Animal Viruses Chapter 13 PDF

Animal viruses Chapter 13  Multiplication of Animal viruses Attachment: Viruses attach to cell membrane. Penetration by endocytosis or fusion. Uncoating by viral or host enzymes. Biosynthesis: Production of nucleic acid and proteins. Maturation: Nucleic acid and ca...

Animal viruses Chapter 13  Multiplication of Animal viruses Attachment: Viruses attach to cell membrane. Penetration by endocytosis or fusion. Uncoating by viral or host enzymes. Biosynthesis: Production of nucleic acid and proteins. Maturation: Nucleic acid and capsid proteins assemble. Release by budding (enveloped viruses), export or rupture.  Attachment, Penetration, and Uncoating Phagocytosis Figure 13.14a  Attachment, Penetration, and Fusion Uncoating Figure 13.14b Release of an Enveloped Virus by Budding Figure 13.20  Summarize How does an animal virus life cycle compare to a bacteriophage? What are the major steps?  Key to Understanding Viral Replication Know how Normal Cells work For Eukaryotes – DNA in Nucleus – mRNA translated in cytoplasm – Replication – making copies of genome Requires a template – Transcription – making copies of genes as RNA Requires a template  Transcription making a mRNA 5’AATTGCATCACTAAGGTCAC3’ DNA of Gene 3’TTAACGTAGTGATTCCAGTG5’ – Coding or (sense) Strand = gene = + – Template (antisense) (complementary) = - – mRNA – 5’AAUUGCAUCACUAAGGUCAC3’ A sense strand RNA (can be translated) tRNAs have an “antisense” recognition Viral Genomes Viral genomes  Things to keep straight + strand = sense strand = mRNA – Ribosomes bind this - strand = antisense ≠ mRNA – Ribosomes don’t bind this or if they do it “doesn’t make sense” Viral RNA is transcribed by viral RNA dependent RNA polymerase – DNA polymerases make DNA – RNA polymerases make RNA Translation is always in cytoplasm  Multiplication of DNA Virus Note Capsid proteins Figure 13.15  DNA Viruses What type of genome Where does it go for uncoating or after uncoating? Where is it replicated? – By what process? Where are proteins made? Where is transcription? Which enzyme?  Sense Strand (+ Strand) RNA Virus Attachment Capsid Nucleus RNA Cytoplasm Host cell Entry Maturation and uncoating and release Translation and synthesis RNA replication by viral RNA- of viral proteins dependent RNA polymerase Uncoating releases – strand is transcribed viral RNA and proteins. from + viral genome. Capsid Viral Viral protein genome protein (RNA) (a) ssRNA; + + strand or sense strand; Picornaviridae mRNA is transcribed from the – strand. Figure 13.17a  Questions to Ponder How does the orientation of a Sense Strand virus compare to an mRNA? Where does the Genome go? How is it replicated? – What enzyme is used? – Where does this come from? Why is a – strand transcribed? Antisense Strand (— Strand) RNA Virus Attachment Capsid Nucleus RNA Cytoplasm Host cell Entry Maturation and uncoating and release Translation and synthesis RNA replication by viral RNA- of viral proteins dependent RNA polymerase Uncoating releases The + strand (mRNA) must first viral RNA and proteins. be transcribed from the – viral Viral Viral genome before proteins can genome protein be synthesized. (RNA) Capsid protein (b) ssRNA; – or – strands are antisense strand; incorporated Additional – strands are Rhabdoviridae into capsid transcribed from mRNA. Figure 13.17b  More Questions to Ponder How does the orientation of an Antisense Strand virus compare to an mRNA? Where does the Genome go? How is it replicated? – What enzyme is used? – Where does this come from? Why is a – strand transcribed? Why is a + strand transcribed? Double-Stranded RNA Virus Attachment Capsid Nucleus RNA Cytoplasm Host cell Entry Maturation and uncoating and release Translation and synthesis RNA replication by viral RNA- of viral proteins dependent RNA polymerase Uncoating releases RNA polymerase initiates production of mRNA is produced inside the viral RNA and proteins. – strands. The mRNA and – strands form the capsid and released into the cytoplasm of the host. Viral Viral dsRNA that is incorporated as new viral genome. genome protein (RNA) Capsid proteins and RNA- (c) dsRNA; + or sense dependent RNA polymerase strand with – or antisense strand; Reoviridae Figure 13.17c Pathways of Multiplication for RNA-Containing Viruses Figure 13.17 Multiplication of a Retrovirus Figure 13.19  Retroviruses How is the RNA genome converted to DNA? What enzyme is used? – Where does this come from? How does this compare to a lysogenic phage? What enzymes or stages of the virus might make a good target for anti- viral drugs?  DNA and RNA Viruses Compared DNA: Cellular enzyme transcribes viral DNA in nucleus. DNA: Retrovirus: Cellular enzyme transcribes viral DNA in nucleus; viral reverse transcriptase copies mRNA to make viral DNA. RNA: + strand: Viral RNA is a template for synthesis of viral RNA polymerase. RNA: - strand: Viral RNA is template for transcription using viral RNA polymerase  DNA and RNA Viruses Compared RNA – strand: Viral enzyme copies viral RNA to make mRNA in cytoplasm. RNA, double-stranded: Viral enzyme copies – strand RNA to make mRNA in cytoplasm. RNA, reverse transcriptase: Viral enzyme copes viral RNA to make DNA in cytoplasm.  Next Time Epidemiology