Molecular Biology Concepts

Laws of Inheritance

• Mendel is responsible for the laws of inheritance

Genetic Material

• Griffith used Streptococcus pneumoniae to prove that DNA is the genetic material

Griffith's Experiment

• The S strain carries the killing character in Griffith's experiment
• The R strain does not carry the killing character in Griffith's experiment
• A mixture of heat-killed S strain and live R strain results in the death of the mouse
• Avery identified the molecule that transformed the R strain into S strain

Hershey and Chase Experiment

• Hershey and Chase used radioactive phosphorus to label DNA
• Hershey and Chase used radioactive sulfur to label protein
• Bacteria separated from the liquid containing viruses is an indication of phosphorus element in the mixture

DNA Structure

• Watson and Crick explained the DNA structure as a double helix and twisted ladder

Nitrogenous Bases

• Uracil (U) is a nitrogenous base that cannot be found in DNA molecules
• Cytosine (C) and Thymine (T) are pyrimidines

Nucleotide Structure

• Levene discovered the structure of a nucleotide
• Ribose sugar is not a component of a DNA nucleotide
• Deoxyribose sugar is not a component of an RNA nucleotide

Base Pairing

• Adenine forms 2 hydrogen bonds with Thymine
• Cytosine forms 3 hydrogen bonds with Guanine

DNA Replication

• Helicase is the DNA enzyme responsible for DNA unwinding
• Polymerase is the DNA enzyme responsible for DNA base pairing
• RNA primase is responsible for adding a short piece of RNA to each DNA strand
• Ligase is the enzyme responsible for joining fragments of a newly formed strand

RNA Types

• mRNA refers to long strands of RNA nucleotides that direct ribosomes to make proteins
• rRNA molecules make up part of the ribosomes of the cell in the cytoplasm
• tRNA molecules transport amino acids from the cytoplasm to the ribosomes

mRNA Synthesis

• RNA Polymerase is the enzyme that makes mRNA in the 5' to 3' direction

DNA Code

• Introns are sequences that interrupt the DNA code
• Exons are the sequences that remain in the mRNA molecule

Operons

• A primer is not a component of an operon
• Under Low tryptophan levels, a regulatory gene binds to the operator

DNA Polymerase & RNA Polymerase

• A comparison of the Location & Function of DNA polymerase & RNA Polymerase is required

Transcription & Translation

• A comparison of the Definition & Names of enzymes involved in Transcription & Translation is required

Trp Operon & Lac Operon

• A comparison of the Regulation Process of Trp Operon & Lac Operon is required

RNA Primer & RNAi

• A comparison of the Functions of RNA Primer & RNAi is required

Helicase enzyme & Ligase

• A comparison of the Functions of Helicase enzyme & Ligase is required

Missense mutation & Nonsense mutation

• A comparison of the Definition & Example of Missense mutation & Nonsense mutation is required

Muscle Dystrophy

• An explanation is required as to how Muscle Dystrophy is a disease caused by mutation

Tryptophan Regulation

• An explanation is required as to why Tryptophan Regulation in Escherichia Coli is an example of Prokaryote gene regulation

HOX Genes

• A description of how HOX genes regulate development in animals is required

Translation

• Using the diagram, translate the following sequences: AUGGCGGAAGAAAACCACUGA

mRNA

• The function of mRNA in the translation process is required

Translation and Transcription

• Mention the location of translation & transcription processes in the cell

Lac Operon

• Explanation of Lac Operon as an example of Gene regulation in E.coli is required

DNA Strand

• For the DNA strand ATGCTATAACAGCATTTA, mention the mRNA formed from this DNA strand, the tRNA formed, and the complementary strand formed

Definitions

• The following must be defined: RNA interference, Mutation, Point Mutation, and Mutagens

Frameshift mutations

• Whether Cystic fibrosis and Crohn's disease are both caused by frameshift mutations needs to be determined