BIOL 3803 Heredity Experiments Quiz

Choose a study mode

Play Quiz
Study Flashcards
Spaced Repetition
Chat to Lesson

Podcast

Play an AI-generated podcast conversation about this lesson

Questions and Answers

Why did Avery, MacLeod, and McCarty's transformation experiment only show DNA as the hereditary molecule?

  • The experiment was conducted without proper controls
  • They used living organisms instead of in vitro conditions
  • Protein was removed as a possible transformation factor (correct)
  • RNA was removed as a possible transformation factor

What was the significance of using radioactive isotopes of sulfur and phosphorus in the Hershey and Chase experiment?

  • To observe which molecules enter bacterial cells during infection
  • To determine the toxicity of radioactive elements on bacteria
  • To track the involvement of sulfur and phosphorus in DNA and protein synthesis (correct)
  • To understand how radioactive elements transform DNA

Based on the Griffith experiments, which scenario would NOT support the conclusion of a transformation factor responsible for heredity?

  • Isolation of living S-iii from a blood sample
  • Heated S-iii and living R-II resulted in mouse death
  • Living R-II bacteria coexisting with non-heated S-iii bacteria (correct)
  • S-iii bacteria transforming into R-II bacteria upon contact

What role did bacterial cultures play in the Hershey and Chase experiment?

<p>To serve as a host for bacteriophages and determine hereditary material (D)</p> Signup and view all the answers

In the Hershey and Chase experiment, why was it important that sulfur is only present in proteins and not in DNA?

<p>To differentiate between DNA and protein as the genetic material (A)</p> Signup and view all the answers

Which statement best summarizes the outcome of Griffith's experiments regarding the transformation factor?

<p>'Heated S-iii leading to R-II transformation provided proof of genetic material change.' (D)</p> Signup and view all the answers

What is the name of the bond that joins one nucleotide to another in the DNA strand 5'-ATCGACCTGATC-3'?

<p>Phosphodiester bond (C)</p> Signup and view all the answers

What is the sequence of the other strand in the DNA duplex with the sequence 5'-ATCGACCTGATC-3'?

<p>TAGCTGGACTAG (A)</p> Signup and view all the answers

What term is used to describe the pattern of base pairing between one DNA strand and its partner in a duplex?

<p>Complementary (B)</p> Signup and view all the answers

In the DNA fragment 5'-ACGTAGAGTGCTC-3' 3'-TGCATCTCACGAG-5', how many covalent bonds are present between nucleotides?

<p>12 (A)</p> Signup and view all the answers

Which normal major event of DNA replication can the temperature-sensitive mutant 2 complete at 40°C?

<p>Unwinding the DNA and making RNA primers (A)</p> Signup and view all the answers

Which molecule is most likely carrying the temperature-sensitive mutation in temperature-sensitive mutant 1?

<p>DNA ligase (C)</p> Signup and view all the answers

What is the polarity of the leading and lagging strands in a DNA replication fork?

<p>The leading strand is 5' to 3', and the lagging strand is 3' to 5' (B)</p> Signup and view all the answers

What is the sequence and polarity of the DNA duplex fragment deduced from the dideoxy DNA sequencing gel?

<p>5' ATAGCCGTACTTAGCTGAGGAGTCGATAAC 3' (A)</p> Signup and view all the answers

Which model of DNA replication was excluded by Meselson and Stahl's experiment?

<p>Conservative model (A)</p> Signup and view all the answers

Which normal major event of DNA replication can the temperature-sensitive mutant 1 complete at 40°C?

<p>Removing RNA primers and replacing them with DNA (B)</p> Signup and view all the answers

What is the primary reason why eukaryotic genomes, like Drosophila, require multiple origins of replication, while bacterial genomes, like E. coli, have only a single origin?

<p>Eukaryotic genomes are larger and need to be replicated faster before cell division. (A)</p> Signup and view all the answers

What is the primary reason for the shortening of telomeres in each replication cycle?

<p>DNA polymerase cannot replicate the very end of the linear chromosome. (B)</p> Signup and view all the answers

What is the primary function of the enzyme telomerase?

<p>To synthesize and maintain the telomeres at the ends of linear chromosomes. (C)</p> Signup and view all the answers

If a double-stranded DNA sample contains 20% cytosine, what is the percentage of thymine in the sample?

<p>30% (A)</p> Signup and view all the answers

In the family pedigree described, what is the genetic term that best describes the pattern of inheritance of the DNA marker?

<p>Codominant (A)</p> Signup and view all the answers

If DNA replication in early Drosophila embryos occurs every 5 minutes, and the Drosophila genome contains approximately 1.8 x 10^8 base pairs, approximately how many origins of replication are required for this rate of replication?

<p>15,000 (C)</p> Signup and view all the answers

If DNA polymerase III lost its 5' to 3' polymerase activity due to a mutation, what would be the effect on DNA replication?

<p>No DNA replication would be possible. (C)</p> Signup and view all the answers

If DNA polymerase III lost its 3' to 5' exonuclease activity due to a mutation, what would be the effect on DNA replication?

<p>DNA replication would be error-prone, as misplaced nucleotides would not be removed. (D)</p> Signup and view all the answers

What is the sequence composition of telomeres in most eukaryotic organisms?

<p>Repeats of TTAGGG (D)</p> Signup and view all the answers

Why is telomerase generally active in germ-line cells but not in somatic cells?

<p>To maintain the integrity of the genome in germ-line cells for future generations. (D)</p> Signup and view all the answers

Flashcards are hidden until you start studying

More Like This

BIOL 2402 Hematology Quiz
10 questions

BIOL 2402 Hematology Quiz

EasygoingAgate6318 avatar
EasygoingAgate6318
BIOL 112 Chapter 6 Flashcards
69 questions
Biol 1610 - Class 22: Membrane Transport
11 questions
BIOL 314 Chapter 20-23 Flashcards
18 questions
Use Quizgecko on...
Browser
Browser