BIO273 Biology Telomeres PDF

BIO273 Biology Telomeres Antiparallel DNA Replication  DNA Polymerase can only add nucleotides to the 3’ end of DNA strand, resulting in a Continuous Leading strand Discontinuous Lagging strand  DNA Polymerase requires an RNA primer to start a new strand RNA is unstable (ex...

BIO273 Biology Telomeres Antiparallel DNA Replication  DNA Polymerase can only add nucleotides to the 3’ end of DNA strand, resulting in a Continuous Leading strand Discontinuous Lagging strand  DNA Polymerase requires an RNA primer to start a new strand RNA is unstable (extra –OH on Ribose site of potential activity) RNA primers are replaced with DNA once the upstream strand reaches it DNA Ligase joins the DNA fragments together to form a continuous strand SCHOOL OF BIOLOGICAL SCIENCES 2 AND APPLIED CHEMISTRY Lagging Strand Synthesis  At the end of the Lagging strand, the RNA primer will not be replaced, as there will be no approaching DNA Polymerase  As a result, at the end of every cycle of DNA replication, as short DNA sequence will be lost from Lagging strand synthesis SCHOOL OF BIOLOGICAL SCIENCES 3 AND APPLIED CHEMISTRY DNA Replication Forks  Prokaryotes = Circular DNA  Eukaryotes = Linear DNA SCHOOL OF BIOLOGICAL SCIENCES 4 AND APPLIED CHEMISTRY Loss of DNA  Lagging strand synthesis results in a loss of DNA at the end  Both Leading & Lagging strand synthesis are required to replicate each new strand of DNA  As a result, both newly replicated DNA strands will be shorter in length, with the loss of many bases at the ends SCHOOL OF BIOLOGICAL SCIENCES 5 AND APPLIED CHEMISTRY Telomeres  Remember how important is it for DNA to be an exact copy Every DNA replication results in a shorter Chromosome What if the lost DNA sequences was part of an important gene? Telomeres (Greek for “end” “part”)  Repetitive nucleotide sequence at the end of each Chromosome  Protects the end of Chromosomes from deterioration Sacrificial bases that do not code for anything  Eukaryotic linear DNA has Telomeres  Prokaryotes circular DNA does not have Telomeres Why not? SCHOOL OF BIOLOGICAL SCIENCES 6 AND APPLIED CHEMISTRY Telomeres  Repeated AGGGTT sequence ~ 2500 x in humans TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG  Telomere length decreases as we age 11 000 bases at birth Fewer than 4000 bases in old age  Shortened Telomere length Hayflick limit Cells stop dividing after 50 – 70 divisions Human diseases like Progeria Dolly the Sheep SCHOOL OF BIOLOGICAL SCIENCES 7 AND APPLIED CHEMISTRY Telomerase  What about all the cell divisions from a Zygote to you? Telomerase  Enzyme replaces lost sequences at the end of Chromosomes Expressed in early Embryos Expressed in Embryonic Stem cells Expressed in Adult Stem cells Expressed in Cancer cells Makes them “Immortal” SCHOOL OF BIOLOGICAL SCIENCES 8 AND APPLIED CHEMISTRY Summary  RNA primer required for DNA Polymerase to initiate replication  Lagging strand synthesis results in the loss of DNA sequences  Leading & Lagging strand synthesis required to make both new DNA strands from the origins of replication  Both newly synthesized DNA strands will have lost DNA at the end  Telomeres are protective repetitive sequences that cap DNA  Telomerase enzyme replaces lost Telomere sequences  Expression in cells allows them to divide indefinitely Embryonic cells, Stem cells & Cancer cells SCHOOL OF BIOLOGICAL SCIENCES 9 AND APPLIED CHEMISTRY