12: Strerols

MicroRNA Regulation

• There are four approaches to microRNA regulation
• The basic approach involves single microRNA-mRNA interactions
• Broad effects are seen when one microRNA regulates many mRNAs
• The functional approach can also be used to describe microRNA regulation
• A pathway-based approach can be used to control regulation

MicroRNAs and Cell Metabolism

• Cellular lipids and cholesterol levels are regulated by the sterol pathway
• The sterol pathway involves sterol binding proteins and sterol response element binding proteins (SREBPs)
• SREBP1 regulates lipid biosynthesis/metabolism
• SREBP2 regulates cholesterol/sterol biosynthesis
• SREBPs are also regulated by upstream regulators
• Cellular lipids and cholesterol levels are also regulated by nuclear hormone receptors called PPARs

MicroRNAs and Lipid Metabolism

• MicroRNAs are regulators of lipid and cholesterol pathways
• MicroRNA-27 is an example of a microRNA
• MiR-27 can abrogate the expression of essential proteins involved in adipogenesis
• In doing so miR-27 can cause an associated inhibition of adipogenic differentiation
• MiR-27 regulates TG (triglyceride) and cholesterol levels
• Both miR-27a and miR-27b negatively regulate LPL expression
• LPL is the rate-limiting enzyme that is involved in the hydrolysis of TG in circulating VLDL and chylomicrons
• MiR-27a and miR-27b can act independently
• MiR-27b represses mRNAs coding for proteins involved in lipid metabolism, including SREBP-1c

MiR-27 and Lipid Metabolism

• hsa-miR-27a has the nucleotide sequence uucacaguggcuaaguuccgc
• hsa-miR-27b has the nucleotide sequence uucacaguggcuaaguucugc
• MiR-27 regulates lipid metabolism in adipocytes and macrophages
• MiR-27 function is misregulated in metabolic disorders like Atherosclerosis/Dyslipidemia
• MiR-27 function is misregulated in metabolic disorders like Non-alcoholic fatty disease/steatosis
• There are two isoforms of miR-27 that occur, differing by one nucleotide

Viruses and Metabolism

• Viruses are obligate parasites
• Viruses dont have independent metabolism
• Viruses lack the organelles needed for metabolism, like ribosomes and mitochondria.
• Because of this, viruses can't grow without entering a host

Hepatitis C Virus (HCV)

• Hepatitis C virus (HCV) alters hepatic lipid homeostasis

How HCV Alters Lipid Metabolism

• HCV infection induces changes in lipid metabolism and SREBP pathway
• HCV depends on the SREBP pathway and lipidation of host protein FBL-2
• HCV depends on de novo fatty acid biosynthesis
• FAS catalyzes de novo synthesis of fatty acids
• FAS is not required for normal liver function in adults, however, it appears to be required for HCV replication
• FASN activity is induced by HCV
• HCV induces miR-27 expression in vitro

HCV Model Systems

• Sub-genomic replicon (SGR) is one model system used to model HCV
• JFH-1 and JFH-1T infectious models are also types of HCV models used during study

The Role of MiR-27 in HCV

• MiR-27 overexpression induces TG accumulation
• HCV-induced miR-27 expression is a novel mechanism of steatosis
• PPAR-α agonism can reverse miR-27 mediated TG accumulation
• MiR-27 overexpression inhibits HCV replication
• HCV activates miR-27a/b expression both in vitro (SGR; JFH-1T) and in vivo (SCID-Alb/uPa)
• Core and NS4B activate miR-27 expression in a PI3K-dependent manner
• MiR-27 overexpression promotes lipid accumulation (larger LDs)
• MiR-27 overexpression inhibits HCV replication, but only in Gt-1b

MiR-27b and Hepatic Lipase C (LIPC)

• MiR-27b regulates lipid regulatory pathways in the human liver and is also induced by the hepatitis C virus (HCV)
• The functional targets of miR-27b have been shown to be not well established
• An activity-based protein profiling method using a serine hydrolase probe, coupled with stable isotope labeling and mass spectrometry, can identifies direct and indirect targets of miR-27b
• Hepatic lipase C (LIPC) stood out as both highly dependent on miR-27b and as a major modulator of lipid pathway misregulation
• Modulation of miR-27b using both exogenous miRNA mimics and inhibitors showed that transcription factors Jun, PPARα, and HNF4α, all of which also influence LIPC levels and activity, are regulated by miR-27b
• LIPC has been shown to affect the progress of the life cycle of HCV and to decrease levels of intracellular triglycerides, upon which HCV is known to depend
• Research demonstrates that miR-27b mediates HCV infection by downregulating LIPC, thereby reducing triglyceride degradation, which in turn increases cellular lipid levels

MicroRNAs and Immunometabolism

• MicroRNA-185 is an immunometabolic regulator
• MicroRNA-185 inhibits the expression of metabolic genes and blocking virus-induced pathways needed for replication
• It was found to be a novel mediator of the innate immune response to viral infection in the liver through regulation of metabolism
• Antiviral targets are druggable targets that are antiviral