MCB 250 Exam 2 Slides - Chromosomes & Replication PDF

Vcast 20 Chromosome MCB 250 Structure and Chromatin 1 Dr. James M. Slauch Dept of Microbiology E. coli Chromosome DNA is 1 mm Cell is 1 µm Size of Intact Cell  The Bacterial Chromosome The E. coli chromosome is a closed c...

Vcast 20 Chromosome MCB 250 Structure and Chromatin 1 Dr. James M. Slauch Dept of Microbiology E. coli Chromosome DNA is 1 mm Cell is 1 µm Size of Intact Cell  The Bacterial Chromosome The E. coli chromosome is a closed circle (a few bacteria have linear chromosomes). Bacteria have “nucleoid” proteins but there is not the repeating higher order structure seen in eukaryotes. There is a higher order structure or scaffolding that is apparent in electron micrographs – “Nucleoid”. Nobody understands the nature of this scaffolding – Unknown proteins? – Gyrase/TopoI? The structure is not static. – There is no evidence that the same piece of DNA is always associated with the scaffold – All regions of the chromosome can apparently find any other region  The Compaction Problem The compaction problem is even greater for eukaryotic cells than for bacteria. A human cell contains 3 x 109 bps per haploid set of chromosomes. 3 x 109 bp x 3.4 Å/bp = 1010Å = 1m. In a diploid cell there will be 2 meters of DNA to accommodate in a nucleus of diameter 10 - 15 µm.  DNA in eukaryotic cells exists as chromatin Chromatin: the complex of DNA and proteins found in the nuclei of eukaryotic cells Histones are the major proteins found associated with eukaryotic DNA. Many non-histone proteins are also present. Half of the mass of a eukaryotic chromosome is protein. Forms of Chromatin (Electron Micrographs) Chromatin isolated at low Chromatin isolated at salt physiological salt (0.15M) Fig 8-17 Compaction States of Eukaryotic DNA The structures at the left are well characterized. The higher order structures at the right are largely speculative. The “beads on a string” of the 10 nm fiber are nucleosomes. Eukaryotic Chromosomes are Packaged Around Histones Histones are small (11 - 21 kDa), very basic (20 -25% lys + arg) proteins. Four histone proteins (the “core histones”) form a disk that the DNA wraps around. – The disk is made up of 2 copies each of H2A, H2B, H3, and H4. H1 is a “linker” protein between the “core” histones.  Eukaryotic Chromosomes are Packaged Around Histones Histone proteins are nearly identical in all eukaryotes, i.e., they are highly conserved. – H4 from cows differs by 2 amino acids from H4 of peas so histone H4 have not changed very much in the ~ 109 years since plants and animals diverged. – Histone H2 is also “conserved” but shows the most variability. – There are 4 “variants” of H2A in humans that can act in a “plug and play” fashion to affect the functions of the particular histone. Gene silencing, DNA repair, etc.  Nucleosome dsDNA wraps around histone core ~1.67 times = Nucleosome or bead on a string (10 nm) 146 bp of DNA plus 20–60 bp linker DNA 10nm Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education  Binding of the histones to the DNA backbone bends the DNA. Note that all of the histones share a similar fold - the “histone fold”. Interactions are primarily with the phosphates and a few minor groove bases – NOT sequence specific  Nucleosome Structure Note N-terminal tails (NTDs, N-terminal H3 (blue) domains). There are H4 8NTDs: 2 H3, 2H4, etc. (green) About 25 - 30% of the total mass of the core histones is in the NTDs. H2A (yellow) NTDs extend out of the H2B (red) central disc and are unstructured in the crystal structure. Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education  Vcast 21 Chromatin 2 MCB 250 Dr. James M. Slauch Dept of Microbiology  Nucleosome Structure Note N-terminal tails (NTDs, N-terminal H3 (blue) domains). There are H4 8NTDs: 2 H3, 2H4, etc. (green) About 25 - 30% of the total mass of the core histones is in the NTDs. H2A (yellow) NTDs extend out of the H2B (red) central disc and are unstructured in the crystal structure. Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education  H1 Histone and Histone Tails are Required to Form 30 nm Fibers 30 H1 nm fiber The exact structure of the 30 nm fiber is not completely clear. This is a recent model based on Cryo-EM. Note that the histone Figs from Watson et al. Molecular Biology of the Gene, NTDs stabilize the 30nm fiber. © 2014, Pearson Education H1 and the 30 nm Fiber  The 30nm fiber is not compact enough to fit DNA into the nucleus. A possibility for higher order chromatin structure: Loops of 30nm fiber. The “chromosome scaffold” is presumably composed of a number of different non-histone proteins, such as TopoII and others(?). The exact structures of the 30nm fiber and all higher order chromosome structures are not really known. It’s likely that these structures are not uniform along the chromosome - different regions probably contain different proteins and have different structures. Still more compaction is required to form condensed mitotic chromosomes Net Result: Each DNA molecule has been packaged into a mitotic chromosome that is 50,000X shorter than the simple DNA helix.  The Level of DNA Compaction and Position of Histones is Highly Regulated In states more compact than the 10 nm fiber, DNA is not accessible for transcription, replication, or repair. Using the light microscope, cytologists have observed for many years that part of the chromatin in the nucleus (heterochromatin) is condensed and stains densely with many dyes. Some of the chromatin (euchromatin) stains weakly with dyes and appears to have an open structure. GRADED EFFECT Little or no transcription Low level transcription Active transcription Heterochromatin Euchromatin 30 nm 10 nm  The Level of DNA Compaction and Position of Histones is Highly Regulated We now understand that the DNA heterochromatic regions is poorly transcribed whereas genes that are highly expressed (frequently transcribed) are in euchromatic regions. So chromatin structure can determine which genes are turned off and which are turned on. Even regions of DNA that are not transcribed must be made accessible for DNA replication and repair. So, how can chromatin structure be altered to allow access to the DNA?  Regulation of Chromatin Structure (The simple version) The overall accessibility of the DNA can be modified Individual histones can be moved to free up a binding site for a regulatory protein Much of this is controlled by proteins that specifically modify the histone tails, giving a “histone code” There are histone tail “Writers, Readers, and Erasers” Figs from Watson et al. Molecular Biology of the Gene, We’ll talk about it later © 2014, Pearson Education  The Histone Code – histone modifications control chromosome compaction and protein interaction and, therefore, gene expression  Are Eukaryotic Chromosomes Supercoiled? Eukaryotic chromosomes are linear – not covalently closed circles. But DNA strands are very long and therefore are topologically constrained. Are the ends attached to anything? – Yes – maybe the nuclear matrix. But wrapping around the histones is equivalent to negative supercoiling. Eukaryotes have Type I and II topoisomerases.  Wrapping of DNA Around Histones Introduces Topoisomerase Negative Supercoils  Vcast 22 DNA Replication MCB 250 Dr. James M. Slauch Dept of Microbiology E. coli Chromosome DNA is 1 mm Cell is 1 µm Size of Intact Cell  Scale of the Problem E. coli chromosome is 4.5 x 106 basepairs and is 1 mm long If the DNA was a 2-stranded kite string 1 mm wide, then it would be ½ mile long and the cell would be ¾ of a meter in diameter – Your assignment: separate the two strands, wrap a new strand around each and end up with two new pieces and NO knots. You have 40 minutes with an average error rate (incorporation of a wrong base, i.e. a mutation) of once per 109 bases. That’s 1 mistake ~every 1000 chromosomes. DNA Replication is Semiconservative The products of replication are duplexes with one old strand (blue) and one new one (red).  Chromosomal Replication is Bidirectional Resolution Origin of Replication Two Replication Forks  Replication proceeds 5’ to 3’ All DNA polymerases require a primer and a template. The primer grows, the template is copied. Synthesis is in the 5’ to 3’ direction. This means that the 3’ end grows. The substrates for DNA replication are dNTPs The building blocks for DNA replication are the four deoxynucleoside triphosphates (dNTPs where N = A,T,G, or C).  Chemistry of DNA Replication The 3’-hydroxyl of the growing chain carries out a nucleophilic attack on the a-phosphate of the incoming NTP forming a new phosphodiester bond. The other product is pyrophosphate (PP) which is rapidly converted to phosphate by pyrophosphatase. Hydrolysis of the PP product drives the reaction in the direction of polymerization. Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education DNA Replication is Semi- continuous 3’ 5’ D au gh te r Leading strand du pl ex Parental DNA duplex 5’ Short RNA primer 3’ Okazaki fragment Direction of fork movement Lagging strand Point of joining 5’  DNA replication Replisome (2xPol III) Synthesizes both Leading and Lagging Strands at Replication Fork Okasaki Fragments After Passage, Pol I Removes RNA primer and Completes DNA Synthesis DNA Ligase Seals Nicks Nick P 3’ 5’ 3’ 5’ OH 5’ 3’ 5’ 3’ The Replisome Note that the leading strand polymerase and the lagging strand polymerases are connected by interactions with the t-protein of the clamp loader.  Vcast 23 Replisome 1 MCB 250 Dr. James M. Slauch Dept of Microbiology DNA Replication is Semi- continuous 3’ 5’ D au gh te r Leading strand du pl ex Parental DNA duplex 5’ Short RNA primer 3’ Okazaki fragment Direction of fork movement Lagging strand Point of joining 5’ The Replisome Note that the leading strand polymerase and the lagging strand polymerases are connected by interactions with the t-protein of the clamp loader.  Proteins Required for Replication Helicase (DnaB) – Melts parental DNA, interacts with PolIII and Primase Primase (DnaG) – Synthesizes RNA primers DNA Polymerase III (Pol III) – Synthesizes DNA. Requires a primer. Single Strand Binding Protein (SSB) – Binds single stranded DNA template cooperatively, prevents reannealing and hairpins RNAse H – Removes RNA primers DNA Polymerase I (Pol I) – Removes RNA primers and replaces RNA with DNA DNA ligase – Seals nicks between Okazaki fragments Topoisomerase – Relaxes DNA in front of the replication fork  Helicase - DnaB Electron Microscope Reconstruction Hexamer – 6 identical subunits Wraps completely around the lagging strand Requires DnaC to load Travels 5’ to 3’ Uses ATP to unwind the helix Helicase is Required to Unwind the DNA Duplex The helicase travels 5’®3’ on the lagging strand template. Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education Single Stranded Binding Protein (Ssb) Prevents Re-annealing of the Helix Fig 11-19f Binding of SSB is Highly Cooperative - Binding of one SSB makes it likely that another will bind next to it Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education  Primase Active site cleft Recruited by Helicase Starts preferentially at 5’- CTG-3’ and lays down a 10-12 nucleotide primer Then dissociates – not processive Must act every 1- 2 kb or so on lagging strand Fig 11-19d Why Use RNA as a Primer We don’t really know Leftover from the “RNA World” Fidelity! (Slauch’s favorite hypothesis) – DNA polymerase requires a primer to increase the fidelity of laying down the next base – Laying down a base “de novo” is a low fidelity event There’s no stacking, geometry not defined, etc – The cell has chosen to lay down RNA de novo and then replace it with high fidelity DNA E. coli DNA Polymerase III “Holoenzyme” is composed of 14 subunits – 3(aeq) 3t g1g2g2dd’ 2b Core polymerase – a – DNA Polymerase – e – 3’ to 5’ Exonuclease – q – Stimulates Exonuclease Trimerization – t Clamp Loader or g complex - g1g2g2dd’ Clamp – b You don’t have to memorize the names of the subunits (the greek letters) but you do need to know the names of the complexes and what they and their components do.  Pol III Core Fingers Thumb Incoming Nucleotide Template Figs from Watson et al. Template Primer Molecular Biology of the Gene, Bend in © 2014, Pearson Education Base Template All DNA polymerases have this general structure. The Polymerization Reaction 2 divalent cations bound to the enzyme participate in the reaction. One activates the 3’ -OH of the primer and the other binds to and helps to position the dNTP and to neutralize its charge. Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education The O-helix is in one of the fingers. A conformation change occurs in the polymerase when a properly base-paired substrate occupies the active site. This positions the properly paired dNTP for reaction. Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education  DNA Replication is Highly Accurate A mistake is a mutation. Mistakes can be minimized either by not making them in the first place or by correcting them after they’ve been made. Pol III is designed to have a low frequency of misincorporations and to fix misincorporations if they occur. There are other mechanisms (to be discussed later) for correcting the mistakes that Pol III misses. Accuracy 1: without correct base pairing the incoming dNTP is not positioned correctly for reaction to occur. Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education Accuracy 2: the 2’-OH of ribonucleotides doesn’t fit in the active site. Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education 1) Slow or no synthesis - can’t extend chain with a mispair at the end Mispaired last base pair Accuracy 3. Pol III has a 3’ ® 5’exonuclease activity that removes misincorporated Exonuclease site bases. 2) Remove Mismatched bp 3) Resume DNA Synthesis Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education  Vcast 24 Replisome 2 MCB 250 Dr. James M. Slauch Dept of Microbiology  Proteins Required for Replication Helicase (DnaB) – Melts parental DNA, interacts with PolIII and Primase Primase (DnaG) – Synthesizes RNA primers DNA Polymerase III (Pol III) – Synthesizes DNA. Requires a primer. Single Strand Binding Protein (SSB) – Binds single stranded DNA template cooperatively, prevents reannealing and hairpins RNAse H – Removes RNA primers DNA Polymerase I (Pol I) – Removes RNA primers and replaces RNA with DNA DNA ligase – Seals nicks between Okazaki fragments Topoisomerase – Relaxes DNA in front of the replication fork The Replisome Note that the leading strand polymerase and the lagging strand polymerases are connected by interactions with the t-protein of the clamp loader.  b Subunit: The Clamp 35Å hole completely surrounds double stranded DNA (or DNA- RNA hybrid) Does not “bind” DNA DNA is free to slide through the hole Tethers the PolIII core to the DNA Confers processivity - enzyme adds a very large number of dNTP’s before it dissociates Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education  The Clamp Fig 11-15  Importance of Being Processive It takes about 1 msec for a DNA polymerase to add a base (so 1000 additions/sec). It takes about 1 min for a polymerase to release and rebind DNA So to copy a 5000 base DNA it takes a highly processive enzyme (holo-PolIII) only a few seconds, whereas several hours would be needed for a poorly processive enzyme to copy this DNA. g Subunit: The Clamp Loader 1 clamp loader per replisome Does not dissociate – integral part of the polymerase complex Recognizes 3’ end of the primer/DNA hybrid Uses ATP to open the clamp (b subunit) and load it Loads the clamp onto the double stranded region So, at least in theory, the clamp loader has to act only once on leading strand but it must act many times on the lagging strand. Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education The Clamp Loader  DNA PolIII Holoenzyme The Replisome  Protein Interactions at the Replication Fork Helicase can contact both Primase and t Helicase recruits Primase to the open origin Primase lays down 5 - 10 nucleotide primer Clamp loader recognizes primer and loads clamp Clamp recruits a PolIII core and initiates leading strand synthesis Helicase recruits primase repeatedly to initiate lagging strand synthesis The Replisome  DNA replication Replisome (2xPol III) Synthesizes both Leading and Lagging Strands at Replication Fork Okasaki Fragments After Passage, Pol I Removes RNA primer and Completes DNA Synthesis DNA Ligase Seals Nicks Nick P 3’ 5’ 3’ 5’ OH 5’ 3’ 5’ 3’  RNAse H Removes RNA from RNA- DNA Hybrids – “H” stands for Hybrid Can only cleave bonds between ribonucleotides Therefore, leaves one ribonucleotide: E. coli Polymerase I (Pol I) Single polypeptide – 3 domains – Polymerase Activity – 3’ to 5’ Exonuclease - Fix errors – 5’ to 3’ Exonuclease – Remove RNA or DNA in “front” of primer Starts at the end of the PolIII synthesized strand and removes RNA primer replacing it with DNA. Not very processive - doesn’t have to go far. Leaves a “nick” - break in backbone in one strand Has additional roles in DNA repair (discussed later) Removal of RNA primer by DNA Polymerase I (Pol I) PolI is poorly processive (it’s not interacting with a clamp) so only 25- 50 bases are added per binding event).  DNA Ligase Nick (also called a “single strand break”) P 5’ 3’ OH 3’ 5’ ATP ADP + PP 5’ 3’ 3’ 5’  DNA Ligase The enzyme transfers an AMP group from ATP to the 5’- phosphate at the nick. The 3’-OH attacks the phosphate forming a phosphodiester bond and releasing AMP.  The Replisome The lagging-strand DNA Polymerases bind to sliding clamps at the primer:template junction and begin to synthesize new Okazaki fragments  Animations You can find several animations depicting DNA replication at: https://www.biointeractive.org/classroom- resources?keyword=DNA+replication I particularly like “DNA replication (advanced detail)”  Replication is Fast! 1000 nucleotides per second If the DNA were 1 meter in diameter: The DNA would be 500 miles long (2 250 mile trips) The Replisome would be the size of a FedEx Truck It would travel at 375 miles per hour One error every 106 miles (which will probably be repaired)  Topoisomerases Relax DNA (prevent or remove positive supercoils) in Front of Replication Fork As helicase unwinds DNA, it decreases the twist, therefore the writhe increases in front of the replisome (Lk remains constant). If this problem is not solved DNA replication would quickly stop. Both Type I and Type II topoisomerases can act to remove the positive supercoils and allow replication to proceed. In E. coli, Gyrase is believed to be the most important enzyme for relaxing DNA in front of a replication fork. Replication machinery Positive Supercoils TopoII Note that the Topoisomerase is NOT part of the replication fork machinery per se Negative Supercoils Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education  Vcast 25 Replication MCB 250 Initiation and Termination Dr. James M. Slauch Dept of Microbiology  Chromosomal Initiation OriC Resolution Origin of Replication Two Replication Forks  Replication Initiation The E. coli chromosome has a single initiation site, oriC. oriC is recognized by a specific initiator protein, DnaA. DnaA must be bound to ATP in order to act as initiator. Binding of DnaA-ATP begins a series of events that leads to establishment of replicaton forks. Replication initiation is tightly controlled.  Structure of oriC The oriC region is about 250 bps long. The 9-mer sites bind DnaA-ATP causing the 13-mer region to melt. Fig 11-29 DnaA-ATP Binds to its Recognition Sites in OriC Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education The DnaA-ATP Nucleoprotein Complex Causes Unwinding of the DNA Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education DnaC Loads DnaB (Helicase) onto the Single Stranded DNA – One Helicase on Each Strand Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education Each Helicase Recruits a Primase to Initiate DNA Synthesis Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education A Clamp Loader Recognizes the 3’ End and Loads a Clamp on Each Strand Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education The Two Replisomes are Now Formed and Proceed Around the Chromosome Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education  Replication Initiation Origin Okazaki Fragments Leading Lagging “Red” Replisome 5’ 3’ 3’ 5’ “Black” Replisome Lagging Leading Origin The Primase in Each Replisome can Only Prime the Lagging Strand The First Lagging Strand Okazaki Fragment ( ) Serves as the Leading Strand Primer for the OTHER Replisome  Replication Initiation The model on the previous slide explains how replication can be initiated using only lagging strand initiation This is a nice model that makes a clear prediction: the leading strand is synthesized as a single continuous molecule starting at the origin This can’t be true! – At some appreciable frequency a replication fork will “collapse” and needs to be reassembled well beyond the origin – There is machinery in the cell that does this – But, the replisome MUST be capable of re-initiating the leading strand Cell Division in E. coli DNA replication must be coordinated with cell division. How is this coordination achieved? E. coli DNA is Methylated Dam (DNA Adenine Methyltransferase) recognizes the sequence 5’GATC 3’ 3’CTAG 5’ and adds a methyl group to the A’s. The methyl group protrudes into the major groove. 5’GATC 3’ CH3 3’CTAG 5’ N6-meA  E. coli DNA is Methylated Methylation is significantly slower than replication – i.e. it takes time for newly replicated DNA to become methylated Methylation tells the cell: – The DNA IS newly synthesized – Which strand is the newly synthesized one? The one that’s NOT methylated. – Which strand is the old one - the one that is methylated. Old Strand New Strand Hemi-methylated Fully Methylated The hemi-methylated DNA will eventually be converted to the fully methylated state. Replication Initiation is Tightly Controlled 1. Control of DnaA-ATP levels The rate-limiting step in initiation is the binding of DnaA-ATP to OriC. The concentration of DnaA-ATP is tightly controlled 1. The amount of DnaA is proportional to cell mass – small (new) cells do not have enough to initiate replication. 2. As the replication fork passes, DnaA-ATP is converted to DnaA-ADP and it dissociates from its DNA binding sites. 3. DnaA-ADP doesn’t work as an initiator and is very slowly converted to DnaA-ATP. This is one of the ways a new round of initiation is blocked until the time is right.  Replication Initiation is Tightly Controlled 2. Control of access to oriC There are 11 GATC sites of methylation in OriC 1. DnaA-ATP binds fully methylated DNA. 2. The protein SeqA binds hemimethylated OriC preventing DnaA binding and slowing Dam methylation. 3. OriC is inactive until fully methylated. SeqA Binds to Hemi-methylated OriC to Prevent Re-initiation Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education Dam Competes with SeqA for Binding and Eventually Fully Methylates the DNA Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education  Termination of Replication Termination of replication is less well understood than initiation and elongation. Replication ends when the two replisomes “collide” Completing DNA synthesis is straightforward, but who unloads the Figs from Watson et al. helicase?? We don’t know! Molecular Biology of the Gene, © 2014, Pearson Education  Topoisomerases are Required for A type II topoisomerase is required to relieve positive Replication supercoils in front of the replication fork. Gyrase does this job in E. coli. Replication can lead A catenane to catenated DNA A type II topoisomerase is molecules. required for decatenation. TopoIV does this job in E. The Topo is said to coli. “resolve” the catenane.  Vcast 26 DNA Replication MCB 250 in Eukaryotes Dr. James M. Slauch Dept of Microbiology  Eukaryotic Chromosomes have Multiple Origins The replisome of eukaryotes is functionally equivalent to that of E. coli. The replisome moves more slowly in eukaryotes (30-50 nucleotides/sec) – probably due to chromatin structure. Humans have 1000x more DNA than E. coli. To get it replicated, replication is initiated simultaneously at multiple origins on each chromosome. Origins are spaced approximately 30 kb apart. A large mammalian chromosome may have thousands of origins. Not all of them will be used in a given round of replication. Eukaryotes Chromosomes have Multiple Origins  Eukaryotic DNA Replication During S phase, all of a eukaryote’s DNA must be replicated once and only once. Incomplete DNA replication leads to chromosome breaks at cell division. Over-replication can lead to extra copies of regions of chromosomes. So, just as in bacteria, replication initiation is tightly regulated.  Eukaryotic DNA Replication Less is known about eukaryotic origins, initiation, and elongation than about corresponding events in prokaryotes. There is much more known, however, than we are going to talk about. The basic principles (how the polymerase works, etc.) are clearly the same in all 3 domains of life. Remember that in order to replicate DNA, eukaryotes have the problem of disassembling all of the structures that compact the DNA into chromatin and, after replication has taken place, putting it all back together. Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education  Eukaryotic Mitotic Cell Cycle Helicases are Loaded at Ori’s Only in G1 and They are Activated Only in S Phase. Don’t worry about the details, just realize that the process is tightly regulated. Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education The End Replication Problem  Telomeres The ends of eukaryotic chromosomes are called telomeres. Telomeres contain tandem repeats of TG rich sequences. In humans the sequence TTAGGG is repeated thousands of times (total length 10 - 15 kb). This structure protects the ends of linear chromosomes from degradation and other bad things.  Telomerase Telomerase is a “reverse transcriptase” - it makes a DNA strand by copying an RNA strand. Telomerase is a ribonucleoprotein - it contains an RNA. This RNA is used as a template for DNA replication. As with all DNA polymerases, telomerase adds dNTPs to the 3’ end of a primer but it’s template is RNA, not DNA. Telomerase  Telomerase Compensates for the Problem, it does Not Solve the Problem  Telomerase In higher eukaryotes most cells do not express levels of telomerase sufficient to repair telomeres so only a limited number of replication/cell division cycles can occur: senescence. Is this the secret of aging? Germ cells and stem cells express telomerase and do not senesce. Cancer cells divide rapidly and most have acquired mutations that allow expression of telomerase. Telomerase is a potential target for anticancer drugs.  Vcast 27 RNA Structure MCB 250 Dr. James M. Slauch Dept of Microbiology  The Central Dogma Transcription Translation Replication DNA RNA Protein Reverse Transcription  RNA vs. DNA RNA contains ribose instead of 2’- deoxyribose. RNA contains uracil instead of thymine. Base pairing in DNA is frequently intermolecular but in RNA it is frequently intramolecular. Pentose Sugars in RNA and DNA Ribose 2-Deoxyribose  Pyrimidines Cytosine Uracil Thymine (DNA and RNA) (RNA) (DNA) G-C and A-U C not A-T U T H G Base Pairing A in DNA RNA  Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education Base OH OH OH HO-P-O-P-O-P-O-CH2 O O O O H H H H OH OH A ribonucleoside triphosphate, NTP  RNA has Secondary and Tertiary Structure The same forces that are important for DNA structure are involved in RNA structure. Base Pairing Base Stacking Hydrophobic Interactions of Bases Repulsion of Negatively Charged Phosphate Groups – cations required  Base pairing generates RNA secondary structures Base pairing between near or distant regions forms stem-loop structures. – Stem-loops can have bulges and loops in otherwise base-paired regions. – Some loop structures are particularly stable - tetraloops, for example. RNA-RNA duplexes adopt a structure very similar to the A-form DNA-DNA duplex. A-form duplexes are more compact than B-form duplexes (more bp’s/helical turn). Non Watson-Crick base pairs can form.  “Special” interactions stabilize certain loops Base – phosphate H-bond H-bonds between sugar -OH and bases G-U base pairing and other “non-canonical” base pairs Stacking interactions, sometimes extrahelical  An RNA Pseudoknot Base pairing interactions with distant regions can generate complex folded structures. Note: loop in one stem-loop is a stem in another stem-loop. Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education  Non-Watson/Crick base pairs are found in some RNA structures. Fig 6-24  Non-Watson/Crick base pairs are found in some RNA structures. Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education The Structure of tRNA  The Structure of 16s rRNA 1542 nucleotides Structure can be 5’ more important than sequence. Double helix in stem 3’ regions is similar in structure to A-DNA The Structure of 16s rRNA  Denaturation of RNA The RNA secondary structure is held together by weak non-covalent interactions The structure will “denature” if these interactions are disrupted or overcome – High Temperature – Hydrogen bonding reagents – Urea – Increase in hydrophobicity – Methanol – Decreased salt concentration High pH? – Alkaline hydrolysis  The 2’ Hydroxyl Makes RNA Susceptible to Alkaline Hydrolysis H H OPO O H H OPO O In contrast, DNA is stable (but denatured) at high pH. For DNA the strands separate at high pH but the backbone remains intact.  Three Major Types of RNA Messenger RNA – mRNA – Template for protein synthesis – Unstable – Average half life ≈ 3 minutes (E. coli) Transfer RNA – tRNA – Adapter between mRNA and amino acids – Stable Ribosomal RNA – rRNA – The heart of the ribosomes that synthesize protein – 5S, 16S, and 23S (Bacteria) – Stable  Other RNAs in the Cell Regulatory RNAs – Small RNAs can be important for regulation often by annealing to mRNAs Catalytic RNAs – Ribozymes – RNAs can carry out enzymatic reactions – Usually affect other RNAs – The “RNA world” hypothesis Bacterial Molecular Biology DNA DNA Replication mRNA  What is a Gene? Factors that control traits or confer phenotypes DNA The fundamental unit of inheritance A segment of DNA composed of a transcribed tRNA rRNA mRNA region and the regulatory sequences that make transcription possible Protein  Transcription In bacteria, all RNA is synthesized by RNA Polymerase. Transcription can be divided into a series of discreet steps. – Binding of RNA Polymerase – Open Complex Formation – Initiation – Promoter Clearance – Elongation – Termination and RNA Release  RNA Polymerase Holoenzyme Transcription Termination Signal Sigma -35 -10 Start Site Binding – Closed Complex Open Complex Formation  Initiation 5’ Core Promoter Clearance Sigma Elongation Termination RNA  Convention and Nomenclature +1 Start site of transcription Non-template Strand 5’ 3’ 3’ 5’ Template Strand 5’ RNA P-P-P- -10 +1 Non-template Strand 5’ CCGGCTCGTATAATAGACAGAATTGATGCGTA 5’ AAUUGAUGCGUA The sequence of the transcript is identical to RNA that of the non-template (or coding) strand (except U instead of T).  E. coli DNA Dependent RNA Polymerase Holoenzyme – a2bb’ws Core Polymerase – a2bb’w – Capable of performing the enzymatic function – Interacts with a series of auxiliary proteins that provide regulation that can occur at all steps of transcription The s Subunit – Required for recognition of the “promoter” – There are 7 different s’s in E. coli that allow for recognition of different promoter sequences. See text, Table 15-2. – s70 is the “housekeeping” s - most of the transcripts in E. coli are made by s70 polymerases.  RNA polymerase b 150 kD b’ 155 kD – (2 of the largest proteins in E. coli) a 37 kD w10 kD (involved in assembly, not required for activity) s70 70kD. Other s’s have different M.W.’s.  Figs from Watson et al. RNA polymerase b (blue) Molecular Biology of the Gene, © 2014, Pearson Education core enzyme a2bb’w a (green) Active site Mg2+ b’ (purple) a (yellow) w (red) Structure of Bacterial RNA Polymerase  Non-template strand Transcription bubble (about 17 bps) is entirely within the protein. RNA-DNA hybrid region is 8 bps.  The chemistry of RNA synthesis is very similar to that of DNA synthesis. Fig 15-3  Analogous to DNA Polymerase, the active site closes on the appropriately positioned NTP. This includes a hydrogen bond to the 2’ hydroxyl group.  Non-template strand Transcription bubble (about 17 bps) is entirely within the protein. RNA-DNA hybrid region is 8 bps.  RNA Polymerase Holoenzyme Transcription Termination Signal Sigma -35 -10 Start Site Binding – Closed Complex Open Complex Formation  The Promoter The promoter is the site in DNA where RNA polymerase binds. We define “the promoter” as the entire region on the DNA required for appropriately regulated transcription initiation. This includes all binding sites for regulatory proteins. The s Subunit Recognizes and Binds to the Promoter Start site -35 17+/- 2 -10 +1 Consensus TTGACA TATAAT Comparison of a large number of promoter regions yields a “consensus sequence” for recognition by the main s factor (s70). Note that these sequences are on one “face” of the helix. Sigma 70 Binds the -10 -35  Promoter Strength How often RNA polymerase binds and initiates transcription is dependent on “promoter strength” – Strong promoters match consensus Frequent initiation = lots of gene product – Weak promoters do not match consensus Infrequent initiation = low levels of product Conserved Sequences in s70 Promoters Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education  Other Factors Affect Promoter Binding Alpha subunit – Can recognize a sequence called the “UP” element – Auxiliary regulatory proteins can bind DNA and Alpha Sigma factor – Different Sigmas recognize different promoter sequences Auxiliary proteins can help RNA polymerase to bind Sigma 70 Binds the -10 -35 The C-terminal domain of alpha binds Figs from Watson et al. the UP element (if there is one). Molecular Biology of the Gene, © 2014, Pearson Education Auxiliary Proteins Can Help or Hinder RNA polymerase binding to the promoter  The Promoter Some define “the promoter” as the –10 –35 sequence and the start site Some (and we prefer to) define “the promoter” as all of the region on the DNA required for appropriately regulated transcription initiation – This includes all binding sites for regulatory proteins  Initiation of Transcription Promoter sequence is recognized by s and is bound by the holoenzyme – Closed complex DNA around the promoter is unwound – Open complex Approximately 10 nucleotides are polymerized – Polymerase can “stutter” giving abortive transcripts Then a transition takes place – promoter clearance  Transition to Open Complex Although Sigma originally binds double stranded DNA, its ability to “flip out” and bind bases in the -10 facilitates melting of Figs from Watson et al. the promoter region. Molecular Biology of the Gene, © 2014, Pearson Education  Abortive Transcripts and Scrunching Abortive transcripts are associated with an apparent compression of the DNA. Eventually, the built up energy allows for “promoter clearance”. Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education  Elongation RNA Polymerase undergoes another conformational change as it exits the promoter and enters the “elongation phase” s dissociates Other proteins load onto the polymerase – Additional proteins increase processivity (block pausing), increase accuracy, and/or aid in termination (for example NusA). The RNA is synthesized as the complex proceeds along the DNA Average rate of transcription 50 - 100 nucleotides/sec but polymerization is interrupted by pauses  RNA Polymerase Core Holoenzyme  RNA Polymerase X Polymerase has editing functions. Upon incorporation of a mismatched nucleotide, the polymerase can “reverse translocate” or backup, cleave the phosphate bond, and try again.  Initiation 5’ Core Promoter Clearance Sigma Elongation Termination RNA  Transcription Termination Rho-independent or Intrinsic – Hairpin structure in RNA is recognized by RNA polymerase – Transcription stops and RNA is released Rho-dependent – Rho is a protein that can attach to RNA and cause the polymerase to stop transcription and dissociate. – About 1/2 of the terminators in E. coli are rho dependent. – Rho can also cause transcription termination if ribosomes stall on the message. If ribosomes lag, then Rho binds RNA and causes transcription termination at next pause site. – Rho is a helicase that acts on RNA-DNA hybrid molecules.  Intrinsic Terminator DNA RNA Terminator Hairpin Structure is more Important than sequence (except for the run of U bases) Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education  Intrinsic Transcriptional Termination Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education Why Does an RNA Hairpin Followed by a Run of U’s Cause Termination? Both elements (G/C rich inverted repeat and run of Us) are needed and they must be adjacent. RNA-RNA interaction in hairpin competes with RNA- DNA binding in the active site causing a pause. Run of U’s gives an unstable RNA-DNA hybrid (A-U is the weakest base pair) UUUUUUUU AAAAAAAA So the pause gives the instability built into the region of A-U pairs the time it needs in order to dissociate  Transcription Termination Rho-independent or Intrinsic – Hairpin structure in RNA is recognized by RNA polymerase – Transcription stops and RNA is released Rho-dependent – Rho is a protein that can attach to RNA and cause the polymerase to stop transcription and dissociate. – About 1/2 of the terminators in E. coli are rho dependent. – Rho can also cause transcription termination if ribosomes stall on the message. If ribosomes lag, then Rho binds RNA and causes transcription termination at next pause site. – Rho is a helicase that acts on RNA-DNA hybrid molecules.  mRNA Encodes Protein Transcription Start Transcription Stop Translation Translation P +1 rbs Start Stop T DNA Transcription rbs START STOP T mRNA Translation Protein Protein Folding rbs = ribosome binding site Bacterial Molecular Biology Replication mRNA Transcription and Translation are Coupled The ribosomes are chasing the polymerase. Indeed there is evidence that the ribosome “pushes” the polymerase. Transcription and Translation are Coupled Initiation site on DNA mRNA 1 mRNA 2 mRNA 3 mRNA 4 Note that the messages are covered with ribosomes. There’s little exposed RNA. Transcription and Translation are Coupled RNAP DNA Ribosomes A G U Naked RNA RNA Nascent Proteins  Rho binds to exposed ss RNA, i.e., RNA with no ribosomes or no stable secondary structure, a rut site (70-80 nucleotides, C- rich). Rho’s ATPase activity allows it to move along ssRNA in a 5’®3’ direction. Its RNA- DNA helicase activity allows it to separate RNA-DNA duplexes.  mRNA in Bacteria Can Be Polycistronic An Operon  Polarity A nonsense (polypeptide chain terminating) mutation in a gene stops translation. Rho will bind to the “naked” (not covered with ribosomes) RNA and terminate transcription. Therefore, if the gene with the mutation is in an operon, the gene(s) downstream from it is/are never transcribed. The mutation is said to be “polar” on the downstream gene(s). Translational Stop Mutations Can be Polar lacZ lacY lacA RNAP Normally transcribed through lacA. But what if there is an early stop codon (mutation) in lacZ? lacZ lacY lacA X Rho terminates transcription – lacY and lacA are never even transcribed. Therefore, the lacZ mutation is “polar” on the downstream genes. X Naked RNA Transcription of the E. coli Chromosome leu lacZYA lacI rrnE thr azi rrnB rrnH rrnA lac rrnC gal xyl rrnD +1 aroL trp arg +1 proC ser rrnG P 5’ his 5’ -35 -10 +1 ade -10 +1 -35 5’ Encodes ~4500 Proteins 5’ P Can be Encoded on Either Strand  Three Types of RNA The Machinery of Translation Messenger RNA – mRNA – Template for Protein Synthesis – Unstable – Half life of 3 minutes (E. coli) Transfer RNA – tRNA – Adapter between mRNA and amino acids – Stable Ribosomal RNA – rRNA – The heart of the ribosomes that synthesizes protein – 5s, 16s, and 23s (Bacteria) – 5.8s, 18s, and 28s (Eukaryotes) – Stable  What is a Gene? DNA Factors that control traits or confer phenotypes The fundamental unit of inheritance tRNA rRNA mRNA A segment of DNA composed of a transcribed region and the regulatory sequences that make transcription possible Protein  Ribosomal RNA Transcripts are Processed E. coli has 7 rRNA loci at various positions on the chromosome The Structure 16s rRNA 1542 Nucleotides  The Structure 23s rRNA 2904 Nucleotides  The Structure 5s rRNA 120 Nucleotides  What is a Gene? DNA Factors that control traits or confer phenotypes The fundamental unit of inheritance tRNA rRNA mRNA A segment of DNA composed of a transcribed region and the regulatory sequences that make transcription possible Protein  Antitermination rRNA operons are not translated Rho should terminate transcription This is actively prevented by auxiliary proteins that interact with RNA Polymerase such that it no longer pauses and does not terminate until it reaches an intrinsic or Rho-independent terminator Antitermination was discovered and is best understood in bacteriophage Lambda  Antitermination Sites in the RNA are recognized by various auxiliary proteins that interact with RNA Polymerase to create a complex that is NOT subject to Rho-mediated Termination and ignores all but the strongest intrinsic terminators. It now travels at 100 nt/sec – reduced pausing.  rRNA in Eukaryotes Transcription in eukaryotes is more complicated and we will talk about it There are multiple types of RNA Polymerase rRNA operons are transcribed by their own polymerase: Pol I Pol I transcripts are NOT capped, spliced or polyadenylated (all of which we will talk about).  rRNA is made by Pol I in the Nucleolus rRNA genes are arranged as tandem repeats. In humans, there are approximately 400 rRNA genes in 5 clusters (on different chromosomes). Localized transcription and processing take place in the nucleolus.  Eukaryotic Transcription Eukaryotes have 3 RNA Polymerases with specialized functions: – Pol I transcribes rRNA genes – Pol II makes mRNA from genes that code for proteins – Pol III transcribes tRNA genes and some other small RNAs Eukaryotic mRNAs are monocistronic – no operons. Transcription and translation are spatially and temporally separate in eukaryotes. mRNA is capped and polyadenylated. Splicing of a pre-mRNA is frequently required to obtain a mature mRNA. Eukaryotic RNA Polymerases Polymerase I (Pol I) – 13 Protein subunits 10-190 kD – Transcribes rRNA operons Polymerase II (Pol II) – 12 Protein subunits 10-220 kD – Transcribes mRNAs Polymerase III (Pol III) – 14 Protein subunits 10-160 kD – Transcribes tRNAs and other small stable RNAs 5 of the small subunits are common to all 3  Conserved Subunits of RNA Polymerases Learn the subunit structure of the bacterial enzyme but NOT the others. There are many more proteins in the eukaryotic enzymes but the overall structure and the basic chemical mechanism are the same as the prokaryotic enzyme.  PolII has a C-terminal Tail (CTD) The large subunit of PolII has a C-terminal domain (the tail) made up of a large number (≈ 25-50, depending on the species) of 7 amino acid repeats (heptad repeats). PolI and PolIII don’t have a CTD. The repeated sequence is: -Tyr-Ser-Pro-Thr-Ser-Pro-Ser-. The Ser, Thr, and Tyr residues can be phosphorylated and the phosphorylation state of the CTD provides signals that direct the binding of various proteins.  Pol II CTD May Extend a Long Distance Behind the Polymerase The CTD serves as a platform for binding proteins that do various things during transcription. Its phosphorylation state changes during the transcription process and determines which proteins bind. Meinhart, et al. Genes and Development 19:1401 (2005)  Pol II Transcription Overall events similar to those in bacteria – Promoter binding, Open complex formation, Promoter clearance, Elongation, Termination However, there are hundreds of proteins interacting at even the simplest promoters We do not understand in detail how transcription initiation works at any eukaryotic (particularly higher eukaryotic) promoter  TBP “General Transcription Factors” form the Pol II Pre-Initiation Complex TFIIH is an ATP- dependent helicase. Promoter clearance requires phosphorylation of the CTD of Pol II.  Pol II Core Promoter This is a very simple Pol II promoter. Most are much more complex.  Function of General Transcription Factors A major function of the whole complex apparatus (at least 30 different kinds of proteins) of the pre-initiation complex is to do what s does for the bacterial enzyme. It attaches the polymerase to specific sites in the DNA. Another function of some of the proteins in the pre- initiation complex is to from an open complex. The ability to do this is built into the bacterial polymerase.  Initiation in vivo The pre-intiation complex described is sufficient to allow transcription in vitro but not in vivo. Remember that in vivo the DNA is wrapped up in nucleosomes. Efficient transcription in vivo requires “remodeling” of nucleosome structures. This process is not completely understood. The mediator is a multiprotein complex that is larger than Pol II. It “mediates” between proteins bound to DNA and the pre-initiation complex. In the preceding slide, mediator is interacting with upstream activators to increase the affinity of the polymerase for the promoter.  Auxiliary Regulatory Proteins Often Function Through the Mediator Different activator Histone Tail Modifier Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education Notice three methods of activation Simple View of Transcriptional Control in Eukaryotes “Regulatory Proteins” in eukaryotes can work by a variety of mechanisms. The usually bind specific sequences (enhancers) “near” (maybe kbs away) the promoter to: Recruit proteins that move Histones to make the promoter and other binding sequences available Recruit modify Histones to make the DNA more open (10 nm) so sequences are available Bind Mediator to enhance Polymerase binding Activation of Eukaryotic Transcription often Involves Moving Histones to Make the Promoter Accessible. Don’t learn the names of these proteins now – We’ll come back to this Eukaryotic RNA Polymerases have to Transcribe through Histones Don’t learn the names of these proteins – just realize that there are proteins that help during transcription  Pol II CTD May Extend a Long Distance Behind the Polymerase The CTD serves as a platform for binding proteins that do various things during transcription. Its phosphorylation state changes during the transcription process and determines which proteins bind. Meinhart, et al. Genes and Development 19:1401 (2005) mRNA Processing in Eukaryotes Eukaryotes have Nuclei – Transcription and translation take place in separate compartments. mRNA is processed and transported to the cytoplasm – 5’ Cap – 3’ Polyadenylation – Splicing There is some variability in structures and signals for these events among eukaryotes. – We’ll concentrate on mammals unless otherwise noted Structure of the 5’ Cap of Eukaryotic mRNAs RNA triphosphatase Synthesis of the Guanylyl transferase 5’ Cap of Eukaryotic mRNAs Methyl transferase Capping Enzymes are Associated with the CTD of Pol II  5’ mRNA Capping Occurs immediately after the 5’ end is made – before transcription is completed. Functions – Important for splicing – Protection from RNases – Increased stability – Enhances efficiency of Translation – Cap Binding Protein – Required for efficient transport from the nucleus  The 3’ End of mRNA is Polyadenylated Primary mRNA Transcript  Polyadenylation Two step process – 1) Cleavage and 2) addition of poly A –Recognition Sequence 5’-------//----AAUAAA- ~20nt -(GU Rich)---- About 200 A’s are added. Can occur prior to completion of transcription – can be >500 bp from 3’ end of the transcript.  Functions of Polyadenylation Protection from RNases – Increased stability – When PolyA is finally lost – mRNA is degraded Enhances Translation – PAB (Poly A Binding Protein) Splicing of Eukaryotic Transcripts  Splicing of Eukaryotic Transcripts Many eukaryotic RNAs have introns that must be removed – Pre-mRNA 0- ~60 introns Introns frequently comprise most of the transcript – may be much more than the exons. Examples: – Collagen – primary transcript = 25 kb; mRNA=2.1 kb – Dystrophin – primary transcript = 2400 kb; mRNA=14 kb “Alternative Splicing” – 1 gene can code for many proteins Consensus Sequences for Splice Sites pyrimidine tract Note: Most of the sequences required for splicing are in the intron not the exon. The consensus sequences shown are for humans. The Splicing Reaction Structure of the Excised Intron –note “3-way junction” This is the “lariat” from the previous slide.  The Spliceosome Splicing is catalyzed by a large protein-RNA complex – the spliceosome (~150 Proteins; 5 RNAs). snRNAs (small nuclear RNAs) – Small (100 – 300 nucleotides), stable, located in the nucleus – U1, U2, U3, U4, U5, and U6 snRNPs (small nuclear ribonuclear proteins, “snurps”). Protein complexes containing the snRNAs. The RNAs are the catalytically active components. snRNPS assemble on the primary transcript as transcription proceeds. The Spliceosome Active Site Base pairing interactions between the RNAs in the snRNPs serve to position the splice sites and to catalyze the splicing reactions. A lot is known about the details of these processes. You should know what U1-U6 are but you don’t need to know what the individual snRNPs do.  Some Introns in Lower Eukaryotes are “Self-Splicing” Class I Introns in Tetrahymena (freshwater protozoa) Class II Introns in Fungi No proteins involved Class II Intron Resembles Spliceosome The CTD Coordinates Processing During Transcription  A set of bound proteins marks the RNA as ready for transport Fully Processed mRNA is Specifically Transported to the Cytoplasm For more detail, see text Fig. 16-22 Alternative splicing greatly increases the number of different proteins that can be produced. 4 Basic Types of Alternative Splicing Alternative 5’ splice site Alternative 3’ splice site Exon skipping or inclusion - Intron inclusion Nilsen & Graveley, Nature 463:457 (2010)  Alternative Splicing can be Regulated Splicing silencers or splicing activators can bind to pre-mRNAs turning some potential splice sites off and others on. This can result in tissue specific splicing. One of the alternative messages might be made in liver cells and a different one in nerve cells.  Higher Organisms have more Introns. More introns means more opportunities for alternative splicing. Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education  The Central Dogma Transcription Translation Replication DNA RNA Protein Reverse Transcription  fM Translation et -a a- aa -a a- aa aa -aa aa tRNA-Amino Acid (aa) Complex GA UAG G CCC AAC UUC GCU AUC GGG UUG AAG CUC 5’ E P A Ribosome Movement DNA Components of the Translation Apparatus Ribosomes mRNA tRNA Aminoacyl tRNA synthetases Initiation, elongation, and termination factors  The Ribosome Bacterial Ribosome Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education  Bacterial Ribosomes 30S Subunit (Small subunit) – 16S rRNA – 21 Ribosomal Proteins S1, S2, S3…….S21 50S Subunit (Large subunit) – 23S and 5S rRNAs – 34 Proteins L1, L2, L3……L34 30S + 50S = 70S  The 30s Subunit is Essentially the 16s rRNA 30s Subunit with Proteins 16s rRNA 3D Structure The Ribosome has 3 Binding Sites for tRNAs A = aminoacyl-tRNA site, P = peptidyl-tRNA site, E = exiting tRNA site The Polypeptide Exit Tunnel Peptidyl transferase center (in color) The small subunit is not shown and the large subunit is cut in half. Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education  fM Translation et -a a- aa -a a- aa aa -aa aa tRNA-Amino Acid (aa) Complex GA UAG G CCC AAC UUC GCU AUC GGG UUG AAG CUC 5’ E P A Ribosome Movement DNA 3’ 5’ tRNAs are adapters between the mRNA codons and the 3’ 5’ amino acids. The Structure of tRNA ~76 Nucleotides  tRNAs tRNAs are small (75 – 95 nucleotides), stable RNAs There is considerable variability in both length and sequence. Some positions are invariant. The 3-D structure is conserved. tRNAs contain a number of modified bases. tRNA Structure Amino acid will be attached to the 3’ terminus. All tRNAs have CCA at their 3’ends. Can be 4-13 nucleotides Basepairs with Codon in mRNA tRNA Contains Modified Bases A 3’ C C 5’ tRNAPhe from Yeast -Invariant Bases are Circled -Modifications are indicated tRNAs Contains Modified Bases U Y D Two modified U’s found in tRNA. There are many other modified bases (over 100 known). Modifications are introduced after the RNA is transcribed (post-transcriptionally). Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education tRNAs Fold Into a Conserved Structure Non-conventional Base Pairing Gives Tertiary Structure The Anticodon is Positioned to Basepair with Codon Codon-Anticodon Interaction The Amino Acid is Attached to the 3’ Terminal A Amino Acid will be attached Aminoacyl-tRNA synthetases “charge” tRNAs with amino acids. An aminoacyl adenylylate is an intermediate. Attachment of the amino Figs from Watson et al. acid to AMP “activates” it for reaction with another amino acid to form Molecular Biology of the Gene, © 2014, Pearson Education a peptide bond. The aminoacyl adenylylate is transferred to 3’ -OH of a Figs from Watson et al. tRNA. The linkage to the tRNA is a reactive, high-energy Molecular Biology of the Gene, © 2014, Pearson Education bond.  The Genetic Code The genetic code relates the sequence of bases in mRNA to the sequence of amino acids in proteins. Problem: There are 20 amino acids but only 4 bases. So how do you specify 20 amino acids with 4 bases? – 1 nucleotide / amino acid can code for 4 amino acids. – 2 nucleotides / amino acid can code for 42 = 16 amino acids. – 3 nucleotides / amino acid can code for 43 = 64 amino acids. – So there must be at least 3 nucleotides / codon. The code is a triplet code: a 3 base codon specifies each amino acid.  The code is degenerate - most amino acids are specified by more than 1 codon. Degeneracy Color 2x Gray 3x Green 4x Yellow 6x Blue Trp and Met are each specified by only one codon. The termination codons are red. Agris, et al., 2006. J. Mol. Biol. 366:1-13.  Second Position The Genetic Code First Position 5’ Third Position 3’ The code is highly evolved Single base changes often result in conservative changes The Code is Highly Evolved Consider a Mutation The theoretically Wild type AUA = Ile possible codes Possible Mutations at Position 1 CUA = Leu UUA = Leu GUA = Val The code has evolved so that the most common mutations have the least effect on the protein  Phil Leder (1934-2020) With Nirenberg at the NIH, elucidated the triplet nature of the genetic code and helped to fully decipher the codons Chairman of the Genetics Dept at Harvard Medical School Created the “OncoMouse”  The Reading Frame THECATATETHEFATRAT… Gene THE CAT ATE THE FAT RAT… Frame 1 T HEC ATA TET HEF ATR AT … Frame 2 TH ECA TAT ETH EFA TRA T … Frame 3 DNA has Six Potential Reading Frames mRNA is “read out” in 3 nucleotide units – codons. Each codon specifies either a particular amino acid or a translational stop. There are 3 possible reading frames in every message. Only one of them makes “sense”. The reading frame is set by the translation initiation process.  Wobble There are 61 codons for amino acids There are 20 amino acids There are only 46 structurally distinct tRNAs in E. coli – 86 tRNA genes – some are identical Therefore, the same tRNA can recognize multiple codons for the same amino acid The 1st and 2nd bases of the codon form strict Watson-Crick basepairs with tRNA The 3rd base in the codon can “wobble” Modified Bases in tRNAs Include Inosine in the Wobble Position Inosine Adenosine  Anticodon Codon (first base) (third base) Wobble Base Pairs I-C Wobble Basepair Anticodon Codon (first base) (third base) I-U Wobble Basepair I-A Wobble Basepair  tRNAs Recognize Multiple Codons AGA and AGG = Arg GGX = Gly Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education  Wobble Helps Explain the Arrangement of the Genetic Code Every tRNA reads either 1, 2, or 3 1st 3rd Position codons Position Codon Anticodon 5’ base of anticodon (wobble base) I A U C – A or C - One codon read U A G – U or G - Two codons read G U C A U –I - Three codons read C G Why do the single codons AUG (Met) and UUG (Trp) end in “G”?  The Genetic Code is Universal (almost) The same code is used in all organisms with a few exceptions. – In mitochondria, UGA specifies Trp not termination. – Selenocysteine can be inserted at certain UGA codons (depending on mRNA context) in most organisms (including humans). A few proteins require selenocysteine to function. – Sometimes certain mRNA sequences will cause shifts in the reading frame during translation. – Occasionally termination codons will be “read-through” producing a longer protein. These are more recent evolutionary changes  Summary-The Genetic Code is: Read 5’ to 3’. Non-overlapping and read in a fixed reading frame, set at translation initiation. Buffered - many single base changes in a codon will code for the same or a structurally related amino acid. Degenerate - most amino acids are specified by more than one codon. Read by tRNA according to Watson-Crick base pairing rules + wobble in the 3rd codon position. Universal (almost) - codons mean the same things in all organisms. There are, however, some exceptions.  Translation Initiation – Ribosome Binding Site (sometimes called a Shine-Dalgarno sequence) base pairs with 16S rRNA of 30S subunit – Initiation codon - AUG – Initiation factors: IF-1, IF-2(GTP), IF-3 – Initiator tRNA - fMet-tRNAiMet Elongation – Elongation factors: EF-Tu(GTP), EF-Ts, EF-G(GTP) Termination – Termination or release factors: RF-1, RF-2, RF-3(GTP) – Termination (STOP) codons: UAG, UAA, UGA  mRNA Initiation Codon S.D. or RBS 5’…AUUCCUAGGAGGUUUGACCUAUGCGAGCU…3’ UCCUCCA HO-3’AU CUAG G-UGG…5’ U-A 30s Subunit Binds at G-C G-C Appropriate Position C-G Based on 16s-Shine G-U 16s rRNA Dalgarno U-A C-G Basepairing – positions C-G AUG in the P site Am G AmGG Bacterial Translation Always Initiates with fMet The formyl group is added AFTER the Met is attached to the specific initiator tRNA (tRNAMet). i  The 30s Subunit (with 3 IF1-3) Bind the mRNA E P A IF’s at the Ribosome 1 2 GTP Binding Site (Shine- GTP Dalgarno) and Load the 3 2 1 Initiator tRNA E P A fMet fMet GTP 2 Like Fig 18-18 Met-tRNAMet 3 1 I E P A mRNA 30s Initiation Complex  fMet GTP 2 3 1 Factor E P A Binding Center 3 The 50s Subunit Binds to Form the 70s Initiation Complex fMet GTP 2 GDP 1 2 1 E P A fMet GDP 2 fMet 1 E P A GTP Hydrolysis is E P A Required to Release IF1-2 70s Initiation Complex  Translation Elongation fM aa et - aa UU C UAC AAC GCU AUC AUG UUG AAG CUC 5’ E P A Ribosome Movement  Translation Elongation fM aa et - aa UU C UAC AAC GCU AUC AUG UUG AAG CUC 5’ E P A Ribosome Movement  Translation Elongation fM et -a a- aa -a aa a- aa aa CG UU C A UAG CCC AAC GCU AUC GGG UUG AAG CUC 5’ E P A Ribosome Movement  Translation Elongation fM et -a a- aa -a a- aa aa -aa CG UU C A UAG CCC AAC GCU AUC GGG UUG AAG CUC 5’ E P A Ribosome Movement  Peptidyl Transferase Reaction The amino group of the incoming aminoacyl-tRNA attacks the acyl carbon of the peptidyl-tRNA transferring the growing peptide chain to a new tRNA. Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education Peptide Bond Synthesis is Catalyzed by the 23S RNA not by a protein enzyme – the Ribosome is a Ribozyme! The 50S subunit. 3’ end of P-site tRNA is red, 3’ end of A site tRNA is green. There is no protein (purple) near, only RNA (gray).  Translation Elongation fM et -a a- aa -a aa a- aa aa CG UU C A UAG CCC AAC GCU AUC GGG UUG AAG CUC 5’ E P A Ribosome Movement  Translation Elongation fM et -a a- aa -a a- aa aa - aa CG UU C A UAG CCC AAC GCU AUC GGG UUG AAG CUC 5’ E P A Ribosome Movement  Translation Elongation fM et -a a- aa -a a- aa aa - aa UU U AG C CCC AAC GCU AUC GGG UUG AAG CUC 5’ E P A Ribosome Movement  Translation Elongation fM et -a a- aa -a a- aa aa - aa aa GA U AG G CCC AAC UUC GCU AUC GGG UUG AAG CUC 5’ E P A Ribosome Movement  Translation Elongation fM et -a a- aa -a a- aa -a aa a- aa GA U AG G CCC AAC UUC GCU AUC GGG UUG AAG CUC 5’ E P A Ribosome Movement Elongation Amino Acyl- tRNA EF-Tu brings the charged tRNA to Factors the ribosome EF-Tu GTP GTP GDP Ef-Ts EF-Ts GTP E P A Is the GTP Exchange Factor GDP GDP GTP E P A E P A E P A Like Fig 18-22  Translation Elongation fM et -a a- aa -a a- aa aa - aa aa GA U AG G CCC AAC UUC GCU AUC GGG UUG AAG CUC 5’ E P A Ribosome Movement  Translation Elongation fM et -a a- aa -a a- aa -a aa a- aa GA U AG G CCC AAC UUC GCU AUC GGG UUG AAG CUC 5’ E P A Ribosome Movement Elongation Amino Acyl- tRNA EF-Tu brings the charged tRNA to Factors the ribosome EF-Tu GTP GTP GDP Ef-Ts EF-Ts GTP E P A Is the GTP Exchange Factor GDP GDP GTP E P A E P A E P A Fidelity of the Ribosome The ribosome mis-incorporates an amino acid 1 in 103-4 The ribosome checks ONLY the codon-anticodon basepairing How is fidelity maintained? Three proposed mechanisms (all of which might be true): 1. Hydrogen bonds in the minor groove of the codon-anticodon with the 16s RNA Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education  Fidelity of the Ribosome Factor Binding Center Not Contacted 2. EF-Tu must fit into the “Factor Binding Center” to induce GTP hydrolysis and release of the tRNA No GTP Hydrolysis Release Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education Ribosome Fidelity 3. “Accommodation”; The Amino-acyl-tRNA must pivot into the active site, straining the codon- anticodon pairing. Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education  Translation Elongation Translocation Requires EF-G and GTP Figs from Watson et al. Molecular Biology of the Gene, © 2014, Pearson Education EF-G Mimics EF-Tu-tRNA Protein  Release Factors are proteins that look and act like tRNAs. They bind Translation to STOP codons. Termination – RF-1 UAA and UAG – RF-2 UAA and UGA – RF-3 GTPase that removes RF-1 and RF-2 from the ribosome RF-2 tRNA tRNA-EF-Tu Protein Complex Translation Termination  Translation Termination RF-1 or RF-2 recognize the stop codon and cause hydrolysis of the peptide from the peptidyl-tRNA A series of steps involving RF-3, EF-G, etc lead to dissociation of the small and large subunits and release of the mRNA IF-3 binds the small subunit Ready to initiate on another mRNA 3 E P A Energy Requirements for Translation 1 ATP to charge a tRNA – But it goes to AMP, so it takes 2 ATP energy equivalents to get it back to ATP 1 GTP for EF-Tu to deli