Genetics: Transcription and Translation Quiz

Questions and Answers

What is the mRNA sequence for the gene portion ACGAGACCTCTTATACTTAAACATAAA?

UGCUCUGGAGAAUAUGAAUUUGUAUUU (correct)

ACGAGACCUCUUAUACUUAAACAUAAA

UGCUCUGGAGAAUGUGAAUUUGUAUUU

None of the above

What is the polypeptide chain for the gene portion ACGAGACCTCTTATACTTAAACATAAA?

UGCUCUGGAGAAUAUGAAUUUGUAUUU

ACGAGACCUCUUAUACUUAAACAUAAA (correct)

UGCUCUGGAGAAUGUGAAUUUGUAUUU

None of the above

What is the outcome of a gene that is mutated but codons code for the same amino acids?

silent mutation

How can a single point mutation in DNA lead to early termination during translation?

By adding a stop codon, through addition or substitution. Signup and view all the answers

What is a consequence of a single nucleotide addition to DNA?

frameshift mutation Signup and view all the answers

Which types of RNA are involved in transcription and translation, and what are their roles?

All of the above Signup and view all the answers

What is the function of RNA polymerase?

It brings RNA nucleotides to a DNA strand to create a complementary RNA strand. Signup and view all the answers

What is gene expression?

The process by which DNA directs protein synthesis, including transcription and translation. Signup and view all the answers

What is transcription?

The synthesis of RNA using information in the DNA. Signup and view all the answers

What is translation?

The synthesis of a polypeptide using information in the mRNA. Signup and view all the answers

What is central dogma?

The concept that cells are governed by a cellular chain of command: DNA -> RNA -> protein. Signup and view all the answers

What are introns?

Noncoding regions of mRNA. Signup and view all the answers

What are axons?

Expressed regions that are typically translated into amino acid sequences. Signup and view all the answers

What are mutations?

Changes in the genetic material of a cell or virus. Signup and view all the answers

What are point mutations?

Chemical changes in just one base pair of a gene. Signup and view all the answers

What is nucleotide pair substitution?

Replaces one nucleotide and its partner with another pair of nucleotides. Signup and view all the answers

What are silent mutations?

Mutations that have no effect on the amino acid produced by a codon. Signup and view all the answers

What are missense mutations?

Mutations that still code for an amino acid, but not the correct one. Signup and view all the answers

What are nonsense mutations?

Mutations that change an amino acid codon into a stop codon. Signup and view all the answers

What are insertions/deletions?

Additions or losses of nucleotide pairs in a gene. Signup and view all the answers

What is a frameshift mutation?

Occurs when the reading frame is altered, affecting the gene's coding. Signup and view all the answers

Which types of mutations result in abnormal amino acid sequences?

All of the above Signup and view all the answers

Which type of mutation stops the translation of the mRNA?

Both A and B Signup and view all the answers

What is the most likely type of mutation if it has no effect on the protein coded by a gene?

Point mutation Signup and view all the answers

Name one amino acid that has more than one codon and one that has only one codon.

ALA has multiple codons (GCA, GCT, GCC, GCG), MET has one codon (AUG). Signup and view all the answers

What type of mutation occurs when the first 'H' is deleted from 'THE FAT CAT ATE THE RAT'?

frameshift mutation Signup and view all the answers

Which type of mutation is responsible for new variations (alleles) of a trait?

All mutations except silent mutations Signup and view all the answers

If a frameshift mutation occurs at the 85th base in a 105-nucleotide long protein coding sequence, how many amino acids will be correct?

28 correct amino acids Signup and view all the answers

Study Notes

Gene Transcription and Translation

Transcription creates mRNA from DNA; example sequences include ACGAGACCTCTTATACTTAAACATAAA (mRNA: UGCUCUGGAGAAUAUGAAUUUGUAUUU) and ACGAGACCTCTTACACTTAAACATAAA (mRNA: UGCUCUGGAGAAUGUGAAUUUGUAUUU).
Polypeptide chains translate mRNA sequences into proteins; for example, the aforementioned mRNA sequences correspond to specific polypeptides.

Types of Mutations

Silent mutations occur when a gene is mutated but still codes for the same amino acid; e.g., UAU and UAC both code for Tyrosine.
Point mutations involve a single base pair change; they can result in various outcomes, such as silent, missense, or nonsense mutations.
Missense mutations produce a different amino acid, potentially altering protein function.
Nonsense mutations convert a codon into a stop codon, leading to truncated proteins.

Additional Mutation Dynamics

Inserting or deleting nucleotides can lead to frameshift mutations, altering the reading frame of the genetic code, affecting all subsequent codons.
Frameshift mutations result in abnormal amino acid sequences and may terminate translation prematurely.

Functions of RNA

Messenger RNA (mRNA) is transcribed from DNA and serves as a template for protein synthesis in ribosomes.
Transfer RNA (tRNA) brings the correct amino acids to the ribosomes during translation.
Ribosomal RNA (rRNA) comprises the ribosomes, facilitating the assembly of amino acids into polypeptides.

Central Dogma of Molecular Biology

The central dogma describes the flow of genetic information within a biological system: DNA → RNA → Protein.

Role of RNA Polymerase

RNA polymerase synthesizes RNA by unwinding DNA and forming complementary RNA strands by forming phosphodiester bonds.

Introns and Exons

Introns are noncoding sequences within mRNA, while exons are coding sequences that are translated into proteins.

Consequences of Mutations

Mutations can introduce new traits, with all types except silent mutations leading to variations in traits.
The impact of a mutation can be assessed by analyzing amino acid sequences; a single-nucleotide addition generally leads to frameshift mutations.

Genetic Code Adaptations

Amino acids can be coded by multiple codons; for example, ALA can be coded by GCA, GCT, GCC, and GCG, while MET is solely coded by AUG.

Practical Analysis

Understanding how mutations change amino acid sequences aids geneticists in studying hereditary traits and protein functionality.
Frameshift mutations disturb the normal sequence of a sentence, analogous to how they disrupt protein synthesis.

Studying That Suits You

Use AI to generate personalized quizzes and flashcards to suit your learning preferences.

Description

This quiz focuses on the transcription and translation processes in genetics. Test your understanding of converting DNA sequences into mRNA and then into polypeptide chains. Perfect for biology students looking to reinforce their knowledge of genetic mutations.