DNA sequencing

Play an AI-generated podcast conversation about this lesson

Which of the following is NOT explicitly identified as a drawback or characteristic associated with sequencing?

Cost
Complexity (correct)
Speed
Informativeness

Given the repetitive sequences 'ttttttttactac' and 'ttttttttacta', what is the most likely next step in a sequencing process involving progressively shorter fragments?

Extending the sequences to identify mutations
Further shortening the sequence to 'ttttttttact*' (correct)
Analyzing the complete genome for similar sequences
Synthesizing the complementary strand

If a known gene sequence 'aaaaaaaatgatgatgatgatcatgatgatgatgatgatgatg' is compared to a new sequence resulting in the identification of a mutation, what is the most direct implication of this discovery?

The function of the gene may be altered. (correct)
The mutation will automatically lead to a disease phenotype.
The stability of the mRNA transcript of the gene will be enhanced.
The expression levels of the mutated gene will increase.

In automated sequencing gels, what is the primary purpose of including the four bases (A, T, G, C) in the sequencing process shown?

To act as chain terminators, allowing for fragment separation by size. (B) Signup and view all the answers

Considering the sequential nature of the displayed outputs, which aspect of DNA sequencing is most directly emphasized?

The stepwise process of determining nucleotide order. (C) Signup and view all the answers

Which of the following is the MOST comprehensive type of genetic testing for identifying a wide range of genetic variations across an individual's entire genome?

Next Generation Sequencing (NGS) (B) Signup and view all the answers

In the context of genetic testing, what distinguishes genotyping from karyotyping?

Genotyping determines the combination of alleles at specific loci, while karyotyping examines the overall chromosome structure and number. (C) Signup and view all the answers

A patient is suspected of having a genetic disorder caused by a point mutation in a single gene. Which genetic testing method would be the MOST appropriate initial test?

Single Gene Analysis (C) Signup and view all the answers

A researcher is studying a genetic condition and wants to identify heterozygotes and homozygotes for a specific gene. Which genetic testing method should they use?

Genotyping (C) Signup and view all the answers

In microarray analysis, what is indicated by a more intense spot when comparing two samples for a specific mutation?

The sample is homozygous for the mutation. (B) Signup and view all the answers

Which of the following methods involves tagging cells with antibodies to assess their size, granularity, and protein expression?

Flow Cytometry (D) Signup and view all the answers

What is a key difference between single gene analysis and Next Generation Sequencing (NGS) in genetic testing?

NGS provides sequence information across the entire genome, while single gene analysis focuses on a specific gene. (C) Signup and view all the answers

Which of the following techniques relies on an enzyme-linked antibody to detect the presence of a specific antigen or antibody in a sample?

ELISA (C) Signup and view all the answers

In genetic testing, what are 'secondary findings' primarily associated with, and why are they significant?

Next Generation Sequencing (NGS), because it analyzes the entire genome, potentially revealing findings unrelated to the test's initial purpose. (D) Signup and view all the answers

What principle underlies the detection method in ELISA?

Observing color change after a substrate reacts with an enzyme linked to an antibody. (C) Signup and view all the answers

A clinical geneticist is evaluating a patient with a suspected autosomal recessive disorder. Which type of genetic testing would be MOST helpful in determining if the patient is a carrier of the disorder?

Genotyping (D) Signup and view all the answers

Which of the following is a primary application of flow cytometry in clinical settings?

Measuring the size and granularity of individual cells. (D) Signup and view all the answers

Which scenario BEST illustrates the application of genetic testing in 'personalized' medicine?

Employing Next Generation Sequencing (NGS) to identify specific genetic markers that predict a patient's response to a particular drug. (D) Signup and view all the answers

Which of the following techniques is best suited for monitoring HIV progression by assessing T-cell counts?

Flow Cytometry (A) Signup and view all the answers

Which of the following is a disadvantage associated with using microarrays for genetic testing?

High cost. (A) Signup and view all the answers

An ELISA test is performed on a patient suspected of having Lyme disease. The test uses an antibody specific to Borrelia burgdorferi, the causative agent of Lyme disease. If the patient has Lyme disease, what would be the expected outcome of the ELISA?

The substrate added will change color, indicating binding of the antibody to Borrelia burgdorferi antigens. (A) Signup and view all the answers

In the context of Brugada syndrome, what is the primary role of a diagnostic test result in guiding patient management?

To establish the need for interventions such as cardioverter-defibrillator implantation or antiarrhythmic therapy. (B) Signup and view all the answers

For an individual with multiple intestinal or colonic polyps, what is the key distinction that genetic testing aims to resolve?

Distinguishing between Lynch syndrome and attenuated familial adenomatous polyposis (FAP). (A) Signup and view all the answers

If a patient tests positive for a mutation associated with hereditary colon cancer, how does this information primarily influence their medical care?

It guides decisions about surgical interventions and risk assessment for extra-colonic manifestations. (C) Signup and view all the answers

How does predictive genetic testing primarily benefit individuals with a family history of a genetic disorder but without current symptoms?

By identifying mutations that increase the risk of developing the disorder, enabling informed decisions about medical care. (D) Signup and view all the answers

According to the National Comprehensive Cancer Network (NCCN), under what circumstance is germline testing of BRCA1/2 recommended?

For any patient in whom a BRCA1/2 mutation is identified on tumor testing. (C) Signup and view all the answers

What is the primary purpose of predictive testing in the context of genetic mutations?

To determine if an individual carries a mutation that will cause or increase the risk for a disease later in life. (C) Signup and view all the answers

What is a crucial factor that influences the overall value and impact of a predictive genetic test?

The availability of effective prevention or early treatment strategies. (A) Signup and view all the answers

Which of the following outcomes is a direct potential benefit of knowing an individual's increased risk for a particular disease through predictive testing?

Changes in patient behavior or clinical interventions aimed at decreasing the risk. (D) Signup and view all the answers

In a dot blot assay, what determines the binding specificity of the probe to the target DNA?

The complementarity between the probe sequence and the target DNA sequence. (B) Signup and view all the answers

What is the primary purpose of washing the membrane after applying the radioactively labeled probe in a dot blot assay?

To remove any unbound or excess probe, ensuring only the probe bound to the DNA remains. (A) Signup and view all the answers

How does temperature affect the binding of a probe to its target DNA sequence?

Lower temperatures favor binding even with slight mismatches, whereas higher temperatures require perfect complementarity. (C) Signup and view all the answers

What is the role of autoradiography film in a dot blot assay?

To capture the signal emitted by the radioactive probe, indicating where the probe has bound to complementary sequences. (D) Signup and view all the answers

In the context of diagnosing Cystic Fibrosis (CF) using a dot blot, what is the purpose of spotting patient DNA twice?

To hybridize one spot with a probe complementary to the normal CFTR sequence and the other with a probe complementary to a mutated sequence. (A) Signup and view all the answers

How does a dot blot differ from a Southern blot?

A Southern blot involves electrophoresis to separate DNA fragments by size, while a dot blot does not. (C) Signup and view all the answers

What factors influence the stringency of binding in a dot blot assay?

The temperature and buffer conditions. (A) Signup and view all the answers

A genetic test identifies a novel DNA variant not previously linked to any known disorder. What is the MOST appropriate next step to determine its potential pathogenicity?

Test other affected and unaffected family members to assess if the variant segregates with the phenotype. (A) Signup and view all the answers

In a dot blot assay, a patient's DNA shows a strong signal with the probe for the normal gene sequence but no signal with the probe for a common mutation. What does this suggest?

The patient does not have the common mutation and may be homozygous for the normal gene. (A) Signup and view all the answers

What is the primary ethical consideration regarding genetic testing in children, particularly for adult-onset conditions?

Respecting the child's future autonomy by allowing them to make their own decisions about testing in adulthood. (A) Signup and view all the answers

In which scenario would disclosing misattribution of parentage discovered during genetic testing be ethically justifiable?

If there is a clear medical benefit to the child that outweighs the potential harm of the disclosure. (D) Signup and view all the answers

When genetic testing IS indicated for a child, what is the recommended initial approach?

Targeted gene panels or single gene testing based on the clinical presentation. (C) Signup and view all the answers

What is a key concern regarding the use of cell-free DNA (cfDNA) testing for aneuploidy?

The potential for gender discrimination based on fetal sex determination. (A) Signup and view all the answers

What is a significant challenge related to cell-free DNA (cfDNA) analysis?

The techniques were developed after many providers completed their training, creating an education gap. (D) Signup and view all the answers

What aspect of genetic testing results requires understanding of family dynamics and support systems?

The potential psychosocial consequences for the patient and their family. (B) Signup and view all the answers

A physician assistant discovers through a patient's genetic testing that the patient is at high risk for a heritable condition. What is the ethical consideration regarding other at-risk family members?

The physician assistant may have an ethical obligation to disclose genetic information to at-risk family members. (B) Signup and view all the answers

Genetic Testing

A medical test that identifies changes in chromosomes, genes, or proteins.

Purpose of Genetic Testing

To confirm or rule out a suspected genetic condition and determine the risk of developing/passing on a genetic disorder.

Single Gene Analysis

Analyzing a single gene for harmful changes (point mutations)

Next Generation Sequencing (NGS)

A next-generation method that provides sequence information about genetic variation across an individual's entire genome.