BY450 Genetics & Evolution - Lecture 3

Choose a study mode

Play Quiz
Study Flashcards
Spaced Repetition
Chat to Lesson

Podcast

Play an AI-generated podcast conversation about this lesson

Questions and Answers

What is the purpose of heating the solution to 95°C?

  • To allow primers to anneal
  • To cool the reaction mixture
  • To synthesize new DNA strands
  • To denature the double helix (correct)

At what temperature should the solution be cooled to allow primers to anneal?

  • 45°C
  • 56°C (correct)
  • 70°C
  • 80°C

How many template strands are used in this procedure?

  • 3
  • 5
  • 2
  • 4 (correct)

Which of the following sequences is the correct representation of a DNA strand in this context?

<p>5’ – CGATCTGATATGCC – 3’ (C)</p> Signup and view all the answers

What is the expected outcome after the cooling stage of the procedure?

<p>Annealing of primers to target sequences (C)</p> Signup and view all the answers

What is the significance of independent assortment during meiosis?

<p>It contributes to genetic variation in offspring. (B)</p> Signup and view all the answers

Which alleles are involved in determining the colour phenotype according to the content?

<p>R and r (A)</p> Signup and view all the answers

How does the gene concept evolve according to the content?

<p>From discrete units to continuous nucleotide sequences. (A)</p> Signup and view all the answers

What role does beta-galactosidase play in E. coli according to the content?

<p>It breaks down lactose when present. (C)</p> Signup and view all the answers

What is a consequence of heritable phenotypic variation according to the content?

<p>It is often caused by genetic variation. (A)</p> Signup and view all the answers

In the context of genetic inheritance, what is meant by a mutant allele?

<p>An altered form of a gene that leads to different traits. (C)</p> Signup and view all the answers

Why is the concept of 'gene' considered elusive in the content provided?

<p>Because phenotype can arise from multiple genetic and environmental factors. (D)</p> Signup and view all the answers

What happens to polar bodies during meiosis as described in the content?

<p>They are discarded and do not have a role in fertilization. (D)</p> Signup and view all the answers

What is the role of the promoter in a gene cassette?

<p>To provide a regulatory sequence for gene expression (C)</p> Signup and view all the answers

Which promoter is most commonly used in genetically modified crops?

<p>CaMV35S promoter (D)</p> Signup and view all the answers

What does the NOS terminator derive from?

<p>Agarobacterium tumefaciens (C)</p> Signup and view all the answers

Why can closely related organisms have more similar DNA sequences?

<p>They share a common ancestor with similar genetic material (A)</p> Signup and view all the answers

Which process is necessary to visualize DNA sequences?

<p>PCR (Polymerase Chain Reaction) (D)</p> Signup and view all the answers

What components are essential within a gene cassette?

<p>Promoter, transgene, and terminator (B)</p> Signup and view all the answers

What is the base sequence of DNA that runs from 3’ to 5’ in the provided example?

<p>3’ – GCTAGACTATACGGATAGGACCCATAGACAGATTACAGATGGCAGATTGACATAGTTAAGTTGACAGACGACAGACGTTAAGTAGACAACACAGTTAGATAGGACAGACAGA – 5’ (C)</p> Signup and view all the answers

Which statement is true about DNA molecules?

<p>They require amplification techniques for observation (C)</p> Signup and view all the answers

What is required to ligate free dinucleotide triphosphate molecules to the 3' end of primers?

<p>dATP, dGTP, dCTP, and dTTP molecules (B)</p> Signup and view all the answers

At what temperature does the polymerase enzyme optimally extend the primers?

<p>72°C (D)</p> Signup and view all the answers

Which polymerase enzyme is commonly used in the ligation of free dinucleotide triphosphate molecules?

<p>Taq polymerase (A)</p> Signup and view all the answers

How many newly synthesized complementary strands are produced at the end of the cycle described?

<p>Two (B)</p> Signup and view all the answers

Which of the following statements about the sequence is true?

<p>The sequence contains both 3' and 5' ends. (B)</p> Signup and view all the answers

In the context of DNA synthesis, what is the significance of dATP, dGTP, dCTP, and dTTP?

<p>They serve as the building blocks for constructing new DNA strands. (C)</p> Signup and view all the answers

What is the role of the polymerase enzyme during the ligation process?

<p>To extend the primers by adding nucleotide triphosphates (C)</p> Signup and view all the answers

Which of the following represents a common misconception about the temperature required for polymerase function?

<p>The temperature must always be kept at room temperature. (B)</p> Signup and view all the answers

What is the primary purpose of meiosis in diploid organisms?

<p>To create haploid gametes with a complete genome (B)</p> Signup and view all the answers

What happens to homologous chromosomes during meiosis?

<p>They separate and each goes into different daughter cells (C)</p> Signup and view all the answers

What is crossing over and when does it occur?

<p>The exchange of genetic material between non-sister chromatids during meiosis (D)</p> Signup and view all the answers

What is the relationship between sister chromatids and homologous chromosomes?

<p>Sister chromatids are identical copies of a chromosome, while homologous chromosomes are pairs of chromosomes with the same genes but possibly different alleles. (C)</p> Signup and view all the answers

During which phase of meiosis does the independent assortment of chromosomes primarily occur?

<p>Metaphase I (C)</p> Signup and view all the answers

How does the genetic diversity in offspring arise during meiosis?

<p>Primarily through crossing over and independent assortment of chromosomes (C)</p> Signup and view all the answers

What occurs during the chiasmata formation in meiosis?

<p>Homologous chromosomes exchange segments of genetic material (A)</p> Signup and view all the answers

Which statement is true regarding the chromosome number in daughter cells after meiosis?

<p>Each daughter cell has half the diploid chromosome number (A)</p> Signup and view all the answers

What is the first step in optimizing the temperature for the polymerase enzyme during PCR?

<p>Warm up to 72°C (A)</p> Signup and view all the answers

How does the amount of DNA sequences between primers change with each cycle of PCR?

<p>It doubles. (D)</p> Signup and view all the answers

What is the direction of the first DNA strand provided in the sequence?

<p>3’ – 5’ (A)</p> Signup and view all the answers

What is the purpose of the polymerase enzyme in PCR?

<p>To replicate the DNA (B)</p> Signup and view all the answers

What does the sequence '3’ – GCTAGACTATACGGATAGGACCCATAGACAGATTACAGATGGCAGATTGACATAGTTAAGTTGACAGACGACAGACGTTAAGTAGACAACACAGTTAGATAGGACAGACAGA – 5’’ indicate?

<p>A double-stranded fragment (D)</p> Signup and view all the answers

Which part of the DNA sequences is critical for initiating DNA synthesis during PCR?

<p>Primer binding site (D)</p> Signup and view all the answers

Which sequence indicates the correct orientation for a double-stranded DNA?

<p>5’ - 3’ and 3’ - 5’ (B)</p> Signup and view all the answers

In what stage of PCR does the actual synthesis of new DNA occur?

<p>Extension (A)</p> Signup and view all the answers

What is the role of the primer in the PCR process?

<p>To bind to specific sequences of the target DNA (D)</p> Signup and view all the answers

What occurs to the DNA strands during denaturation in PCR?

<p>The strands separate into single strands. (D)</p> Signup and view all the answers

Flashcards

Heat denaturation

A process of separating two DNA strands, using high temperature to break hydrogen bonds between base pairs.

Primer annealing

The process of short, single-stranded DNA sequences (called primers) binding to complementary regions on the DNA strands.

DNA synthesis

The stage where a new DNA strand is synthesized, using the original strand as a template, by adding nucleotides to the primer.

Polymerase chain reaction (PCR)

The process of creating multiple copies of a specific DNA segment, often used in research and diagnostics.

Signup and view all the flashcards

PCR cycle

The initial steps in the PCR cycle involve heating and cooling to separate the DNA double helix, allowing primers to bind, and then building new DNA strands from the primer.

Signup and view all the flashcards

Meiosis Diagram

A diagram representing the process of meiosis, including the separation of maternal and paternal chromosomes and the independent assortment of alleles.

Signup and view all the flashcards

Primer

A short sequence of DNA that is complementary to a specific region of the target DNA. It acts as a starting point for DNA polymerase to synthesize new DNA strands.

Signup and view all the flashcards

Homologous Chromosomes

The two copies of a chromosome, one inherited from each parent, that carry the same genes but may have different alleles.

Signup and view all the flashcards

Taq polymerase

A type of DNA polymerase enzyme that is used in PCR. It is heat-stable and can withstand the high temperatures required for PCR.

Signup and view all the flashcards

Alleles

Alternative forms of a gene, located at the same locus on homologous chromosomes, that can influence a specific trait.

Signup and view all the flashcards

Independent Assortment of Chromosomes

The process by which homologous chromosomes separate during meiosis I, ensuring that each daughter cell receives one copy of each chromosome.

Signup and view all the flashcards

Denaturation

The process of separating DNA strands by heat, allowing for replication.

Signup and view all the flashcards

Annealing

The process of annealing primers to the target DNA strands, allowing for replication initiation.

Signup and view all the flashcards

Genotype

The genetic makeup of an organism, represented by the combination of alleles it carries for a specific gene.

Signup and view all the flashcards

Extension

The process of extending the primer by adding nucleotides complementary to the target DNA.

Signup and view all the flashcards

Phenotype

The observable characteristics of an organism determined by its genotype and environmental factors.

Signup and view all the flashcards

PCR (Polymerase Chain Reaction)

A technique that uses cycles of denaturation, annealing, and extension to amplify a specific region of DNA.

Signup and view all the flashcards

Mutation

A change in the nucleotide sequence of a gene.

Signup and view all the flashcards

Gene Expression

The process by which genetic information encoded in DNA is transcribed into RNA and then translated into a protein, leading to expression of the gene.

Signup and view all the flashcards

Target DNA

The specific region of DNA being targeted for amplification in PCR.

Signup and view all the flashcards

Meiosis

The process by which a diploid cell divides into four haploid daughter cells (gametes) with a complete haploid component of the genome.

Signup and view all the flashcards

Crossing over

The exchange of genetic material between homologous chromosomes during meiosis.

Signup and view all the flashcards

Chromatid

A duplicated chromosome, consisting of two identical sister chromatids.

Signup and view all the flashcards

Diploid

A cell containing two sets of chromosomes, one from each parent.

Signup and view all the flashcards

Haploid

A cell containing one set of chromosomes.

Signup and view all the flashcards

Sexual reproduction

The process by which offspring inherit a combination of genes from both parents.

Signup and view all the flashcards

Gene Cassette

A gene cassette is a segment of DNA containing a transgene, a promoter sequence, and a terminator sequence. This cassette allows the transgene to be expressed correctly in a new organism.

Signup and view all the flashcards

CaMV35S Promoter

The CaMV35S promoter, derived from the cauliflower mosaic virus, initiates the expression of a transgene. It acts like a switch, turning on the gene's activity.

Signup and view all the flashcards

NOS Terminator

The NOS terminator, derived from the Ti plasmid in Agrobacterium tumefaciens, signals the end of the transgene's expression. It acts like a stop button for the gene's activity.

Signup and view all the flashcards

Transgene

A transgene is a gene that is transferred from one organism to another. This new gene can confer specific characteristics to the recipient organism.

Signup and view all the flashcards

DNA Sequence Comparison

The genetic relatedness of organisms can be assessed by comparing their DNA sequences. Organisms with similar DNA sequences are typically more closely related.

Signup and view all the flashcards

DNA Visualization

DNA molecules are extremely small and cannot be observed directly with conventional microscopes. Therefore, special techniques are used to visualize or analyze their sequences.

Signup and view all the flashcards

DNA Preparation

The process of placing DNA in a microcentrifuge tube with some water allows for its manipulation and preparation for various analytical techniques. It is a fundamental step in many DNA-based experiments.

Signup and view all the flashcards

Annealing Temperature

The optimal temperature for the DNA polymerase enzyme to work efficiently during extension.

Signup and view all the flashcards

Warm up to 72°C

The process of increasing the temperature to optimize the activity of the polymerase enzyme in PCR.

Signup and view all the flashcards

Exponential Amplification

The amount of DNA sequences between the primers doubles with each cycle of PCR.

Signup and view all the flashcards

DNA Amplification

The process where a specific DNA sequence is replicated numerous times, resulting in a large number of copies.

Signup and view all the flashcards

Applications of PCR

The use of PCR to diagnose diseases, identify individuals, or study genetic variation.

Signup and view all the flashcards

Study Notes

BY450 Fundamentals of Genetics & Evolution - Lecture 3

  • Lecture is about genes and genomes.

The Human Genome

  • Human genome contains 23 pairs of chromosomes.
  • 3,000,000,000 base pairs (bps).
  • XY for males, XX for females.
  • Coding DNA only accounts for approximately 1.5% of the total DNA.
  • Non-coding DNA, comprising ~ 98.5%, includes functionally vital elements like enhancers and promoters, as well as RNA-producing genes (e.g., ribosomal and transfer RNA).

Eukaryotic Genes

  • A eukaryotic gene comprises coding segments (exons) separated by non-coding segments (introns).
  • RNA splicing removes introns; spliceosomes and small nuclear RNAs accomplish this.
  • Some protein-coding genes have a single exon that isn't spliced.

Meiosis

  • Meiosis is essential for maintaining diploid organisms.
  • Chromosome pairs are sorted before creating daughter cells (gametes) that have a complete haploid component of the genome.
  • Meiosis results in genetically distinct gametes by separating homologous chromosomes.

Gene "Units" and Inheritance

  • Genes are inherited units impacting phenotype (observable characteristics like flower colour).
  • Genes have various alleles (e.g., R and r for flower colour), resulting in different genotypes leading to distinct phenotypes.

Gene Expression

  • Gene expression involves a gene's activity in a cell, producing a particular product like protein.
  • Bacterium E. coli illustrates this using the lacZ gene as an example. It produces the enzyme beta-galactosidase only when lactose is present, regulated by a repressor protein that prevents gene expression.
  • If lactose is present, repressor protein detachment permits beta-galactosidase expression.

Gene Expression - Regulation and Mutation

  • Mutations in gene expression or regulatory pathways affect phenotypic traits.
  • Mutations include alterations in expression, coding, or mutation type.

Genetically Modified Organisms (GMOs)

  • GMOs contain inserted genes from other organisms using biological vectors.
  • The inserted gene, called a 'transgene', requires a promoter and terminator for proper operation in the new organism.
  • Common elements include the CaMV35S promoter and the NOS terminator.

Polymerase Chain Reaction (PCR)

  • PCR is a laboratory technique amplifying DNA segments.
  • Initial steps involve heating to denature DNA and cooling to anneal primers to specific DNA segments.
  • Amplification involves repeated cycles of heating and cooling in combination with DNA polymerase and necessary nucleotides.
  • Cycles of amplification lead to exponential DNA increase.

Studying That Suits You

Use AI to generate personalized quizzes and flashcards to suit your learning preferences.

Quiz Team

More Like This

Use Quizgecko on...
Browser
Browser