on diversity? Types of adaptations Interactions within ecosystems Area of Study 3: How do humans use science to explore and communicate contemporary bioethical issues? Study Design Key Knowledge the nature of a pair of homologous chromosomes carrying the same gene loci and the distinction between autosomes and sex chromosomes variability of chromosomes in terms of size and number in different organisms karyotypes as a visual representation that can be used to identify chromosome abnormalities Key Capabilities Students can: - Describe the structure of chromosomes. - Match pairs of homologous chromosomes to form a karyotype Activity 1: Review chromosomes, genes, and number of chromosomes. Resources What do you know about this image? 1 Chromosomes to genomes Page 74  What is a gene? How many chromosomes do humans have? What are two main features of DNA replication? 1 Chromosomes to genomes Page 75  What are two main features of DNA replication? Activity 1: Human Genome Project Instructions Resources Spend 5-10mins learning about the human genome project and where genes are found Human Genome Project | Hum Click on any chromosome in the list to see the selected traits and disorders associated with that chromosome. Share your learnings with the class Activity 2: Chromsomes and karyotypes PPT Skip pages 17-33 (we will re-visit) Instructions Resources Learn about chromosomes and karyotypes U2 2 Chromoso... A simplified version of the chromosomes PPT - without ploidy Chromoso mes 1 Chromosomes to genomes Page 76 Activity 3: Make a karyotype Instructions Resources Use this interactive to match the homologous chromosomes and form a karyotype. Make a Karyotype Follow the instructions on the interactive to drag and drop the chromosomes. Activity 4: Glossary Matchup Instructions Resources Complete the glossary page by matching the term with the definition. Deoxyribonucleic Acid Nucleus Nucleotide Nitrogen Base Protein Synthesis Glossary Transcription Filling Task RNA Polymerase Translation Ribosome Amino acid Protein Chromosome Gene Protein DNA Replication Helicase DNA Polymerase Allele Karyotype Sister Chromatid Homologous Chromosomes 1 Chromosomes to genomes Page 77  Homologous Chromosomes Allele Karyotype Centromere Sister Chromatid Histone Chromatin DNA Replication Helicase DNA Polymerase Ligase 1 Chromosomes to genomes Page 78 Glossary Solutions Term Definition Deoxyribonucleic Acid A double-stranded molecule containing genetic information that determines the characteristics of living organisms. It is composed (DNA) of nucleotides arranged in a double helix. Nucleus The membrane-bound organelle in eukaryotic cells that houses DNA and controls cellular activities. Nucleotide The basic structural unit of DNA and RNA, consisting of a phosphate group, a sugar (deoxyribose or ribose), and a nitrogenous base. Nitrogen Base A component of nucleotides that forms the genetic code in DNA and RNA. The four bases in DNA are adenine (A), thymine (T), cytosine (C), and guanine (G). Protein Synthesis The process by which cells produce proteins using instructions encoded in DNA. It involves transcription and translation. Transcription The first stage of protein synthesis where a segment of DNA is copied into messenger RNA (mRNA) inside the nucleus. RNA Polymerase An enzyme that catalyzes the synthesis of mRNA from a DNA template during transcription. Translation The process in which ribosomes read mRNA sequences and assemble amino acids into proteins using transfer RNA (tRNA). Ribosome A cellular structure composed of RNA and proteins that facilitates the assembly of amino acids into proteins. Amino Acid The building blocks of proteins, linked together in a specific sequence to form polypeptides. Protein A macromolecule composed of amino acids that perform essential functions in the body, such as enzymatic activity, structural support, and cellular communication. Chromosome A thread-like structure composed of DNA and proteins that carries genetic information. Humans have 46 chromosomes in their somatic cells. Gene A segment of DNA that contains the instructions for making a specific protein or functional RNA molecule. DNA Replication The process by which DNA makes an identical copy of itself before cell division to ensure genetic continuity. Helicase An enzyme that unwinds and separates the two strands of the DNA double helix during DNA replication. DNA Polymerase An enzyme that adds complementary nucleotides to the growing DNA strand during replication. Allele An alternative form of a gene that occurs at a specific locus on a chromosome, responsible for genetic variation. Karyotype A visual representation of an organism’s chromosomes, used to identify chromosomal abnormalities. Sister Chromatid One of two identical copies of a chromosome joined together at the centromere, formed during DNA replication. Homologous A pair of chromosomes, one from each parent, that carry genes for the same traits but may have different alleles. Chromosomes Centromere The region of a chromosome where sister chromatids are joined and where spindle fibers attach during cell division. Histone A protein that helps package DNA into chromatin by forming nucleosomes, allowing efficient DNA organization in the nucleus. Chromatin The loosely coiled form of DNA and proteins present in the nucleus when the cell is not dividing. Ligase An enzyme that joins fragments of DNA together, particularly during DNA replication and repair. 1 Chromosomes to genomes Page 79 1.7 - Cell Division Unit 2: How does inheritance impact on diversity? Area of Study 1: How is inheritance explained? DNA, genes, chromosomes, and protein synthesis. Mitosis and Meiosis Patterns of Inheritance Area of Study 2: How do inherited adaptations impact on diversity? Types of adaptations Interactions within ecosystems Area of Study 3: How do humans use science to explore and communicate contemporary bioethical issues? Study Design Key Knowledge the eukaryotic cell cycle, including the characteristics of each of the sub- phases of mitosis and cytokinesis in plant and animal cells the process of mitosis. Key Capabilities Students can: - Understand the purpose of mitosis and the cell cycle. - Identify the stages of mitosis from microscope images. - Model the stages of mitosis The purpose of cell division Cell division occurs when a single parent cell divides into two genetically identical daughter cells. The fundamental purpose of replication is the passing on of genetic material (DNA) to the next generation of offspring. In eukaryotic cells, cellular division is referred to as mitosis. Prokaryotic cells use a much simpler method known as binary fission (more on this later). In multicellular eukaryotes (plants, fungi, animals), the two main reasons for cellular replication are growth and repair. Growth All forms of life begin as a single cell. For some organisms, this is also where it ends. Others, such as 1 Chromosomes to genomes Page 80 All forms of life begin as a single cell. For some organisms, this is also where it ends. Others, such as yourself, grow and develop from a single, fertilised egg cell into a complex organism – consisting of more than 37 trillion cells. Mitosis is responsible not only for the division of cells that results in this growth, but also for the development of these 37 trillion cells into the 210 specialised types of cells inside your body. Repair Cells don’t all have the same lifespan. The neurons that make up your brain tissue are thought to last a lifetime, but the cells that line your stomach only last for a maximum of 5 days, because of the highly acidic environment they are in. Mitosis replaces worn-out or damaged cells, ensuring that, among other things, organs such as our stomach and our skin remain intact. Activity 1: Cell Division overview Instructions Resources Answer the questions after watching the animation Overview of Cell Division of "Overview of cell division". 1. What is the process called that cells use to reproduce and create new cells? 2. How do unicellular organisms like bacteria reproduce, and what is this type of reproduction called? 3. What role do chromosomes play in cell division, and how do they change appearance during this process? 4. How do somatic cells and gametes differ in terms of chromosome numbers in humans? 5. What happens when a sperm cell fertilizes an egg, and what is the resulting cell called? Watch this video for further detail on the Cell Cycle stages. How Do Cells Divide - Phases Of Mitosis - Cell Division And The Cell Cycle - Cellular Division Make your own notes about each stages of the cell cycle as you watch the video. 1 Chromosomes to genomes Page 81 Make your own notes about each stages of the cell cycle as you watch the video. Activity 2: The cell cycle and mitosis Instructions Resources Read this ppt - don’t worry too much about checkpoints at this stage - we will review this again. 6 The cell The important part is to learn the stages of mitosis cycle & m... and how it fits in the cell cycle and production of new cells. Add any extra information learnt to your notes. The cell cycle The cell cycle is the process that most eukaryotic cells undergo to multiply. The cell cycle consists of distinct stages that cells progress through in an orderly manner in preparation for division. As the parent cell gives rise to two genetically identical daughter cells, these daughter cells immediately commence their own pathway through the stages – hence the term ‘cycle’. On average, a typical human cell takes approximately 24 hours to progress through the cycle, although this can vary depending on the type of cell. Activity 3: Mitosis sequence Instructions Resources Complete the sorting activity using the cards. OR Cut up the pieces and re-arrange on an A3 paper. Annotate from what you know about the cell cycle. Cell Cycle Sequenci... 1 Chromosomes to genomes Page 82 Activity 4: Cell cycle summary Instructions Resources Complete the summary page in A3 format. Cell Cycle A3 Key Kn... Activity 5: Modelling mitosis - stop motion or photoboard Instructions Resources Model the stages of mitosis using pop beads and Here is a teacher completing a demonstration (it is long - you could the whiteboards or poster paper. shorten the process to make it better!). Mitosis demo with beads You could also use chalk markers on the benches. Annotate your drawings - and / or give a commentary of what is happening at each stage. Here is another reference: Modeling Mitosis and Meiosis (Activity) | General Biology Lab Manual Using Climate Change Modules Activity 6: Observing Mitosis under the Microscope Instructions Resources Identify cells in various stages of mitosis using the prepared slides. Practical-3B -2-Observ... Activity 7: Observing Mitosis under the Microscope Instructions Resources Structure of Plant roots Root growth is sustained by stem cells maintained at the root tip. This area of stem cells is called the quiescent Practical-3B center (QC) The stem cells differentiate into new cells of various types to form the structure of the root. As new -2-Observ... cells are produced, the root tip is pushed farther through the soil or medium. 1 Chromosomes to genomes Page 83 Identify cells in various stages of mitosis using the prepared slides. 1. Complete each of the six drawings of mitosis stages. 2. Complete questions 3-5. 3. Check your answers. Scientific Drawings of Microscope Images Drawings should be neat, showing only the main features. Not all cells need to be drawn; however, cells which are drawn should be accurate, and not simply a 'guess'. 1 Chromosomes to genomes Page 84 Activity 8: Preparing and onion slide for the Microscope Introduction Your Task Resources We will be preparing some slides of onion epithelial Follow the method shown in the video to prepare two slides. cells. - Iodine stained epithelial cells. Onion Cells Epithelial cells are cells which form protective barriers or layers on the inner and outer surfaces. - Methyl blue stained epithelial cells. Epithelial cells are very simple cells, which contain Complete the practical sheet, including drawings of each very few organelles. preparation. 1 Chromosomes to genomes Page 85 1.8 Meiosis Learning Intention To understand the processes of meiosis as the production of haploid gametes from diploid cells. To understand the significance of crossing over of chromatids and independent assortment for genetic diversity. Success Criteria □ Outline the purpose of and key steps in meiosis □ Distinguish between mitosis and meiosis □ State the biological advantage for offspring that are genetically diverse Lesson PPT U2 3 U2 3 Stages U2 4 Meiosis n... of Meiosis Mitosis vs... Key vocabulary Aneuploidy Autosomes Centromere Chiasma Chromatid Crossing over Diploid Fertilisation Gamete Gonads Haploid Homologous chromosomes Independent assortment Karyotype Meiosis Non-disjunction Sex chromosomes Sexual reproduction Synapsis Trisomy Zygote Asexual and sexual reproduction In asexual reproduction, the production of offspring requires just one parent organism. Offspring are genetically identical to, or clones of, the parent organism. Sexual reproduction, which is a method of reproduction that relies on the fusion of the nuclei of two sex cells (e.g. egg and sperm) from two parents (typically male and female). The offspring have received genetic information from both parents, and so they are not genetically identical to either parent. 1 Chromosomes to genomes Page 86 Sexual reproduction involves the contribution of genetic information from two parents via their gametes, which fuse during fertilisation to form a zygote. Activity 1 Resources Watch this video about the process of fertilisation in Fertilization humans. THE BEST VIDEO!! Haploid and diploid Note the terms haploid (n) and diploid (2n). These terms describe the number of chromosomes in the respective cells. The letter n is the symbol used to represent the number of chromosomes in one set of the organism’s DNA. Diploid - 2n, indicates that a diploid cell has twice as many chromosomes as a haploid (n) cell. For example, in humans, the amount of genetic information carried by the gametes, the haploid cell, is 23 single chromosomes. When the ovum and the sperm meet and fuse, the zygote formed contains 23 pairs of chromosomes, the diploid number. Geneticists use a karyotype, a pictorial representation of the chromosomes in the nucleus of an individual’s somatic cell, to determine the diploid number of chromosomes. Different organisms have different diploid numbers. Western clawed frog Golden Perch fish 1 Chromosomes to genomes Page 87 2n = 20 2n = 48 Meiosis Meiosis is the process by which animals and plants produce gametes for sexual reproduction. This process occurs in the gonads of sexually reproducing organisms (in humans, the testes and ovaries). The process begins with a parent cell, which is diploid, and results in four ‘daughter’ cells (the gametes), which are haploid. Remember, the gametes must contain only half the chromosomes of a somatic cell, so that when fertilisation occurs, the resulting zygote has the full set of chromosomes or a diploid number of chromosomes. Meiosis occurs in 2 stages: Meiosis I Separation of homologous pairs reducing the chromosome number by half (2n -->n) Meiosis II Sister chromatids are separated producing four haploid gametes These steps are further subdivided into several stages: interphase, prophase, metaphase, anaphase, telophase and cytokinesis (not a stage of meiosis). The events that occur during these stages are very similar to mitosis. 1 Chromosomes to genomes Page 88 The events that occur during these stages are very similar to mitosis. Activity 2 Resources Slowly step through each phase of meiosis using the interactive Interactive Meiosis from Cells Alive Activity 3 Resources Complete summary notes on each stage of meiosis using the Cells Alive resource, or the PPT. Stages of meiosis Increasing genetic diversity The advantage of sexual reproduction and meiosis is that they create genetic variation or diversity in the offspring. Variation is necessary for populations of organisms so some individuals are better adapted and to survive changes in the environment, including selection pressures such as disease or climate change, allowing for evolution to occur. There are three main sources of this genetic variation: crossing over (in prophase I) independent assortment (in metaphase I) random fusion of gametes from the two parents (fertilisation) Crossing over During prophase I, homologous chromosomes position themselves side by side, a process called synapsis. The non-sister chromatids of the homologous chromosomes are in contact with each other at points called chiasmata (singular: chiasma). This is the physical point at which crossing over may occur. 1 Chromosomes to genomes Page 89 The non-sister chromatids of a homologous pair of chromosomes get so close that some of the genetic material from the maternal chromosome swaps with some of the genetic material from the paternal chromosome. This results in the chromosomes being recombined in a new combination of genetic material, leading to more variation between the gametes. Crossing over during prophase I results in the formation of recombinant chromosomes with a new combination of genetic material. The green circle indicates the position of the chiasma. Independent assortment When homologous chromosomes line up in metaphase I, their orientation towards the opposing poles is random: the maternal chromosome may be on the left and the paternal chromosome on the right, or vice versa. This random orientation of the homologous pairs during metaphase I is called independent assortment. As this random assortment occurs for each homologous pair independently of the other pairs, the number of possible gamete combinations depends on the number of homologous pairs that the species has. In humans, the number of possible gamete combinations is 223 (or 8 388 608). Independent assortment during metaphase I results in many possible gamete combinations. Random fertilisation Random fertilization is the process of any sperm and egg randomly fusing during sexual reproduction. This process creates genetic variation in a population. During sexual reproduction, the gametes of two unrelated individuals fuse. Each human couple has the potential to produce more than 64 trillion genetically unique children 1 Chromosomes to genomes Page 90 Activity 3 Resources Complete the interactive on Bioman Biology. BioMan Biology Make Snurfle gametes and offspring to learn how meiosis and fertilisation occurs. When meiosis goes wrong: Non-disjunction & Aneuploidy Non-disjunction is when chromosomes do not separate as they should during meiosis I or meiosis II. The affected cells are circled in red. Chromosomal Abnormalities If a zygote is formed from a gamete that has experienced a non-disjunction event, the resulting offspring will have extra or missing chromosomes in every cell of their body Conditions that arise from non-disjunction events include: Patau’s Syndrome (trisomy 13) Edwards Syndrome (trisomy 18) Down Syndrome (trisomy 21) Klinefelter Syndrome (XXY) Turner’s Syndrome (monosomy X) Activity 4 Resources Complete non-disjunction activity in Bioman BioMan Biology Activity 5 1 Chromosomes to genomes Page 91 Activity 5 Copy and complete the table into your Comparison of Meiosis and Mitosis notes. This could also be made into a Venn Diagram. Feature Mitosis Meiosis Number of Divisions Number of Daughter Cells Genetic Description Chromosome Number Where When Role 1 Chromosomes to genomes Page 92 EXP Modelling Meiosis Modelling meiosis - stop motion or photoboard Instructions Resources Model the stages of meiosis using pop beads and the whiteboards or poster paper. meiosis pop You could also use chalk markers on the benches. bead activ... Mitosis and Meiosis Simulation from 5:50min Annotate your drawings - and / or give a commentary of what is happening at each stage. 1 Chromosomes to genomes Page 93 Study Design Key knowledge From chromosomes to genomes the structure of DNA and chromosomes the role of DNA in protein synthesis. the distinction between genes, alleles and a genome the nature of a pair of homologous chromosomes carrying the same gene loci and the distinction between autosomes and sex chromosomes variability of chromosomes in terms of size and number in different organisms karyotypes as a visual representation that can be used to identify chromosome abnormalities the production of haploid gametes from diploid cells by meiosis, including the significance of crossing over of chromatids and independent assortment for genetic diversity Genotypes and phenotypes the use of symbols in the writing of genotypes for the alleles present at a particular gene locus the expression of dominant and recessive phenotypes, including codominance and incomplete dominance proportionate influences of genetic material, and environmental and epigenetic factors, on phenotypes Patterns of inheritance pedigree charts and patterns of inheritance, including autosomal and sex-linked inheritance predicted genetic outcomes for a monohybrid cross and a monohybrid test cross predicted genetic outcomes for two genes that are either linked or assort independently. From 2 Genotypes Page 94 Study Design Key knowledge From chromosomes to genomes the structure of DNA and chromosomes the role of DNA in protein synthesis. the distinction between genes, alleles and a genome the nature of a pair of homologous chromosomes carrying the same gene loci and the distinction between autosomes and sex chromosomes variability of chromosomes in terms of size and number in different organisms karyotypes as a visual representation that can be used to identify chromosome abnormalities the production of haploid gametes from diploid cells by meiosis, including the significance of crossing over of chromatids and independent assortment for genetic diversity Genotypes and phenotypes the use of symbols in the writing of genotypes for the alleles present at a particular gene locus the expression of dominant and recessive phenotypes, including codominance and incomplete dominance proportionate influences of genetic material, and environmental and epigenetic factors, on phenotypes Patterns of inheritance pedigree charts and patterns of inheritance, including autosomal and sex-linked inheritance predicted genetic outcomes for a monohybrid cross and a monohybrid test cross predicted genetic outcomes for two genes that are either linked or assort independently. From 3 Patterns of Inheritance Page 95 1 Protein synthesis Keywords 1 Protein synthesis Deoxyribonucleic Acid (DNA) Nucleus Nucleotide Nitrogen Base Edrolo reference: Protein Synthesis Chapter 4A & 7 Transcription RNA Polymerase Translation Ribosome Amino Acid Protein Chromosome Gene DNA Replication Helicase DNA Polymerase Allele Centromere Histone Chromatin Ligase Karyotype Glossary Page 96 2 Cell Division - mitosis and meiosis Keywords 2 Cell Division anaphase Aneuploidy asexual reproduction autosomes binary fission Edrolo reference: cell cycle Chapter 4B&7B cell division centrioles Note - this section of centromere the course is taken chiasma from Unit 1 (mitosis) chromatid and Unit 2 (meiosis) chromatin chromosome crossing over cytokinesis diploid Fertilisation gamete haploid homologous chromosomes interphase independent assortment karyotype metaphase mitosis meiosis monosomy non-disjunction polyploidy prophase sex chromosomes sexual reproduction S stage of interphase sister chromatid spindle fibres synapsis trisomy telophase trisomy zygote Glossary Page 97 3 Genetics Keywords 3 Genetics Allele Alternative splicing Carrier Codominant Gene locus Edrolo reference: Gene Chapter 7 Genetics Genome Genomics Homologous chromosomes Hemizygous Incomplete dominance Inheritance Monohybrid cross Non-sister chromatids Sister chromatids Somatic cell Complete dominance Dominant Epigenetics Genotype Heterozygous Homozygous Phenotype Recessive Glossary Page 98 4 Inheritance Keywords 4 Inheritance Continuous variation Dihybrid cross Discontinuous variation First filial generation (F1) Linked genes Edrolo reference: Monohybrid cross Chapter 8 Multiallelic alleles Parental generation (P) Pedigree chart Polygenic trait Punnett square Segregation Sex-linked gene Test cross Unlinked genes X-linked Y-linked Glossary Page 99 Monday, April 18, 2022 12:29 PM Complementary base pairing Glossary Page 100  Monday, April 18, 2022 12:29 PM Enzyme Helicase un zips MRNA= Codons Trna= Anti condons 1. What is the role of mRNA in the process of translation? To make a copy of the DNA and take it into the Ribosome to be de coded 2. How do ribosomes contribute to protein synthesis during translation? The Ribosomes de code the codons on the mRNA and make proteins 3. What are the key steps involved in the initiation phase of translation? 4. How do tRNA molecules assist in the elongation phase of translation? 5. What happens during the termination phase of translation, and how is the newly synthesized protein released? DNA Nuclus Transcription mRNA Amino acid Cytosol Polypeptide chain tRNA Translation Anti condon Codon mRNA Ribosome UNIT 1 notes Page 101  Ribosome There are many ways in which DNA can become DNA - accidentally altered. The result can include changes TACCGAGCTATGTCCCATGATGATATC to the sequence of DNA, which can have significant effects upon the proteins which are produced within mRNA - a cell. AUGGCUCGAUACAGGGUACUACUAUAG These accidental alterations are called mutations. AA - Met - Ala - Arg - Tyr - Arg - Val - Leu - Leu - Stop 1.. Make a mutation to the DNA shown on the right to change one of the amino acids to a different amino acid. DNA - T A C AAA G C T A T G T C C C A T G A T G A T A TC mRNA - A U G UUU C G A U A C A G G G U A C U A C U A UAG AA - Met - Phe - Arg - Tyr - Arg - Val - Leu - Leu - Stop 2.. Make a mutation to the DNA shown on the right to change one of the amino acids into a stop. DNA - T A C C G A G C T A T G T C C C A T ATC mRNA - A U G G C U C G A U A C A G G G U A UAG AA - Met - Ala - Arg - Tyr - Arg - Val - Leu - Leu - Stop 3.. Which of these mutations do you think would have a larger impact upon the functioning of the cell? Why? Number one because the seqence in 2 is the same but different stop point and number one iscompletly diffrent Use the video to answer the following questions: UNIT 1 notes Page 102 Use the video to answer the following questions: 1. Define the term chromosome. An entire group of DNA 2. Outline the relationship between DNA, Genes, and Chromosomes. They all have DNA in them 3. Describe the relationship between histones and DNA. Inside a chromosome 4. When are chromosomes packed tightly, and what is the purpose of this tight packing? 5. State the number of chromosomes in human cells, and where they came from? 46 (23 pairs ) 6. What is the name of the loose stringy like structure which DNA exists as for most of its time when its cell is not reproducing? Chromotine UNIT 1 notes Page 103 Monday, April 18, 2022 12:29 PM C C B B UNIT 2 notes Page 104