BY450 Genetics & Evolution - Lecture 3
47 Questions
0 Views

Choose a study mode

Play Quiz
Study Flashcards
Spaced Repetition
Chat to lesson

Podcast

Play an AI-generated podcast conversation about this lesson

Questions and Answers

What is the purpose of heating the solution to 95°C?

  • To allow primers to anneal
  • To cool the reaction mixture
  • To synthesize new DNA strands
  • To denature the double helix (correct)

    • At what temperature should the solution be cooled to allow primers to anneal?

  • 45°C
  • 56°C (correct)
  • 70°C
  • 80°C

    • How many template strands are used in this procedure?

  • 3
  • 5
  • 2
  • 4 (correct)

    • Which of the following sequences is the correct representation of a DNA strand in this context?

    <p>5’ – CGATCTGATATGCC – 3’ (C)</p> Signup and view all the answers

    What is the expected outcome after the cooling stage of the procedure?

    <p>Annealing of primers to target sequences (C)</p> Signup and view all the answers

    What is the significance of independent assortment during meiosis?

    <p>It contributes to genetic variation in offspring. (B)</p> Signup and view all the answers

    Which alleles are involved in determining the colour phenotype according to the content?

    <p>R and r (A)</p> Signup and view all the answers

    How does the gene concept evolve according to the content?

    <p>From discrete units to continuous nucleotide sequences. (A)</p> Signup and view all the answers

    What role does beta-galactosidase play in E. coli according to the content?

    <p>It breaks down lactose when present. (C)</p> Signup and view all the answers

    What is a consequence of heritable phenotypic variation according to the content?

    <p>It is often caused by genetic variation. (A)</p> Signup and view all the answers

    In the context of genetic inheritance, what is meant by a mutant allele?

    <p>An altered form of a gene that leads to different traits. (C)</p> Signup and view all the answers

    Why is the concept of 'gene' considered elusive in the content provided?

    <p>Because phenotype can arise from multiple genetic and environmental factors. (D)</p> Signup and view all the answers

    What happens to polar bodies during meiosis as described in the content?

    <p>They are discarded and do not have a role in fertilization. (D)</p> Signup and view all the answers

    What is the role of the promoter in a gene cassette?

    <p>To provide a regulatory sequence for gene expression (C)</p> Signup and view all the answers

    Which promoter is most commonly used in genetically modified crops?

    <p>CaMV35S promoter (D)</p> Signup and view all the answers

    What does the NOS terminator derive from?

    <p>Agarobacterium tumefaciens (C)</p> Signup and view all the answers

    Why can closely related organisms have more similar DNA sequences?

    <p>They share a common ancestor with similar genetic material (A)</p> Signup and view all the answers

    Which process is necessary to visualize DNA sequences?

    <p>PCR (Polymerase Chain Reaction) (D)</p> Signup and view all the answers

    What components are essential within a gene cassette?

    <p>Promoter, transgene, and terminator (B)</p> Signup and view all the answers

    What is the base sequence of DNA that runs from 3’ to 5’ in the provided example?

    <p>3’ – GCTAGACTATACGGATAGGACCCATAGACAGATTACAGATGGCAGATTGACATAGTTAAGTTGACAGACGACAGACGTTAAGTAGACAACACAGTTAGATAGGACAGACAGA – 5’ (C)</p> Signup and view all the answers

    Which statement is true about DNA molecules?

    <p>They require amplification techniques for observation (C)</p> Signup and view all the answers

    What is required to ligate free dinucleotide triphosphate molecules to the 3' end of primers?

    <p>dATP, dGTP, dCTP, and dTTP molecules (B)</p> Signup and view all the answers

    At what temperature does the polymerase enzyme optimally extend the primers?

    <p>72°C (D)</p> Signup and view all the answers

    Which polymerase enzyme is commonly used in the ligation of free dinucleotide triphosphate molecules?

    <p>Taq polymerase (A)</p> Signup and view all the answers

    How many newly synthesized complementary strands are produced at the end of the cycle described?

    <p>Two (B)</p> Signup and view all the answers

    Which of the following statements about the sequence is true?

    <p>The sequence contains both 3' and 5' ends. (B)</p> Signup and view all the answers

    In the context of DNA synthesis, what is the significance of dATP, dGTP, dCTP, and dTTP?

    <p>They serve as the building blocks for constructing new DNA strands. (C)</p> Signup and view all the answers

    What is the role of the polymerase enzyme during the ligation process?

    <p>To extend the primers by adding nucleotide triphosphates (C)</p> Signup and view all the answers

    Which of the following represents a common misconception about the temperature required for polymerase function?

    <p>The temperature must always be kept at room temperature. (B)</p> Signup and view all the answers

    What is the primary purpose of meiosis in diploid organisms?

    <p>To create haploid gametes with a complete genome (B)</p> Signup and view all the answers

    What happens to homologous chromosomes during meiosis?

    <p>They separate and each goes into different daughter cells (C)</p> Signup and view all the answers

    What is crossing over and when does it occur?

    <p>The exchange of genetic material between non-sister chromatids during meiosis (D)</p> Signup and view all the answers

    What is the relationship between sister chromatids and homologous chromosomes?

    <p>Sister chromatids are identical copies of a chromosome, while homologous chromosomes are pairs of chromosomes with the same genes but possibly different alleles. (C)</p> Signup and view all the answers

    During which phase of meiosis does the independent assortment of chromosomes primarily occur?

    <p>Metaphase I (C)</p> Signup and view all the answers

    How does the genetic diversity in offspring arise during meiosis?

    <p>Primarily through crossing over and independent assortment of chromosomes (C)</p> Signup and view all the answers

    What occurs during the chiasmata formation in meiosis?

    <p>Homologous chromosomes exchange segments of genetic material (A)</p> Signup and view all the answers

    Which statement is true regarding the chromosome number in daughter cells after meiosis?

    <p>Each daughter cell has half the diploid chromosome number (A)</p> Signup and view all the answers

    What is the first step in optimizing the temperature for the polymerase enzyme during PCR?

    <p>Warm up to 72°C (A)</p> Signup and view all the answers

    How does the amount of DNA sequences between primers change with each cycle of PCR?

    <p>It doubles. (D)</p> Signup and view all the answers

    What is the direction of the first DNA strand provided in the sequence?

    <p>3’ – 5’ (A)</p> Signup and view all the answers

    What is the purpose of the polymerase enzyme in PCR?

    <p>To replicate the DNA (B)</p> Signup and view all the answers

    What does the sequence '3’ – GCTAGACTATACGGATAGGACCCATAGACAGATTACAGATGGCAGATTGACATAGTTAAGTTGACAGACGACAGACGTTAAGTAGACAACACAGTTAGATAGGACAGACAGA – 5’’ indicate?

    <p>A double-stranded fragment (D)</p> Signup and view all the answers

    Which part of the DNA sequences is critical for initiating DNA synthesis during PCR?

    <p>Primer binding site (D)</p> Signup and view all the answers

    Which sequence indicates the correct orientation for a double-stranded DNA?

    <p>5’ - 3’ and 3’ - 5’ (B)</p> Signup and view all the answers

    In what stage of PCR does the actual synthesis of new DNA occur?

    <p>Extension (A)</p> Signup and view all the answers

    What is the role of the primer in the PCR process?

    <p>To bind to specific sequences of the target DNA (D)</p> Signup and view all the answers

    What occurs to the DNA strands during denaturation in PCR?

    <p>The strands separate into single strands. (D)</p> Signup and view all the answers

    Study Notes

    BY450 Fundamentals of Genetics & Evolution - Lecture 3

    • Lecture is about genes and genomes.

    The Human Genome

    • Human genome contains 23 pairs of chromosomes.
    • 3,000,000,000 base pairs (bps).
    • XY for males, XX for females.
    • Coding DNA only accounts for approximately 1.5% of the total DNA.
    • Non-coding DNA, comprising ~ 98.5%, includes functionally vital elements like enhancers and promoters, as well as RNA-producing genes (e.g., ribosomal and transfer RNA).

    Eukaryotic Genes

    • A eukaryotic gene comprises coding segments (exons) separated by non-coding segments (introns).
    • RNA splicing removes introns; spliceosomes and small nuclear RNAs accomplish this.
    • Some protein-coding genes have a single exon that isn't spliced.

    Meiosis

    • Meiosis is essential for maintaining diploid organisms.
    • Chromosome pairs are sorted before creating daughter cells (gametes) that have a complete haploid component of the genome.
    • Meiosis results in genetically distinct gametes by separating homologous chromosomes.

    Gene "Units" and Inheritance

    • Genes are inherited units impacting phenotype (observable characteristics like flower colour).
    • Genes have various alleles (e.g., R and r for flower colour), resulting in different genotypes leading to distinct phenotypes.

    Gene Expression

    • Gene expression involves a gene's activity in a cell, producing a particular product like protein.
    • Bacterium E. coli illustrates this using the lacZ gene as an example. It produces the enzyme beta-galactosidase only when lactose is present, regulated by a repressor protein that prevents gene expression.
    • If lactose is present, repressor protein detachment permits beta-galactosidase expression.

    Gene Expression - Regulation and Mutation

    • Mutations in gene expression or regulatory pathways affect phenotypic traits.
    • Mutations include alterations in expression, coding, or mutation type.

    Genetically Modified Organisms (GMOs)

    • GMOs contain inserted genes from other organisms using biological vectors.
    • The inserted gene, called a 'transgene', requires a promoter and terminator for proper operation in the new organism.
    • Common elements include the CaMV35S promoter and the NOS terminator.

    Polymerase Chain Reaction (PCR)

    • PCR is a laboratory technique amplifying DNA segments.
    • Initial steps involve heating to denature DNA and cooling to anneal primers to specific DNA segments.
    • Amplification involves repeated cycles of heating and cooling in combination with DNA polymerase and necessary nucleotides.
    • Cycles of amplification lead to exponential DNA increase.

    Studying That Suits You

    Use AI to generate personalized quizzes and flashcards to suit your learning preferences.

    Quiz Team

    Related Documents

    BY450 Fundamentals of Genetics & Evolution Lecture 3 Genes & Genomes PDF

    Description

    This quiz covers key concepts from BY450 Lecture 3, focusing on genes, genomes, and the structure of the human genome. It also explores eukaryotic gene organization, RNA splicing, and the critical process of meiosis in maintaining genetic diversity. Test your understanding of these fundamental topics in genetics.

    More Like This

    Use Quizgecko on...
    Browser
    Open
    Browser
    Browser