BioMg1350 Fall 2024 Lecture Slides PDF

Please log into PollEv using your NetID biomg1350fall24 https://pollev.com/biomg1350fall24 Transcription – synthesis of RNA The “Central Dogma” of Molecular Biology DNA sequence nucleus mRNA sequence cytosol Protein se...

Please log into PollEv using your NetID biomg1350fall24 https://pollev.com/biomg1350fall24 Transcription – synthesis of RNA The “Central Dogma” of Molecular Biology DNA sequence nucleus mRNA sequence cytosol Protein sequence The building blocks of RNA The monomers in RNA are “nucleotides” There are important differences to deoxynucleotides in DNA! RNA DNA 5’ 4’ 1’ 3’ 2’ RNA uses ribose instead of deoxyribose in DN The monomers in RNA are “nucleotides” There are important differences to deoxynucleotides in DNA! RNA DNA RNA uses uracil (U) instead of thymine (T) in D  Nucleotides in RNA form polymers by phosphodiester linkage monomer monomer dimer condensation H 2O 5’ 5’ 3’ condensation 3’ phosphodiester OH OH linkage 5’ H 2O + 5’ O- 3’ OH 3’ OH Panel 2-6 Essential Cell Biology  RNA is single-stranded 5’ end sugar- phosphate backbone G (acidic) ribose OH phosphodiester linkage U ribose OH phosphodiester linkage A ribose OH phosphodiester linkage C ribose OH 3’ end  RNAs can fold into complex 3D structures Base-pairing within the same RNA molecule allows the folding into a 3D structure (which can include “non-conventional” base pairs)  RNAs can fold into complex 3D structures DNA forms anti-parallel Examples of different RNA structures Double helices hat are the advantages for cells in making RNA Why this? …and why not this?  Transcription synthesis of RNA from a DNA template The “Central Dogma” of Molecular Biology DNA sequence nucleus mRNA sequence cytosol Protein sequence A “gene” is a segment of DNA that contains instructions for making a RNA molecule RNA Figure 7-2 modified ECB6  During transcription, RNA is synthesized complementary to the “template” strand of DNA “coding” strand DNA by RNA Polymerase RNA plate strand is read by “RNA polymerase” polymerase synthesizes RNA only in 5’ to 3’ direction (same as DNA syn scription results in single-stranded RNA (”RNA transcript”) lting RNA sequence is the same as coding DNA strand, except T is repla Adapted from Figure 7-6 ECB  A gene is a segment of DNA that contains instructions for making a RNA molecule RNA Human genome contains: 6.4 billion base pairs per diploid genome ~20,000 protein coding genes, which make up only 1% of the DNA ~5,000 non-protein coding RNA genes (DNA -> RNA) w do cells know, where to start and which DNA sequen to transcribe into RNA? Figure 7-2 modified ECB6  Regulation of prokaryotic transcription gene RNA polymerase coding strand RNA polymerase binds to the promote (stretch of DNA containing certain sequenc with the help of transcription factor(s terminator template promoter strand “Sigma factor” in prokaryotes RNA synthesis begins Promoter defines where RNA polymera starts to synthesize RNA RNA polymerase synthesizes RNA in 5’ to 3’ direction using the growing RNA template strand of DNA (1 error transcript in 1000 nucleotides) RNA polymerase stops at the terminato (specific DNA sequences), falls off from the DNA and releases the completed RN Genes can be encoded in both DNA strands The position and orientation of the promoter determines where RNA synthesis starts and which strand is the template strand (remember: RNA synthesis can only proceed in 5’ to 3’ direction)  Many RNA polymerases can transcribe a single gene simultaneously growing RNA DNA Transcription of gene 1 Transcription of gene 2 Figure 7-8 ECB6 ee different types of RNA (mRNA, tRNA, rR k together in protein synthesis (translat  A gene is a segment of DNA that contains instructions for making a particular RNA molecule mRNA RNA non-protein coding RNA rRNA tRNA micro(mi)RNA others protein coding RNA Different RNAs perform different functions for the cel Figure 7-2 modified ECB6 fferent types of RNAs perform different functio Type of RNA Size Function ~100 – 10 mRNA (messenger RNA) Protein coding kb ~100 - Protein synthesis rRNAs (ribosomal RNA) 5000 (machinery) Protein synthesis (adaptors tRNAs (transfer RNA) ~70 - 90 to mRNA) mRNA processing, gene Many others! ….. regulation, etc. messenger RNA (mRNA) nscription allows for amplification and regulat RNA polymerase transcription factors gene A gene B mRNA mRNA and the rate at which different genes are transcribed is highly regulate You will learn a lot more about gene regulation in lectures 16 and 17 Most eukaryotic genes contain introns SPLICING mRNA Exons – sequences that remain in the mRNA after splicing Introns – sequences that are removed by splicing Splicing is carried out by several small nuclear (sn)RNAs  Alternative splicing can produce different mRNAs and proteins from the same gene RNA splicing increases the number of different proteins the same gene (or genome) can encode Figure 7-23 ECB5 modified  Capping and polyadenylation of mRNA (only mRNAs are capped and polyadenylated) These modifications can affect: how quickly mRNA is turned over (mRNA stability) how efficiently mRNA is translated Figure 7-17 ECB5  Once transcribed and modified, mRNA is exported from the nucleus to the cytosol for translation Genetic information transmitted by the mRNA directs the synthesis of proteins coding strand Code using 4 bases template strand (CGAT) m Code using 4 bases Codon (CGAU) mRNA is read in 5’ to 3’ direction for translation Sequence using 20 amino acids Figure 7-1 Essential Cell Biology  The nucleotide sequence of mRNA is translated into the amino acid sequence of a protein via the genetic code a set of 3 nucleotides defines a codon codoncodoncodoncodoncodoncodon 3 nucleotide codons: 4 x 4 x 4 = 64 possible codons (2 nucleotide codons: 4 x 4 = 16 possible codons, not enough!) Figure 7-27 Essential Cell Biology (don’t memorize the codons) mRNA molecule has three possible “reading fra 5’ … C U C A G C G U U A C C A U... 3’ How do cells know, which reading frame to use to synthesize the correct protein? Figure 7-28 Essential Cell Biology The genetic code contains codons for START and STOP START STOP Start codon is always There are three stop codons, whi AUG, are bound by proteins (not tRNA) and defines the reading called “release factors” and do n frame. code for any amino acids (AUG can also encode methionine within a protein) Figure 7-27 Essential Cell Biology In eukaryotic cells, translation begins at the first AUG and ends at the first “in-frame” stop codon Consider this messenger RNA (mRNA) Open Reading Frame (ORF) 5’ 3’ GAUCCACGACCAUGACUGACUCACUGACUUGGCCGUACGCAUCGAUGCGAUUGACCUGAGAAUGC MetThrAspSerLeuThrTrpProTyrAlaSerMetArgLeuAsn 5’ 3’ untranslated untranslated region region N-terminus C-terminus (3’UTR) (5’UTR) mRNA is translated in the 5’ to 3’ direction. Polypeptides are synthesized in the NH2- to -COOH direction How do you link codons to amino acids? amino acid ? mRNA OH OH OH OH 5’ end U U C 3’ end transfer RNA (tRNA) NAs (‘transfer RNAs’) link codons and amino ac amino acid 3D structure of tRNA O Phe tRNA 5’ 3’ 3’-AAG-5’ Anticodon sequence 5’-UUC-3’ Sequence in mRNA mRNA is read in 5’ to 3’ direction for translation! w do cells couple the right amino acid to its tRN amino acyl-tRNA synthetase anticodon loop Amino acyl-tRNA synthetases are critical for the genetic code! acyl-tRNA synthetases attach amino acids to There is at least one amino acyl-tRNA synthetase for each amino acid Each amino acyl-tRNA synthetase is specific for one amino acid and the appropriate tRNA(s) Figure 7-33 Essential Cell Biology ribosomal RNA (rRNA)  mRNA is decoded on ribosomes This process is known as ‘translation’ Peptidyl-Aminoacyl- Exit tRNA tRNA Catalyzes peptide bond formation (rRNA does this!) Binds mRNA and matches tRNAs to mRNA codons complete ribosome: 4 rRNA molecules + 82 proteins Figure 7-38 Essential Cell Biology Origin of Life – The idea of an “RNA world” RNA can encode genetic information RNA can fold in many 3D structures RNA can have structural function RNA can have catalytic activity (Ribozymes) ural and artificial RNA-based enzymes (Ribozym osed) transition from an “RNA world” to moder