Podcast
Questions and Answers
What is the function of DNA in the cell?
What is the function of DNA in the cell?
DNA is a storage system and stores genetic information.
How do purines and pyrimidines differ in structure?
How do purines and pyrimidines differ in structure?
Purines have a double ring; pyrimidines have a single ring.
Write the complementary sequence to the following: 5' AGGTCACGTCTAGCTAGCTAGA 3'.
Write the complementary sequence to the following: 5' AGGTCACGTCTAGCTAGCTAGA 3'.
5' TCTAGCTAGCTAGACGTGACCT 3'.
Which of the ribose carbons participate in the phosphodiester bond?
Which of the ribose carbons participate in the phosphodiester bond?
Which of the ribose carbons carries the nitrogen base?
Which of the ribose carbons carries the nitrogen base?
Why does DNA polymerase require primase activity?
Why does DNA polymerase require primase activity?
What is the covalent bond between nucleotides catalyzed by DNA polymerase?
What is the covalent bond between nucleotides catalyzed by DNA polymerase?
Is DNA replication conservative?
Is DNA replication conservative?
What is the lagging strand in DNA synthesis?
What is the lagging strand in DNA synthesis?
Short pieces of DNA involved in DNA synthesis in replicating cells are called _______ fragments.
Short pieces of DNA involved in DNA synthesis in replicating cells are called _______ fragments.
What is the function of polymerase?
What is the function of polymerase?
What is the function of helicase?
What is the function of helicase?
What is the function of primase?
What is the function of primase?
What is the function of exonuclease?
What is the function of exonuclease?
What is the function of endonuclease?
What is the function of endonuclease?
How does DNA move from cell to cell in (a) conjugation, (b) transduction, and (c) transformation?
How does DNA move from cell to cell in (a) conjugation, (b) transduction, and (c) transformation?
In a mixed culture of bacteria with phenotypes A+ and A-, what type of transfer occurred if A- bacteria became A+?
In a mixed culture of bacteria with phenotypes A+ and A-, what type of transfer occurred if A- bacteria became A+?
What was the rationale for labeling bacteriophage with 35S and 32P in the Hershey and Chase 'blender' experiment?
What was the rationale for labeling bacteriophage with 35S and 32P in the Hershey and Chase 'blender' experiment?
A plasmid that carries genes for its own transfer and propagation is called _________.
A plasmid that carries genes for its own transfer and propagation is called _________.
What enzymes can convert a supercoiled plasmid to a relaxed circle?
What enzymes can convert a supercoiled plasmid to a relaxed circle?
Flashcards
DNA's Function
DNA's Function
DNA stores genetic information.
Purines
Purines
Adenine and Guanine (double ring).
Pyrimidines
Pyrimidines
Cytosine and Thymine (single ring).
Complementary Sequence
Complementary Sequence
Signup and view all the flashcards
5' Ribose Carbon
5' Ribose Carbon
Signup and view all the flashcards
1' Ribose Carbon
1' Ribose Carbon
Signup and view all the flashcards
Primase Requirement
Primase Requirement
Signup and view all the flashcards
Phosphodiester Bond
Phosphodiester Bond
Signup and view all the flashcards
Semi-Conservative Replication
Semi-Conservative Replication
Signup and view all the flashcards
Lagging Strand
Lagging Strand
Signup and view all the flashcards
Leading Strand
Leading Strand
Signup and view all the flashcards
Polymerase
Polymerase
Signup and view all the flashcards
Helicase
Helicase
Signup and view all the flashcards
Primase
Primase
Signup and view all the flashcards
Exonuclease
Exonuclease
Signup and view all the flashcards
Endonuclease
Endonuclease
Signup and view all the flashcards
Conjugation
Conjugation
Signup and view all the flashcards
Transduction
Transduction
Signup and view all the flashcards
Transformation
Transformation
Signup and view all the flashcards
Self-Transmissible Plasmids
Self-Transmissible Plasmids
Signup and view all the flashcards
Study Notes
DNA Function and Structure
- DNA serves as a storage system for genetic information.
- Nitrogen bases differ in structure: purines have a double ring (adenine, guanine), while pyrimidines have a single ring (cytosine, thymine).
- The complementary sequence for 5' AGGTCACGTCTAGCTAGCTAGA 3' is 5' TCTAGCTAGCTAGACGTGACCT 3'.
Ribose Carbons and Bonding
- The 5' ribose carbon carries the phosphate group that forms a phosphodiester bond with the hydroxyl group of the 3' ribose carbon.
- The 1' carbon of the ribose is responsible for carrying the nitrogen base.
- DNA polymerase requires primase activity to provide a 3' OH group necessary for synthesis.
DNA Replication
- The covalent bond formed between nucleotides during replication is a phosphodiester bond.
- DNA replication is semi-conservative, meaning each new DNA molecule contains one old strand and one new strand.
- The lagging strand runs 5' to 3' relative to the direction of synthesis, involving Okazaki fragments, while the leading strand is read continuously 3' to 5'.
Enzymatic Functions
- Polymerase catalyzes the formation of phosphodiester bonds between nucleotides.
- Helicase unwinds nucleic acids, alleviating stress on the double helix by breaking and reattaching phosphodiester bonds.
- Primase is an RNA polymerase that initiates replication by providing an RNA primer when no 3' OH group is available.
- Exonuclease digests phosphodiester bonds from the ends of nucleic acid molecules.
- Endonuclease breaks phosphodiester bonds within polymer chains, not just at the ends.
DNA Transfer Mechanisms
- Conjugation involves direct contact between cells for DNA transfer.
- Transduction relies on intermediary viruses or bacteriophages to move DNA between cells.
- Transformation occurs without physical contact or viral carriers.
- In a case where A- bacteria became A+, this is indicative of conjugation if they do not retain the A+ phenotype when cultured alone.
Experimental Insight
- In the Hershey and Chase experiment, 35S was used to label protein and 32P to label nucleic acid, as proteins lack phosphorus while nucleic acids lack sulfur.
- Self-transmissible plasmids carry genes that enable their own transfer and propagation.
- Helicases, also known as topoisomerases, can convert supercoiled plasmids into relaxed circles by breaking one strand of the double-stranded DNA.
Studying That Suits You
Use AI to generate personalized quizzes and flashcards to suit your learning preferences.
Description
Test your knowledge of DNA with these flashcards focusing on its functions and structure. From understanding purines and pyrimidines to complementary sequences, this quiz helps reinforce key concepts in molecular biology. Perfect for students looking to strengthen their grasp on genetic information storage.
