Molecular Biology Concepts

Choose a study mode

Play Quiz
Study Flashcards
Spaced Repetition
Chat to Lesson

Podcast

Play an AI-generated podcast conversation about this lesson
Download our mobile app to listen on the go
Get App

Questions and Answers

Scientist responsible for the law of inheritance in the early 1900s.

  • Hershey
  • Franklin
  • Mendel (correct)
  • Watson

Scientist used the streptococcus pneumonia to prove that DNA is the genetic material.

  • Franklin
  • Watson
  • Griffith (correct)
  • Mendel

The strain that carries the killing character in Griffith experiment is

  • K strain
  • O strain
  • S strain (correct)
  • R strain

The strain that doesn't carry the killing character in Griffith experiment is

<p>R strain (B)</p>
Signup and view all the answers

A mixture of heat-killed S strain and live R strain:

<p>Mouse dies (C)</p>
Signup and view all the answers

The scientist that identified the molecule that transformed the R strain into S Strain is

<p>Avery (B)</p>
Signup and view all the answers

Hershey and chase used Radioactive Phosphorus to label the :

<p>DNA (A)</p>
Signup and view all the answers

Hershey and chase used Radioactive Sulphur to label the :

<p>Protein (B)</p>
Signup and view all the answers

Bacteria separated from the liquid containing viruses is an indication of _____ Element in the mixture:

<p>phosphorus</p>
Signup and view all the answers

Scientist that explained the DNA structure as a double helix is:

<p>Watson and Crick (A)</p>
Signup and view all the answers

Scientist that explained the DNA structure as a Twisted ladder is:

<p>Watson and Crick (C)</p>
Signup and view all the answers

A nitrogenous base that cannot be found in DNA molecules is:

<p>U (C)</p>
Signup and view all the answers

Nitrogenous bases that are considered Pyrimidines are (Choose 2 answers)

<p>C (A), T (B)</p>
Signup and view all the answers

Scientist that discovered the structure of nucleotide is :

<p>Leven (A)</p>
Signup and view all the answers

All of the following are components of the DNA nucleotide except:

<p>Ribose sugar (A)</p>
Signup and view all the answers

Adenine form ...... bonds with Thymine

<p>2 hydrogen (C)</p>
Signup and view all the answers

Cytosine form ......... bonds with Guanine

<p>3 hydrogen (A)</p>
Signup and view all the answers

_____ DNA enzyme is responsible for DNA unwinding.

<p>Helicase</p>
Signup and view all the answers

_____ DNA enzyme is responsible for DNA Base Pairing.

<p>Polymerase</p>
Signup and view all the answers

_____ enzyme is responsible of adding a short piece of RNA to each DNA strand

<p>RNA Primase</p>
Signup and view all the answers

_____ Enzyme is responsible for joining fragments of new formed strand.

<p>Ligase</p>
Signup and view all the answers

Long Strands of RNA nucleotides that direct ribosomes to make proteins.

<p>mRNA (A)</p>
Signup and view all the answers

Molecules make up part of the ribosomes of the cell in the cytoplasm.

<p>rRNA (C)</p>
Signup and view all the answers

Molecules transport amino acids from the cytoplasm to the ribosomes.

<p>tRNA (B)</p>
Signup and view all the answers

_____ Enzyme makes mRNA in the 5' to 3' direction.

<p>RNA Polymerase</p>
Signup and view all the answers

Sequences that interrupt the DNA code:

<p>Introns (B)</p>
Signup and view all the answers

The Sequences that remain in the mRNA molecule are called:

<p>Exons (A)</p>
Signup and view all the answers

An Operon Consists of all the following except:

<p>Primer (C)</p>
Signup and view all the answers

When Tryptophan levels are low _______ Enzyme binds to the operator.

<p>RNA Primase</p>
Signup and view all the answers

Flashcards

Who is Mendel?

Mendel established the basic laws of inheritance in the early 1900s through experiments with pea plants.

What is the S strain?

The 'S' strain possesses a capsule and kills the mice. It has a smooth appearance.

What is the R strain?

The 'R' strain lacks a capsule that does not kill the mice. Has a rough appearance.

Who is Avery?

Avery identified DNA as the molecule responsible for transformation in Griffith's experiment.

Signup and view all the flashcards

Radioactive Phosphorus labels?

Hershey and Chase used radioactive phosphorus to label DNA to track it during viral infection.

Signup and view all the flashcards

Radioactive Sulfur labels?

Hershey and Chase used radioactive sulfur to label protein to track it during viral infection.

Signup and view all the flashcards

Who are Watson and Crick?

Watson and Crick are credited with explaining the double helix structure of DNA.

Signup and view all the flashcards

Uracil is in RNA or DNA?

Uracil is found in RNA but not in DNA, where thymine is used instead.

Signup and view all the flashcards

A binds to T with how may H bonds?

Adenine forms two hydrogen bonds with Thymine (A=T) in DNA.

Signup and view all the flashcards

What is Helicase?

Helicase is responsible for unwinding the DNA double helix.

Signup and view all the flashcards

Study Notes

Laws of Inheritance

  • Mendel is responsible for the laws of inheritance

Genetic Material

  • Griffith used Streptococcus pneumoniae to prove that DNA is the genetic material

Griffith's Experiment

  • The S strain carries the killing character in Griffith's experiment
  • The R strain does not carry the killing character in Griffith's experiment
  • A mixture of heat-killed S strain and live R strain results in the death of the mouse
  • Avery identified the molecule that transformed the R strain into S strain

Hershey and Chase Experiment

  • Hershey and Chase used radioactive phosphorus to label DNA
  • Hershey and Chase used radioactive sulfur to label protein
  • Bacteria separated from the liquid containing viruses is an indication of phosphorus element in the mixture

DNA Structure

  • Watson and Crick explained the DNA structure as a double helix and twisted ladder

Nitrogenous Bases

  • Uracil (U) is a nitrogenous base that cannot be found in DNA molecules
  • Cytosine (C) and Thymine (T) are pyrimidines

Nucleotide Structure

  • Levene discovered the structure of a nucleotide
  • Ribose sugar is not a component of a DNA nucleotide
  • Deoxyribose sugar is not a component of an RNA nucleotide

Base Pairing

  • Adenine forms 2 hydrogen bonds with Thymine
  • Cytosine forms 3 hydrogen bonds with Guanine

DNA Replication

  • Helicase is the DNA enzyme responsible for DNA unwinding
  • Polymerase is the DNA enzyme responsible for DNA base pairing
  • RNA primase is responsible for adding a short piece of RNA to each DNA strand
  • Ligase is the enzyme responsible for joining fragments of a newly formed strand

RNA Types

  • mRNA refers to long strands of RNA nucleotides that direct ribosomes to make proteins
  • rRNA molecules make up part of the ribosomes of the cell in the cytoplasm
  • tRNA molecules transport amino acids from the cytoplasm to the ribosomes

mRNA Synthesis

  • RNA Polymerase is the enzyme that makes mRNA in the 5' to 3' direction

DNA Code

  • Introns are sequences that interrupt the DNA code
  • Exons are the sequences that remain in the mRNA molecule

Operons

  • A primer is not a component of an operon
  • Under Low tryptophan levels, a regulatory gene binds to the operator

DNA Polymerase & RNA Polymerase

  • A comparison of the Location & Function of DNA polymerase & RNA Polymerase is required

Transcription & Translation

  • A comparison of the Definition & Names of enzymes involved in Transcription & Translation is required

Trp Operon & Lac Operon

  • A comparison of the Regulation Process of Trp Operon & Lac Operon is required

RNA Primer & RNAi

  • A comparison of the Functions of RNA Primer & RNAi is required

Helicase enzyme & Ligase

  • A comparison of the Functions of Helicase enzyme & Ligase is required

Missense mutation & Nonsense mutation

  • A comparison of the Definition & Example of Missense mutation & Nonsense mutation is required

Muscle Dystrophy

  • An explanation is required as to how Muscle Dystrophy is a disease caused by mutation

Tryptophan Regulation

  • An explanation is required as to why Tryptophan Regulation in Escherichia Coli is an example of Prokaryote gene regulation

HOX Genes

  • A description of how HOX genes regulate development in animals is required

Translation

  • Using the diagram, translate the following sequences: AUGGCGGAAGAAAACCACUGA

mRNA

  • The function of mRNA in the translation process is required

Translation and Transcription

  • Mention the location of translation & transcription processes in the cell

Lac Operon

  • Explanation of Lac Operon as an example of Gene regulation in E.coli is required

DNA Strand

  • For the DNA strand ATGCTATAACAGCATTTA, mention the mRNA formed from this DNA strand, the tRNA formed, and the complementary strand formed

Definitions

  • The following must be defined: RNA interference, Mutation, Point Mutation, and Mutagens

Frameshift mutations

  • Whether Cystic fibrosis and Crohn's disease are both caused by frameshift mutations needs to be determined

Studying That Suits You

Use AI to generate personalized quizzes and flashcards to suit your learning preferences.

Quiz Team

Related Documents

Use Quizgecko on...
Browser
Browser