DNA Study Questions Flashcards

Podcast

Play an AI-generated podcast conversation about this lesson

Questions and Answers

What is the function of DNA in the cell?

DNA is a storage system and stores genetic information.

How do purines and pyrimidines differ in structure?

Purines have a double ring; pyrimidines have a single ring.

Write the complementary sequence to the following: 5' AGGTCACGTCTAGCTAGCTAGA 3'.

5' TCTAGCTAGCTAGACGTGACCT 3'.

Which of the ribose carbons participate in the phosphodiester bond?

The 5' ribose carbon and the 3' ribose carbon. Signup and view all the answers

Which of the ribose carbons carries the nitrogen base?

The 1' carbon of the ribose carries the nitrogen base. Signup and view all the answers

Why does DNA polymerase require primase activity?

DNA polymerase cannot begin synthesis without a 3' OH group. Signup and view all the answers

What is the covalent bond between nucleotides catalyzed by DNA polymerase?

The covalent bond is a phosphodiester bond. Signup and view all the answers

Is DNA replication conservative?

False Signup and view all the answers

What is the lagging strand in DNA synthesis?

The lagging strand is the strand positioned 5' to 3' with respect to the direction of synthesis. Signup and view all the answers

Short pieces of DNA involved in DNA synthesis in replicating cells are called _______ fragments.

Okazaki Signup and view all the answers

What is the function of polymerase?

Catalyzes formation of a phosphodiester bond between nucleotides. Signup and view all the answers

What is the function of helicase?

Unwinds nucleic acids, relieving stress on the double helix. Signup and view all the answers

What is the function of primase?

An RNA polymerase that starts replication in the absence of a 3' OH group. Signup and view all the answers

What is the function of exonuclease?

Digests phosphodiester bonds from the ends of nucleic acid molecules. Signup and view all the answers

What is the function of endonuclease?

Breaks the phosphodiester bonds in nucleic acids within the polymer chains. Signup and view all the answers

How does DNA move from cell to cell in (a) conjugation, (b) transduction, and (c) transformation?

Conjugation involves physical contact; transduction involves intermediary viruses; transformation occurs without physical contact. Signup and view all the answers

In a mixed culture of bacteria with phenotypes A+ and A-, what type of transfer occurred if A- bacteria became A+?

Conjugation occurred in the mixed culture. Signup and view all the answers

What was the rationale for labeling bacteriophage with 35S and 32P in the Hershey and Chase 'blender' experiment?

35S labels protein; 32P labels nucleic acid since there is no S in nucleic acid and no P in phage proteins. Signup and view all the answers

A plasmid that carries genes for its own transfer and propagation is called _________.

self-transmissible Signup and view all the answers

What enzymes can convert a supercoiled plasmid to a relaxed circle?

Helicases (topoisomerases). Signup and view all the answers

Study Notes

DNA Function and Structure

DNA serves as a storage system for genetic information.
Nitrogen bases differ in structure: purines have a double ring (adenine, guanine), while pyrimidines have a single ring (cytosine, thymine).
The complementary sequence for 5' AGGTCACGTCTAGCTAGCTAGA 3' is 5' TCTAGCTAGCTAGACGTGACCT 3'.

Ribose Carbons and Bonding

The 5' ribose carbon carries the phosphate group that forms a phosphodiester bond with the hydroxyl group of the 3' ribose carbon.
The 1' carbon of the ribose is responsible for carrying the nitrogen base.
DNA polymerase requires primase activity to provide a 3' OH group necessary for synthesis.

DNA Replication

The covalent bond formed between nucleotides during replication is a phosphodiester bond.
DNA replication is semi-conservative, meaning each new DNA molecule contains one old strand and one new strand.
The lagging strand runs 5' to 3' relative to the direction of synthesis, involving Okazaki fragments, while the leading strand is read continuously 3' to 5'.

Enzymatic Functions

Polymerase catalyzes the formation of phosphodiester bonds between nucleotides.
Helicase unwinds nucleic acids, alleviating stress on the double helix by breaking and reattaching phosphodiester bonds.
Primase is an RNA polymerase that initiates replication by providing an RNA primer when no 3' OH group is available.
Exonuclease digests phosphodiester bonds from the ends of nucleic acid molecules.
Endonuclease breaks phosphodiester bonds within polymer chains, not just at the ends.

DNA Transfer Mechanisms

Conjugation involves direct contact between cells for DNA transfer.
Transduction relies on intermediary viruses or bacteriophages to move DNA between cells.
Transformation occurs without physical contact or viral carriers.
In a case where A- bacteria became A+, this is indicative of conjugation if they do not retain the A+ phenotype when cultured alone.

Experimental Insight

In the Hershey and Chase experiment, 35S was used to label protein and 32P to label nucleic acid, as proteins lack phosphorus while nucleic acids lack sulfur.
Self-transmissible plasmids carry genes that enable their own transfer and propagation.
Helicases, also known as topoisomerases, can convert supercoiled plasmids into relaxed circles by breaking one strand of the double-stranded DNA.

Studying That Suits You

Use AI to generate personalized quizzes and flashcards to suit your learning preferences.

Description

Test your knowledge of DNA with these flashcards focusing on its functions and structure. From understanding purines and pyrimidines to complementary sequences, this quiz helps reinforce key concepts in molecular biology. Perfect for students looking to strengthen their grasp on genetic information storage.