Unraveling the DNA Code
60 Questions
0 Views

Choose a study mode

Play Quiz
Study Flashcards
Spaced Repetition
Chat to Lesson

Podcast

Play an AI-generated podcast conversation about this lesson

Questions and Answers

Which dye is commonly used in real-time PCR as an intercalating dye?

  • Fluorescein
  • FAM
  • Quencher
  • SYBR green (correct)

What happens to the fluorescence level in the hydrolysis probe technique during PCR?

  • It fluctuates
  • It remains constant
  • It decreases
  • It increases (correct)

What is the purpose of using two sequence-specific oligonucleotide probes in detection method 3?

  • To generate fluorescence during PCR
  • To label the DNA double helix
  • To increase the sensitivity of the PCR (correct)
  • To assess the melting point of DNA

What is the purpose of melting curve analysis in real-time PCR?

<p>To assess the specificity of PCR products (A)</p> Signup and view all the answers

Which method can be used to separate DNA from RNA and protein based on differences in buoyant density?

<p>Centrifugation with cesium chloride (A)</p> Signup and view all the answers

What is the purpose of cell lysis in the isolation of nucleic acids?

<p>To release the inner contents of the cells (B)</p> Signup and view all the answers

Which of the following methods is commonly used for DNA amplification?

<p>Polymerase chain reaction (PCR) (A)</p> Signup and view all the answers

What is the function of plasmids?

<p>To store and transfer genetic information (A)</p> Signup and view all the answers

Which of the following is a key application of PCR in forensic science?

<p>Amplifying and sequencing small amounts of DNA (C)</p> Signup and view all the answers

What is the purpose of annealing in a PCR cycle?

<p>To allow primers to bind to the DNA strands (C)</p> Signup and view all the answers

What is the typical length of PCR primers?

<p>15-30 nucleotides (D)</p> Signup and view all the answers

What is the purpose of real-time PCR?

<p>To track the progress of a PCR reaction (C)</p> Signup and view all the answers

Who coined the term 'plasmid' and what did he win the Nobel Prize for?

<p>Joshua Lederberg, for discovering bacterial conjugation (B)</p> Signup and view all the answers

What is the main characteristic of plasmids?

<p>They are small DNA molecules that can replicate independently (C)</p> Signup and view all the answers

What is the normal number of copies of plasmid found in a single cell called?

<p>Copy number (A)</p> Signup and view all the answers

What is the purpose of using phenol and chloroform in DNA/RNA purification?

<p>To separate proteins from nucleic acids (B)</p> Signup and view all the answers

Which enzyme is added to the pyrosequencing reaction mixture to catalyze the incorporation of nucleotides?

<p>DNA polymerase (A)</p> Signup and view all the answers

What is the limitation of pyrosequencing when it comes to detecting homopolymeric regions?

<p>Homopolymeric regions longer than 10 bases cannot be resolved (C)</p> Signup and view all the answers

Which enzyme catalyzes the reaction of pyrophosphate (PPi) with adenosine 5’ phosphosulfate (APS) in pyrosequencing?

<p>ATP sulfurylase (B)</p> Signup and view all the answers

What triggers the release of visible light in pyrosequencing?

<p>ATP (C)</p> Signup and view all the answers

Which enzyme does the virus use to produce DNA from its RNA genome?

<p>Reverse transcriptase (A)</p> Signup and view all the answers

What is the purpose of the Ct value in real-time PCR?

<p>To detect a real signal above background fluorescence (C)</p> Signup and view all the answers

What is the formula to calculate fold changes in gene expression using qRT-PCR?

<p>Fold change = 2-Δ(ΔCt) (C)</p> Signup and view all the answers

What is the disadvantage of qPCR?

<p>Long turnaround time (D)</p> Signup and view all the answers

Which of the following is a step in RNA-seq library construction?

<p>Fragmentation of RNA using random hexamers (A)</p> Signup and view all the answers

What is the purpose of using oligo(dT) beads in RNA-seq library construction?

<p>To select specifically for mRNAs (B)</p> Signup and view all the answers

Which enzyme is used to degrade only the RNA in RNA:DNA hybrids during second strand synthesis in RNA-seq library construction?

<p>Ribonuclease H (RNase H) (B)</p> Signup and view all the answers

What is the purpose of using random hexamers instead of oligo(dT) primers for first strand synthesis in RNA-seq library construction?

<p>To reduce 3' end bias in the sequencing library (B)</p> Signup and view all the answers

What is the purpose of phosphorylating the dsDNAs at their 5' ends in RNA-seq library construction?

<p>To prepare the dsDNAs for adapter ligation (D)</p> Signup and view all the answers

What is the sequence of the Y-shaped adapters used in Illumina library construction?

<p>5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3' |||||||||||| 3' CACTGACCTCAAGTCTGCACACGAGAAGGCTAG 5' (C)</p> Signup and view all the answers

Which detection method in real-time PCR uses two sequence-specific oligonucleotide probes labeled with different dyes?

<p>Detection Method 3 (D)</p> Signup and view all the answers

What is the purpose of melting curve analysis in real-time PCR?

<p>To assess the dissociation characteristics of double-stranded DNA during heating (D)</p> Signup and view all the answers

Which enzyme is responsible for reverse transcription in the synthesis of cDNA using single-stranded RNA as a template?

<p>Reverse transcriptase (B)</p> Signup and view all the answers

What is the genetic material used by retroviruses?

<p>RNA (B)</p> Signup and view all the answers

Which scientist coined the term 'plasmid' and won the Nobel Prize for discovering bacterial conjugation?

<p>Joshua Lederberg (A)</p> Signup and view all the answers

What is the main characteristic of plasmids?

<p>They are small DNA molecules within a cell that can replicate independently. (D)</p> Signup and view all the answers

What is the purpose of using phenol and chloroform in DNA/RNA purification?

<p>To separate proteins from nucleic acids. (D)</p> Signup and view all the answers

What is the purpose of real-time PCR?

<p>To detect the presence or absence of specific DNA sequences in a sample. (C)</p> Signup and view all the answers

Which of the following is a key application of PCR in forensic science?

<p>Amplifying and sequencing small amounts of DNA (B)</p> Signup and view all the answers

What is the purpose of the Ct value in real-time PCR?

<p>To measure the starting amount of target DNA (C)</p> Signup and view all the answers

What is the limitation of pyrosequencing when it comes to detecting homopolymeric regions?

<p>It cannot accurately determine the sequence of homopolymeric regions (B)</p> Signup and view all the answers

What is the purpose of melting curve analysis in real-time PCR?

<p>To identify the presence of nonspecific amplification (C)</p> Signup and view all the answers

Which enzyme is responsible for catalyzing the reaction of ATP with the substrate luciferin in pyrosequencing?

<p>Luciferase (B)</p> Signup and view all the answers

What is the limitation of pyrosequencing when it comes to detecting homopolymeric regions?

<p>Homopolymeric regions longer than 10 bases cannot be resolved (D)</p> Signup and view all the answers

What triggers the release of pyrophosphate (PPi) in pyrosequencing?

<p>Incorporation of nucleotide by DNA polymerase (A)</p> Signup and view all the answers

Which enzyme is used to degrade excess nucleotide dNTP and ATP in the pyrosequencing reaction mixture?

<p>Apyrase (D)</p> Signup and view all the answers

Which of the following is true about Ct values in real-time PCR?

<p>Ct values are inversely proportional to the amount of targeted nucleic acid (C)</p> Signup and view all the answers

What is the purpose of a standard curve in absolute quantification of gene expression?

<p>To compare the results from actual experiments with known amounts of target DNA (A)</p> Signup and view all the answers

What is the main advantage of relative quantification over absolute quantification in measuring gene expression?

<p>Relative quantification allows for comparison of gene expression levels across different experiments (B)</p> Signup and view all the answers

What is the formula to calculate fold changes in gene expression using qRT-PCR?

<p>Fold change = 2^(-ΔΔCt) (D)</p> Signup and view all the answers

Which of the following is NOT a method used for cell lysis in the isolation of nucleic acids?

<p>Treatment with a hypertonic solution (A)</p> Signup and view all the answers

Which of the following correctly describes the separation of DNA, RNA, and protein by centrifugation in cesium chloride (CsCl) gradient?

<p>RNA sinks to the bottom, proteins float on the top, and DNA is concentrated close to the middle (B)</p> Signup and view all the answers

What is the purpose of centrifuging the CsCl gradient at very high speeds in the separation of DNA, RNA, and protein?

<p>To form a stable gradient of CsCl (C)</p> Signup and view all the answers

What are plasmids?

<p>Small circular DNA molecules found in the cytoplasm of prokaryotic cells (B)</p> Signup and view all the answers

Which step is performed at 16°C during RNA-seq library construction?

<p>Second strand synthesis (A)</p> Signup and view all the answers

Which molecule is specifically degraded by Ribonuclease H during second strand synthesis in RNA-seq library construction?

<p>rRNA (C)</p> Signup and view all the answers

What is the purpose of adding an 'A' base to the 3' ends of dsDNAs in RNA-seq library construction?

<p>To facilitate adapter ligation (D)</p> Signup and view all the answers

What is the purpose of using random hexamers instead of oligo(dT) primers for first strand synthesis in RNA-seq library construction?

<p>To reduce 3' end bias in the sequencing library (B)</p> Signup and view all the answers

Which molecule is often removed from the total RNA pool before proceeding with library construction in RNA-seq?

<p>rRNA (D)</p> Signup and view all the answers

What is the purpose of selecting specifically for mRNAs using oligo(dT) beads in RNA-seq library construction?

<p>To selectively amplify mRNAs (B)</p> Signup and view all the answers

More Like This

Unraveling the DNA Packaging Mystery
12 questions
Unraveling the DNA Mystery
10 questions
Use Quizgecko on...
Browser
Browser