Lect 6 (PCR) slides (1).pdf

BIOL 366 Lecture 5. Fundamental and applications of Polymerase Chain Reaction (PCR) Lecture objectives. To learn about: - Basics of Polymerase Chain Reaction (PCR) - Applications of PCR; how to engineer a gene - Quantitative (real-time) PCR Readings: 1. Text Section: 7.2 2. “qPCR Essentials”...

BIOL 366 Lecture 5. Fundamental and applications of Polymerase Chain Reaction (PCR) Lecture objectives. To learn about: - Basics of Polymerase Chain Reaction (PCR) - Applications of PCR; how to engineer a gene - Quantitative (real-time) PCR Readings: 1. Text Section: 7.2 2. “qPCR Essentials” and “Real-Time PCR Vs. Traditional PCR” articles from Applied Biosciences (on Canvas). 3. Analyzing real-time PCR data by the comparative C(T) method. Thomas D Schmittgen and Kenneth J Livak (2001). DOI: 10.1038/nprot.2008.73 (in reserve) 1 Announcements / Questions Below Text questions are good for practice Chapter 4: 4.4., 4.5, 4.8, 4.9, 4.13, 4.14 Chapter 6: 6.2 – 6.13 & 6.17 Chapter 7: 7.1, 7.2, 7.4, 7.5, 7.7, 7.8. 2 The Polymerase Chain Reaction (PCR). • Developed by Kary Mullis in 1983 (see How We Know) • Is used to amplify (make copies of) a DNA segment • In theory, PCR can detect and amplify as little as one DNA molecule in almost any type of sample. • Given the extreme sensitivity of PCR methods, contamination of samples is a serious issue. In many applications, e.g., forensic and ancient DNA tests, controls must be run to make sure the amplified DNA is not derived from contaminating sources. 3 The constituents of a PCR reaction. - Buffer: why? - DNA template - Primers - Nucleotides (dNTPs; A,C,G,T) - A heat-stable DNA polymerase (The Taq DNA polymerase (from Thermus aquaticus is often used) The reaction is placed in a thermocycler, which is programmed to perform the required number of cycles. 4 The Polymerase Chain Reaction (PCR). Fig. 7-9a. Note: In practice all reagents and components of the PCR experiments are added to a test tube before experiment begins. Also, note the unusual 5’ to 3’ directions 5 The Polymerase Chain Reaction (PCR). • After PCR assay is completed, reaction products can be stained and resolved on a gel (agarose) to visualize the amplified DNA • Common stains: -Ethidium bromide -SYBR Green • Gels are not very quantitative; why? Number of template molecules 6 To amplify a fragment o f DNA by PCR, prepare the reaction mix and: 5’GCAGGTCGACTCTAGAGGCTCCCCGGGTACCGAGCTCATTCAGTCC 3’CGTCCAGCTGAGATCTCCGAGGGGCCCATGGCTCGAGTAAGTCAGG Step 1: Heat to 95 oC to denature the DNA template 5’GCAGGTCGACTCTAGAGGCTCCCCGGGTACCGAGCTCATTCAGTCC 3’CGTCCAGCTGAGATCTCCGAGGGGCCCATGGCTCGAGTAAGTCAGG Step 2: Cool to 45 – 60 oC to allow primers to anneal to the template 5’GCAGGTCGACTCTAGAGGCTCCCCGGGTACCGAGCTCATTCAGTCC3’ 3’GTAAGTCAGG5’ Learn to make primers Step 3: Primer Extension (72 degrees C) 5’GCAGGTCGACTC3’ 3’CGTCCAGCTGAGATCTCCGAGGGGCCCATGGCTCGAGTAAGTCAGG5’ 5’GCAGGTCGACTCTAGAGGCTCCCCGGGTACCGAGCTCATTCAGTCC 3’CGTCCAGCTGAGATCTCCGAGGGGCCCATGGCTCGAGTAAGTCAGG 5’GCAGGTCGACTCTAGAGGCTCCCCGGGTACCGAGCTCATTCAGTCC 3’CGTCCAGCTGAGATCTCCGAGGGGCCCATGGCTCGAGTAAGTCAGG Repeat steps 1-3 as many times as needed (30 to 40 cycles are common). 7 Phases of PCR: DNA amplification follows three phases: Exponential, Linear, Plateau. Question: What happens (to the concentration of the amplified DNA) in each phase? Exponential phase: The PCR product is doubling at every cycle (assuming 100% reaction efficiency). • During this phase the concentration of PCR product is proportional to the amount of target gene in the starting sample Linear Variability: Reaction components are being consumed, product is no longer doubling with each cycle. Plateau: Reaction has stopped, no more products are being made and if left long enough,8 the PCR products will begin to degrade. Applications of PCR: 1. Creating / engineering restriction sites using PCR. 2. Point Mutations (altering codons) i. Nucleotide deletion ii. Nucleotide insertion iii. Nucleotide substitution 3. Detection of gene expression i. Extract RNA ii. Reverse transcribe to cDNA iii. Obtain primers for the gene of interest iv. Amplify the gene of interest by PCR Notes: 1. This figure is from older text 2. Note the unusual 5’ to 3’ directions 9 Break / Activity 10 There are different types of PCR. The most common types are: 1. Basic, standard, or End-Point PCR. PCR reaction is completed and the products are analyzed by staining and gel electrophoresis. 2. Real-time PCR, aka quantitative PCR, or qPCR. i. Basic principles are the same as standard PCR ii. Monitors DNA synthesis after each cycle iii. Records the data digitally iv. Collected data is analyzed. One common method is the Livak ΔΔCT method. v. Requires specialized equipment vi. Is ideal for studying gene expression 11 qPCR Terminology Threshold: the minimum accepted fluorescence level. Cycle threshold value (CT value): the number of cycles required for a sample to emit fluorescence above the threshold. Baseline: Refers to “baseline fluorescence” in all wells of the reaction plate. Text Fig 7-10 12 qPCR Terminology Reference gene: A gene that is: - Readily detectable in all tissues tested - Is expressed at a constant/stable rate across all samples tested - Is used to normalize expression of the target gene - Can indicate if all aspects of your assay went well - Examples: actin and 18s rRNA Sample and Calibrator: In “relative qPCR” experiments. The expression of a target gene in the target tissue/sample (the Sample) is compared to that of the calibrator tissue/sample (the Calibrator). For example: A researcher wants to determine the effects of an antifungal agent (AFA) on the expression of a plant terpene synthase (TPS) gene in leaves of Arabidopsis plant. She treats a few plants with the AFA (dissolved in a buffer), and a few plants with only the buffer. In this example leaf tissue from plants treated with buffer alone represent the Calibrator (non treated), and those from plants treated with the buffer containing AFA represent the Sample (treated). 13 Detection of DNA in qPCR: There are two general strategies: A) Reporter dyes, e.g., SYBR green. The dye binds double stranded DNA and then emits fluorescence light. i. The light is detected by the instrument. ii. The intensity of the light is proportional to [DNA] Fig 18 from Article 1 on canvas 14 B) DNA probes (continued): The TaqMan probe • These probes are labelled with a reporter dye (fluorophore) at one end, and a quencher at the other. • When the fluorophore and the quencher are in proximity, quenching inhibits any fluorescence. • After the probe binds its target during qPCR, it is degraded by the polymerase producing a signal that can be detected by the instrument. • They are typically 100 – 200 bp long Fig 15 from Article 1 on canvas 15 Other common probes include Molecular Beacons (upper figure) and Scorpion (lower figure) https://www.sigmaaldrich.com/CA/en/technical-documents/technical-article/genomics/qpcr/molecularbeacons?gclid=CjwKCAjwy7CKBhBMEiwA0Eb7aq6SaZirilHndsoGsUTyawJREnZqlOuGPMs-3UUY6ZwIfjlDJofrihoCHssQAvD_BwE 16 Detection of DNA in qPCR: B) DNA probes 17 Some disadvantages of traditional/standard PCR that relies on End-Point Detection, compared to qPCR. Disadvantages of End-Point PCR: • Non – Automated; Post PCR processing needed • Results are not expressed as numbers • Poor Precision; Staining DNA in gel is not very quantitative • Low sensitivity; relatively large amounts of DNA (>20 cycles of PCR) are needed for detection • Size-based discrimination only ➢ In qPCR melting point analysis ca be done to distinguish between amplified fragments. 18 The following data was obtained in a qPCR experiments designed to determine the relative expression of Gene 1 in leaf or flower tissue of lavender plants. Notes: Actin was used as a reference gene. Where: Primer Actin Gene1 Replication 3 3 Tissue Leaf Leaf Average CT 24.00 35.00 Actin 3 Flower 24.00 - Target is Gene 1 Gene1 3 Flower 25.00 - Reference gene is Actin. - Sample is flower tissue - Calibrator is leaf tissue Can you tell where gene 1 is more strongly expressed by looking at the data? Yes, in flower tissue. Why????? 19 The following data was obtained in a qPCR experiments designed to determine the relative expression of Gene 1 in leaf or flower tissue of lavender plants. Notes: Actin was used as a reference gene. Primer Actin Gene1 Replication 3 3 Tissue Leaf Leaf Average CT 24.00 35.00 Actin 3 Flower 21.00 Gene1 3 Flower 25.00 Where: - Sample is flower tissue - Calibrator is leaf tissue - Target is Gene1 - Reference gene is Actin. • Data needs to be normalized to the reference gene • The Livak method (below formula) can be used to calculate the expression fold differences for Gene1 in flower relative to leaf tissue. Fold Change = 2-∆∆CT = 2 -((CT target – CT reference) in sample – (CT target – CT reference) in calibrator) 20 To calculate fold changes: 1) Calculate the average CT value for each gene in both flower and leaf tissue. 2) Normalize the CT of target to reference (obtain ΔCT) in sample (flower) and calibrator (leaf) ΔCT (sample) = CT (target in sample) – CT (reference in sample) ΔCT (calibrator) = CT (target in calibrator) – CT (reference calibrator) 3) Calculate the difference between the ΔCT of the test sample and the ΔCT of the calibrator, also called ΔΔCT: ΔΔCT = ΔCT (sample) – ΔCT (calibrator) 4) Calculate the expression ratio (fold difference) Expression ratio (folds) = 2–ΔΔCT Fold Change = 2-∆∆CT = 2 -((CT target – CT reference) in sample – (CT target – CT reference) in calibrator) Reference: Kenneth J. Livak* and Thomas D. Schmittgen (2001). Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2–ΔΔCT Method. METHODS, Vol 25, pp:402–408. 21