Bio Sci H97 Lecture #2, DNA Structure and Replication PDF

Bio Sci H97 Lecture #2, Sept 30th 2024 DNA structure and replication Read chapter 1 - 1.2 (6-11, 7-14), 1.4 (15-18, 19-23). Read chapter 7 - 7.2(240-247, 310-315), 7.3 (248-9, 315-326), 7.4 (254-257, 323-336), 7.5 (261-266, 340-352)...

Bio Sci H97 Lecture #2, Sept 30th 2024 DNA structure and replication Read chapter 1 - 1.2 (6-11, 7-14), 1.4 (15-18, 19-23). Read chapter 7 - 7.2(240-247, 310-315), 7.3 (248-9, 315-326), 7.4 (254-257, 323-336), 7.5 (261-266, 340-352) Version 8-14-22 Bio 97, Parsons, UCI - Copyright: All rights reserved 1  Lecture 2: Objectives DNA structure and replication: o Identify the components of DNA o Know the 4 bases and be able to explain complimentary base pairing. o Be able to explain how nucleotides are polymerized to form DNA o Describe semi-conservative replication and explain its significance o Be able to name and describe major enzymatic processes in DNA replication PCR/sequencing: o Outline the process of PCR o Explain dideoxy sequencing (Sanger) o Understand the concepts (not details) behind Next-generation sequencing and be able to understand the differences with Sanger sequencing. Bio 97, Parsons, UCI - Copyright: All rights reserved 2  Lecture 2: Keywords Double helix Sugar-phosphate backbone Rosalind Franklin Elongation Nucleotide Semiconservative Deoxyribose Bidirectional Pyrimidine Origin of replication Purine RNA primase Adenine, Cytosine, Guanine, Thymine Chromosome Deoxynucleotide phosphates (dNTP) Primers Complementary Leading, lagging strand Antiparallel Okazaki fragment Hydrogen Bond 5’-3’ exonucleases Major, minor groove Ligase DNA polymerase Helicase Polymerase Chain Reaction (PCR) Proofreading Sanger/dideoxynucleotide sequencing Next-generation sequence Bio 97, Parsons, UCI - Copyright: All rights reserved 3  The DNA Double Helix o Identified by Rosalind Franklin and modeled by James Watson and Francis Crick, the secondary structure of DNA shows that it is fairly simple in structure o It is composed of four kinds of nucleotides, joined by covalent phosphodiester bonds making two polynucleotide chains that come together to form a double helix o Despite the structural simplicity, DNA is a complex informational molecule 4 Bio 97, Parsons, UCI - Copyright: All rights reserved  DNA Nucleotides o A DNA nucleotide is composed of a sugar, one of four nitrogenous bases, and up to three phosphate groups o Deoxyribose is the sugar of DNA nucleotides; it has five carbons, identified as 1, 2, 3, 4, and 5 o A nucleotide base is attached to the 1 carbon, a hydroxyl (OH) group is attached to the 3 carbon, and one to three phosphates are attached to the 5 carbon Why is this important? The structure of the nucleotide provides polarity to DNA. 5 Bio 97, Parsons, UCI - Copyright: All rights reserved  DNA Nucleotides and Bases o Pyrimidines, cytosine and thymidine, have a single ring, and purines, adenine and guanine, have a double ring Pure As Gold Pyramids are there for U T C o Deoxynucleotide monophosphates the links in the chain have single phosphates and are called dNMPs, where N refers to any of the four bases o Deoxynucleotide triphosphates (dNTPs) used to build the polynucleotide chain during replication 6 Bio 97, Parsons, UCI - Copyright: All rights reserved  The DNA duplex Two polynucleotide chains form a double helix that follows two rules: 1. The bases of one strand are complementary to the bases in the corresponding strand (A pairs with T and G pairs with C) 2. The two strands are antiparallel with respect to their 5 and 3 ends 7 Bio 97, Parsons, UCI - Copyright: All rights reserved  Basis of Complementary Pairing o Complementary base pairing combines one purine with one pyrimidine o The chemical basis of the pairing is the formation of stable hydrogen (H) bonds among the bases on the antiparallel strands o Two H bonds form between A and T; three H bonds form between G and C o The antiparallel arrangement of the two strands of the double helix is essential for forming stable H bonds 8 Bio 97, Parsons, UCI - Copyright: All rights reserved  Major and Minor Grooves o Base-pair stacking creates gaps among the sugar-phosphate backbones that partially expose the nucleotides o The major groove, approximately 12Å wide, alternates with the minor groove, approximately 6Å wide o These grooves are regions where DNA binding proteins can make direct contact with nucleotides 9 Bio 97, Parsons, UCI - Copyright: All rights reserved  Assembly of Polynucleotide Chains o Individual nucleotides are assembled into chains by the enzyme DNA polymerase o It catalyzes the formation of a phosphodiester bond between the 3 hydroxyl group of one nucleotide and the 5 phosphate of an adjacent one o Each polynucleotide chain has a sugar-phosphate backbone, consisting of alternating sugar and phosphate groups 10 Bio 97, Parsons, UCI - Copyright: All rights reserved  DNA strand elongation 11 Bio 97, Parsons, UCI - Copyright: All rights reserved  DNA strand elongation 12 Bio 97, Parsons, UCI - Copyright: All rights reserved  DNA Replication Is Semiconservative and Bidirectional o The integrity of the nucleotide sequence of DNA is of paramount importance o The general mechanism of DNA replication is the same in all organisms o As organisms diverged and became more complex, some differences did develop in the replication proteins and enzymes o Semiconservative DNA replication: each daughter duplex contains one parental and one daughter strand 13 Bio 97, Parsons, UCI - Copyright: All rights reserved  Multiple Replication Origins in Eukaryotes o Electron micrograph analysis shows multiple origins of replication on eukaryotic chromosomes o Eukaryotic genomes contain hundreds to thousands of origins of replication sites o The human genome may contain more than 50,000 origins o DNA replication rate varies among different types of cells 14 Bio 97, Parsons, UCI - Copyright: All rights reserved  Multiple Replication Origins in Eukaryotes RNA DNA primers (▼)are polymerase Multiple Origins needed; elongates ofcannot these DNA initiate Replication on aDNA are strands synthesized by adding strand Single by a synthesis Chromosome specialized on own RNA nucleotides polymerase to the itsDrosophila from 3 end of acalled melanogaster primase preexisting strand * ▼ * ▼ * ▼ * ▼ ▼ ▼ * * * 15 Bio 97, Parsons, UCI - Copyright: All rights reserved  Leading and Lagging Strand Synthesis One copy of pol III synthesizes one daughter strand continuously in the same direction as fork progression This is the leading strand The other copy of pol III elongates the other daughter strand discontinuously, in the opposing direction to fork progression, via short segments called Okazaki fragments This is the lagging strand Tsuneko Okazaki 16 Bio 97, Parsons, UCI - Copyright: All rights reserved The Replication Bubble RNA Primer Removal and Okazaki Fragment Ligation DNA polymerase I uses two activities to complete replication: 1. Its 5-3 exonuclease activity removes the RNA primers 2. Its 5-3 polymerase activity adds DNA nucleotides to the 3ʹ end of the DNA segment preceding the primer DNA ligase seals the gap among the resulting DNA segments 17 Bio 97, Parsons, UCI - Copyright: All rights reserved  Replisome Replisome is a complex – consisting of multiple enzymes that performs DNA replication is a systematic manner. Some of the components and functions are listed: DNA helicase – unwinds helix Primase – generates RNA primers 2x DNA polymerase III – replication of both strands 5’ to 3’ and proof reading due to a 3-to- 5 exonuclease activity DNA polymerase I - 5-3 exonuclease activity removes RNA primer. 5’-3’ polymerase replaces RNA DNA Ligase – makes phosphodiester bonds make continuous DNA strand 18  Removal and Replacement of RNA Primer Nucleotides and Ligation of Okazaki Fragments Okazaki fragments about 100-200 nucleotides long in eukaryotes 19  Proofreading o Carried out by DNA pol III in the replisome o Replication errors produce a DNA mismatch and inability of the mismatched bases to form the appropriate H bonds o This leads to displacement of the 3 OH into the 3-to-5 exonuclease site of the enzyme o Several nucleotides (including the incorrect one) are removed and new nucleotides are incorporated 20 Bio 97, Parsons, UCI - Copyright: All rights reserved  Molecular biology techniques o Polymerase Chain Reaction (PCR) o Sanger sequencing o Next-generation sequencing Bio 97, Parsons, UCI - Copyright: All rights reserved  The Polymerase Chain Reaction o PCR requires: o polymerase o The A double-stranded chain DNA template reaction (PCR)containing the target is an automated sequence version to be of DNA amplified replication developed by Kary Mullis that produces millions of copies of a short target DNA segment o A supply of the four DNA nucleotides o has o PCR A heat-stable DNA polymerase almost endless applications o Two different single-stranded DNA primers – composition/size important o PCR reactions are carried out in small volumes (10 to 50 L) o A buffer solution o The most commonly used DNA polymerase, Taq, is isolated from Thermus aquaticus, which occurs naturally in hot springs 22 Bio 97, Parsons, UCI - Copyright: All rights reserved  The Polymerase Chain Reaction o PCR uses two DNA sequences called PCR primers that provide a starting point for Taq polymerase to add nucleotides o The PCR primers define the 5 and 3 boundaries of the replication products o PCR is composed of three steps that result in exponential amplification of large numbers of the target DNA o Reactions carried out in a tube in a thermocycler 23 Bio 97, Parsons, UCI - Copyright: All rights reserved 5’ 3’ 3’ 5’ 24 Bio 97, Parsons, UCI - Copyright: All rights reserved extension Anneal Denature 72oooCCC – 55-65 –– 95 Cycle 1 5’ 3’ Denaturation: Primer thethe extension: annealing: reaction the mixture reaction reaction is heatedisisto temperature temperature  95°C raised to to reduced  45–68°C denature 72°C to allowthe DNA Taqallow to into single polymerase primers to to strands synthesize hybridize toDNA bycomplementary their extending primers sequences in the target DNA 25 Bio 97, Parsons, UCI - Copyright: All rights reserved Denature Anneal 72oooCCC –– 95 – 55-65 extension Cycle 2 5’ 3’ extension: thethe Primer annealing: Denaturation: the reaction reaction reaction temperature is heatedisisto temperature mixture  95°C raised reducedto to  45–68°C 72°C to allowthe denature Taqallow to polymerase DNA primers into to single hybridize to synthesize strands their DNA bycomplementary extending primers sequences in the target DNA 26 Bio 97, Parsons, UCI - Copyright: All rights reserved Denature Anneal 72oooCCC –– 95 – 55-65 extension Cycle 3 5’ 3’ Denaturation: thethe Primer extension: annealing: reaction the mixture reaction reaction is heatedisisto temperature temperature  95°C raised to to reduced  45–68°C denature 72°C to allowthe DNA Taqallow to into single polymerase primers to strands synthesize hybridize toDNA their bycomplementary extending primers sequences in the target DNA 27 Bio 97, Parsons, UCI - Copyright: All rights reserved  Analysis of PCR Products o Amplified DNA fragments are separated from the rest of the reaction mixture by gel electrophoresis o PCR product sizes are measured in base pairs (bp) and compared to known size markers o Differences in the size of DNA amplified by a pair of primers are related to the amount of DNA between the primers o PCR product can be cloned into plasmids o PCR product can be directly sequenced 28 Bio 97, Parsons, UCI - Copyright: All rights reserved  Dideoxynucleotide DNA Sequencing o The ultimate description of a DNA molecule is its precise sequence of bases o The first DNA-sequencing protocols were developed by Maxam and Gilbert, and another by Sanger in 1977 o The Sanger (dideoxynucleotide) method was most amenable to automation and is the basis for the high-throughput approach that is the method of choice today 29 Bio 97, Parsons, UCI - Copyright: All rights reserved  Dideoxynucleotide DNA Sequencing o Dideoxynucleotide DNA sequencing (dideoxy sequencing) uses DNA polymerase and DNA primers to replicate new DNA from a single- stranded template o The four standard deoxynucleotide bases (dNTPs) are present in large amounts o Each reaction contains a small amount of one dideoxynucleotide (ddNTP), which lacks a 3-OH group 30 Bio 97, Parsons, UCI - Copyright: All rights reserved  Dideoxynucleotide DNA Sequencing o Whenever a ddNTP is incorporated into the product DNA molecule, replication ceases o A separate reaction is carried out for A, T, G, and C, using the corresponding small amount of ddNTP OLD FASHIONED o Each reaction tube produces a series of partial DNA molecules, each of which ends with that nucleotide YOU WILL NEVER DO THIS o All four reactions must be run side by side on a gel in order to determine the complete sequence LAST TIME I DID THIS WAS IN THE LAST CENTURY 31 Bio 97, Parsons, UCI - Copyright: All rights reserved Dideoxynucleotide DNA Sequencing 32 Bio 97, Parsons, UCI - Copyright: All rights reserved One reaction with four ddNTPs. Each ddNTP is tagged with a different fluorescent moiety. Whenever a ddNTP is added to the new DNA strand the extension is halted. The products will have fluorescent tags at the 3’ ends indicating the identity of the last base copied. Use of a thermocycler allows many products to be made NOTE one primer amplification is linear. 5’ 3’ AATGCGCTGCATCGTAGCATGCAG AATGCGCTGCAT AATGCGCTGCA AATGCGCTG AATGCGCTGCATCGTAGC 3’ 5’ C C T C A C A A C A G T G T A G T G T G C C T C C A C A C C A A A G G T G T G A T T G 33 Bio 97, Parsons, UCI - Copyright: All rights reserved Completed reaction - With this kind of Sanger sequencing you get good data capillary of continuous sequence up to 1000bp Chromagraph Fluorescent + detector A A T T G C C A C C A G T G Interpretation 34 Bio 97, Parsons, UCI - Copyright: All rights reserved  Next-generation sequencing (NGS) New generations of DNA sequencing technologies sequence hundreds of thousands to millions of DNA fragments in parallel This decreases the cost of DNA sequencing and increases the speed due to the simultaneous nature of sequencing fragments at the same time Unlike Sanger/ Dideoxynucleotide DNA Sequencing, NGS identifies the sequence of a DNA strand “by synthesis” rather than by the chain termination Each section of DNA sequenced is much smaller than can be achieved by Sanger sequencing. To annotate so many small pieces of sequence, the sequence must first be mapped back to a reference sequence. 35 Bio 97, Parsons, UCI - Copyright: All rights reserved  Comparing Sanger to NGS https://www.youtube.com/watch?v=womKfikWlxM Watch this YouTube video that explains one commonly used method of NGS Sanger sequencing NGS Focused on one specific region at a Massively parallel – whole genomes at a time time Continuous sequence up to 1kb Each sequence is short Requires some knowledge of target to Any DNA can be sequenced BUT a design primer reference genome is needed for annotation The last nucleotide in an extension is Every nucleotide is labelled labeled Chain termination Sequencing by synthesis Suitable for sequencing plasmids, Suitable for sequencing anything large constructs, transgenes etc and complex: transcriptome, whole genomes, whole exonomes etc Bio 97, Parsons, UCI - Copyright: All rights reserved  Peer recommended resources: DNA structure https://www.youtube.com/watch?v=0E4p34mqJbg&ab_channel=NeuralAcademy (Lin ks to an external site.) DNA replication https://www.youtube.com/watch?v=3jslVQDGkLU https://www.youtube.com/watch?v=TNKWgcFPHqw Next generation sequencing https://www.youtube.com/watch?v=shoje_9IYWc https://www.youtube.com/watch?v=ToKUGz_YhC4 PCR https://youtu.be/aUBJtHwHASA (Links to an external site.) https://youtu.be/hO3mTqrEeq8 (Links to an external site.) (Warning funny video) https://youtu.be/x5yPkxCLads https://www.youtube.com/watch?v=uKeMiAZ8Zu4 37  Bio Sci H97 Genetics Lecture 3, October 2nd 2024 Gene expression: transcription Read Chapter 8 - 8.1 (275-279, 362-365), 8.3 (286-292, 375- 381), 8.4 (294-302, 385-391) eText Bio 97, Parsons, UCI - Copyright: All rights reserved