60 Questions
Which dye is commonly used in real-time PCR as an intercalating dye?
SYBR green
What happens to the fluorescence level in the hydrolysis probe technique during PCR?
It increases
What is the purpose of using two sequence-specific oligonucleotide probes in detection method 3?
To increase the sensitivity of the PCR
What is the purpose of melting curve analysis in real-time PCR?
To assess the specificity of PCR products
Which method can be used to separate DNA from RNA and protein based on differences in buoyant density?
Centrifugation with cesium chloride
What is the purpose of cell lysis in the isolation of nucleic acids?
To release the inner contents of the cells
Which of the following methods is commonly used for DNA amplification?
Polymerase chain reaction (PCR)
What is the function of plasmids?
To store and transfer genetic information
Which of the following is a key application of PCR in forensic science?
Amplifying and sequencing small amounts of DNA
What is the purpose of annealing in a PCR cycle?
To allow primers to bind to the DNA strands
What is the typical length of PCR primers?
15-30 nucleotides
What is the purpose of real-time PCR?
To track the progress of a PCR reaction
Who coined the term 'plasmid' and what did he win the Nobel Prize for?
Joshua Lederberg, for discovering bacterial conjugation
What is the main characteristic of plasmids?
They are small DNA molecules that can replicate independently
What is the normal number of copies of plasmid found in a single cell called?
Copy number
What is the purpose of using phenol and chloroform in DNA/RNA purification?
To separate proteins from nucleic acids
Which enzyme is added to the pyrosequencing reaction mixture to catalyze the incorporation of nucleotides?
DNA polymerase
What is the limitation of pyrosequencing when it comes to detecting homopolymeric regions?
Homopolymeric regions longer than 10 bases cannot be resolved
Which enzyme catalyzes the reaction of pyrophosphate (PPi) with adenosine 5’ phosphosulfate (APS) in pyrosequencing?
ATP sulfurylase
What triggers the release of visible light in pyrosequencing?
ATP
Which enzyme does the virus use to produce DNA from its RNA genome?
Reverse transcriptase
What is the purpose of the Ct value in real-time PCR?
To detect a real signal above background fluorescence
What is the formula to calculate fold changes in gene expression using qRT-PCR?
Fold change = 2-Δ(ΔCt)
What is the disadvantage of qPCR?
Long turnaround time
Which of the following is a step in RNA-seq library construction?
Fragmentation of RNA using random hexamers
What is the purpose of using oligo(dT) beads in RNA-seq library construction?
To select specifically for mRNAs
Which enzyme is used to degrade only the RNA in RNA:DNA hybrids during second strand synthesis in RNA-seq library construction?
Ribonuclease H (RNase H)
What is the purpose of using random hexamers instead of oligo(dT) primers for first strand synthesis in RNA-seq library construction?
To reduce 3' end bias in the sequencing library
What is the purpose of phosphorylating the dsDNAs at their 5' ends in RNA-seq library construction?
To prepare the dsDNAs for adapter ligation
What is the sequence of the Y-shaped adapters used in Illumina library construction?
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3' |||||||||||| 3' CACTGACCTCAAGTCTGCACACGAGAAGGCTAG 5'
Which detection method in real-time PCR uses two sequence-specific oligonucleotide probes labeled with different dyes?
Detection Method 3
What is the purpose of melting curve analysis in real-time PCR?
To assess the dissociation characteristics of double-stranded DNA during heating
Which enzyme is responsible for reverse transcription in the synthesis of cDNA using single-stranded RNA as a template?
Reverse transcriptase
What is the genetic material used by retroviruses?
RNA
Which scientist coined the term 'plasmid' and won the Nobel Prize for discovering bacterial conjugation?
Joshua Lederberg
What is the main characteristic of plasmids?
They are small DNA molecules within a cell that can replicate independently.
What is the purpose of using phenol and chloroform in DNA/RNA purification?
To separate proteins from nucleic acids.
What is the purpose of real-time PCR?
To detect the presence or absence of specific DNA sequences in a sample.
Which of the following is a key application of PCR in forensic science?
Amplifying and sequencing small amounts of DNA
What is the purpose of the Ct value in real-time PCR?
To measure the starting amount of target DNA
What is the limitation of pyrosequencing when it comes to detecting homopolymeric regions?
It cannot accurately determine the sequence of homopolymeric regions
What is the purpose of melting curve analysis in real-time PCR?
To identify the presence of nonspecific amplification
Which enzyme is responsible for catalyzing the reaction of ATP with the substrate luciferin in pyrosequencing?
Luciferase
What is the limitation of pyrosequencing when it comes to detecting homopolymeric regions?
Homopolymeric regions longer than 10 bases cannot be resolved
What triggers the release of pyrophosphate (PPi) in pyrosequencing?
Incorporation of nucleotide by DNA polymerase
Which enzyme is used to degrade excess nucleotide dNTP and ATP in the pyrosequencing reaction mixture?
Apyrase
Which of the following is true about Ct values in real-time PCR?
Ct values are inversely proportional to the amount of targeted nucleic acid
What is the purpose of a standard curve in absolute quantification of gene expression?
To compare the results from actual experiments with known amounts of target DNA
What is the main advantage of relative quantification over absolute quantification in measuring gene expression?
Relative quantification allows for comparison of gene expression levels across different experiments
What is the formula to calculate fold changes in gene expression using qRT-PCR?
Fold change = 2^(-ΔΔCt)
Which of the following is NOT a method used for cell lysis in the isolation of nucleic acids?
Treatment with a hypertonic solution
Which of the following correctly describes the separation of DNA, RNA, and protein by centrifugation in cesium chloride (CsCl) gradient?
RNA sinks to the bottom, proteins float on the top, and DNA is concentrated close to the middle
What is the purpose of centrifuging the CsCl gradient at very high speeds in the separation of DNA, RNA, and protein?
To form a stable gradient of CsCl
What are plasmids?
Small circular DNA molecules found in the cytoplasm of prokaryotic cells
Which step is performed at 16°C during RNA-seq library construction?
Second strand synthesis
Which molecule is specifically degraded by Ribonuclease H during second strand synthesis in RNA-seq library construction?
rRNA
What is the purpose of adding an 'A' base to the 3' ends of dsDNAs in RNA-seq library construction?
To facilitate adapter ligation
What is the purpose of using random hexamers instead of oligo(dT) primers for first strand synthesis in RNA-seq library construction?
To reduce 3' end bias in the sequencing library
Which molecule is often removed from the total RNA pool before proceeding with library construction in RNA-seq?
rRNA
What is the purpose of selecting specifically for mRNAs using oligo(dT) beads in RNA-seq library construction?
To selectively amplify mRNAs
Test your knowledge of DNA sequencing methods with this quiz! Learn about Maxam-Gilbert sequencing, Sanger sequencing, and Pyrosequencing. Discover how these techniques differ and how they contribute to DNA analysis.
Make Your Own Quizzes and Flashcards
Convert your notes into interactive study material.
Get started for free
