DNA Forensics PDF

SP EC I A L TOPIC S IN MOD ERN G EN E T IC S 5 DNA Forensics F orensic science (or forensics) uses technological and minisate...

SP EC I A L TOPIC S IN MOD ERN G EN E T IC S 5 DNA Forensics F orensic science (or forensics) uses technological and minisatellites, or variable number tandem repeats scientific approaches to answer questions about the (VNTRs). As described earlier in the text (see Chapter 11), facts of criminal or civil cases. Prior to 1986, foren- VNTRs are located in noncoding regions of the genome and are sic scientists had a limited array of tools with which to link made up of DNA sequences of between 15 and 100 base pairs evidence to specific individuals or suspects. These included (bp) long, with each unit repeated a number of times. The num- some reliable methods such as blood typing and fingerprint ber of repeats found at each VNTR locus varies from person to analysis, but also many unreliable methods such as bite person, and hence VNTRs can be from 1 to 20 kilobases (kb) in mark comparisons and hair microscopy. length, depending on the person. For example, the VNTR Since the first forensic use of DNA profiling in 1986 5′@GACTGCCTGCTAAGATGACTGCCTGCTAAGAT (Box 1), DNA forensics (also called forensic DNA finger- GACTGCCTGCTAAGAT@3′ printing or DNA typing) has become an important method for police to identify sources of biological materials. DNA is composed of three tandem repeats of a 16-nucleotide profiles can now be obtained from saliva left on cigarette sequence (highlighted in bold). butts or postage stamps, pet hairs found at crime scenes, or VNTRs are useful for DNA profiling because there are SPECIAL TOPICS 5 bloodspots the size of pinheads. Even biological samples that as many as 30 different possible alleles (repeat lengths) at are degraded by fire or time are yielding DNA profiles that any VNTR in a population. This creates a large number of help the legal system determine identity, innocence, or guilt. possible genotypes. For example, if one examined four dif- Investigators now scan large databases of stored DNA profiles ferent VNTR loci within a population, and each locus had in order to match profiles generated from crime scene evi- 20 possible alleles, there would be approximately 2 billion dence. DNA profiling has proven the innocence of people who possible genotypes in this four-locus profile. were convicted of serious crimes and even sentenced to death. To create a VNTR profile (also known as a DNA finger- profilingOF Forensic scientists have used DNA CREATION toUNTR PROFILE identify print), scientists extract DNA from a tissue sample and digest vic- restriction 1that Extract Dna fromtissue sample with digest enzyme tims of mass disasters such as the Asian Tsunami on cleaves ofof side either 2004 river and region it with a restriction enzyme that cleaves on either side of the a southern separate the September 11, 2001, terrorist attacks the in Dna digested New using York. gel They and electrophoresis VNTR subject repeat region (Figure ST 5.1). The digested DNA is to Blot anamic have also used forensic DNA analysis aExpose toget From to a identify membrane and mbridized endangered witha separated prone by gel electrophoresis and subjected to Southern blot radioactive the a illegalmembrane ttrade. xay im torallele and m easurethe band pattern analysis species and animals trafficked in the larger wildlife untie repeat remain near thetop o the f get (which is described in detail in Chapter 17). Briefly, The applications of DNA profiling vivir extend smaller migratemore thru r apidly theae separated DNA is transferred from the gel to a beyond forensic investigations. These include membrane and hybridized with a radioactive paternity and family relationship testing, iden- ”Even biological probe that recognizes DNA sequences within tification of plant materials, verification of samples degraded the VNTR region. After exposing the membrane military casualties, and evolutionary studies. by fire or time to X-ray film, the pattern of bands is measured, In this Special Topics chapter, we will are yielding DNA with larger VNTR repeat alleles remaining near explore how DNA profiling works and how the top of the gel and smaller VNTRs, which the results of profiles are interpreted. We profiles that help migrate more rapidly through the gel, being will learn about DNA databases, the potential determine identity, closer to the bottom. The pattern of bands is the problems associated with DNA profiling, and innocence, or guilt.“ same for a given individual, no matter what tis- the future of this powerful technology. sue is used as the source of the DNA. If enough VNTRs are analyzed, each person’s DNA profile will be unique (except, of course, for identical twins) because ST 5.1 DNA Profiling Methods of the huge number of possible VNTRs and alleles. In practice, scientists analyze about five or six loci to create a DNA profile. VNTR-Based DNA Fingerprinting A significant limitation of VNTR profiling is that it The era of DNA-based human identification began in 1985, requires a relatively large sample of DNA (10,000 cells or with Dr. Alec Jeffreys’s publication on DNA loci known as about 50 mg of DNA)—more than is usually found at a typical 491 M05A_KLUG8414_10_SE_ST05.indd 491 16/11/2018 21:42  492 5 SPECIAL TOPIC: DNA FORENSICS BOX 1 The Pitchfork Case: The First in order to identify the second killer, the samples, one did not. Colin Pitchfork, Criminal Conviction Using DNA police asked Dr. Alec Jeffreys of the Uni- a bakery worker, paid a friend to give a Profiling versity of Leicester to analyze the crime blood sample in his place, using forged I scene evidence using a new method of identity documents. Their plan was DNA analysis called VNTR profiling. detected when their conversation was n the mid-1980s, the bodies of Dr. Jeffreys’s VNTR analysis revealed a overheard at a local pub. The conversa- two schoolgirls, Lynda Mann and match between the DNA profiles from tion was reported to police, who then Dawn Ashworth, were found in semen samples obtained from both arrested Pitchfork, obtained his blood Leicestershire, England. Both girls had crime scenes, suggesting that the same sample, and sent it for analysis. His been raped, strangled, and their bodies person was responsible for both rapes. DNA profile matched the profiles from left in the bushes. In the absence of use- However, neither of the DNA profiles the semen samples left at both crime ful clues, the police questioned a local matched those from a blood sample scenes. Pitchfork confessed to the mur- intellectually disabled porter named taken from Richard Buckland. Having ders, pleaded guilty, and was sentenced Richard Buckland. During interroga- eliminated their only suspect, the to life in prison. The Pitchfork Case was tion, Buckland confessed to the murder police embarked on the first mass not only the first criminal case resolved of Dawn Ashworth; however, police did DNA dragnet in history by requesting by forensic DNA profiling, but also the not know whether he was also respon- blood samples from every adult male in first case in which DNA profiling led to sible for Lynda Mann’s death. In 1986, the region. Although 4000 men offered the exoneration of an innocent person. Individual 1 Individual 2 SPECIAL TOPICS 5 VNTR-A VNTR-A Allele A5 Allele A3 Allele A2 Allele A4 VNTR-B VNTR-B Allele B2 Allele B3 Allele B1 Allele B2 DNA fingerprint B3 B2 B2 A5 A4 B1 A3 A2 Individual 1 Individual 2 F I G U R E ST 5. 1 DNA fingerprint at two VNTR loci for two by gel electrophoresis and detected as bands on a South- individuals. VNTR alleles at two loci (A and B) are shown for ern blot (bottom). The number of repeats at each locus is two different individuals. Arrows mark restriction-enzyme variable, so the overall pattern of bands is distinct for each cutting sites that flank the VNTRs. Restriction-enzyme diges- individual. The DNA fingerprint profile shows that these indi- tion produces a series of fragments that can be separated viduals share one allele (B2). crime scene. In addition, the DNA must be relatively intact Autosomal STR DNA Profiling (nondegraded). As a result, VNTR profiling has been used The development of the polymerase chain reaction (PCR) most frequently when large tissue samples are available— revolutionized DNA profiling. As described in Chapter 17, such as in paternity testing. Although VNTR profiling is still PCR is an in vitro method that uses specific primers and a used in some cases, it has mostly been replaced by more sen- heat-tolerant DNA polymerase to amplify specific regions sitive methods, as described next. of DNA. Within a few hours, this method can generate a  ST 5.1 DNA PROFILING METHODS 493 A* D3S1358 D1S1656 D2S441 D10S1248 D13S317 Penta E D16S539 D18S51 D2S1338 CSF1P0 Penta D TH01 vWA D21S11 D7S820 D5S818 TPOX DYS391 D8S1179 D12S391 D19S433 FGA D22S1045 100 200 300 400 500 FIGURE ST 5.2 Relative size ranges and fluorescent dye labeling colors of 24 STR products generated by a commercially available DNA profiling kit. The scale at the bottom of the diagram indicates DNA fragment sizes in base pairs. millionfold increase in the quantity of DNA within a specific material similar to that used in slab gel electrophoresis. The sequence region. Using PCR-amplified DNA samples, scien- amplified DNA sample is loaded onto the top of the capillary tists are able to generate DNA profiles from trace samples tube, and an electric current is passed through the tube. The (e.g., the bulb of single hairs or a few cells from a bloodstain) negatively charged DNA fragments migrate through the gel and from samples that are old or degraded (such as a bone toward the positive electrode, according to their sizes. Short found in a field or an ancient Egyptian mummy). fragments move more quickly through the gel, and larger The majority of human forensic DNA profiling is now ones more slowly. At the bottom of the tube, a laser detects done by amplifying and analyzing regions of the genome each fluorescent fragment as it migrates through the tube. known as microsatellites, or short tandem repeats The data are analyzed by software that calculates both the (STRs). STRs are similar to VNTRs, but the repeated motif is shorter—between two and nine base pairs, repeated from STR locus SPECIAL TOPICS 5 7 to 40 times. For example, one locus known as D8S1179 TCTA is made up of the four base-pair sequence TCTA, repeated Primer 7 to 20 times, depending on the allele. There are 19 possi- Allele 1 * ble alleles of the locus that are found within a population. * Primer 7 repeats Primer Although hundreds of STR loci are present in the human Allele 2 * genome, only a subset is used for DNA profiling. At the pres- * Primer 10 repeats ent time, the FBI and other U.S. law enforcement agencies 1. PCR amplification use 20 STR loci as a core set for forensic analysis. Most Euro- pean countries now use 12 STR loci as a core set. * * Several commercially available kits are used for forensic * DNA analysis of STR loci. The methods vary slightly, but gen- * erally involve the following steps. As shown in Figure ST 5.2, * * each primer set is tagged by one of four fluorescent dyes— * represented here as blue, green, yellow, or red. Each primer * 2. Capillary electrophoresis set is designed to amplify DNA fragments, the sizes of which vary depending on the number of repeats within the region – amplified. For example, the primer sets that amplify the TH01, vWA, D21S11, D7S820, D5S818, TPOX, and DYS391 STR loci are all labeled with a fluorescent tag indicated as yellow. The sizes of the amplified DNA fragments allow sci- Laser entists to differentiate between the yellow-labeled products. + detector For example, the amplified products from the D21S11 locus range from about 200 to 260 bp in length, whereas those from FI G U R E ST 5. 3 Steps in the PCR amplification and analysis the TPOX locus range from about 375 to 425 bp, and so on. of one STR locus (D8S1179). In this example, the person is het- erozygous at the D8S1179 locus: One allele has 7 repeats and After amplification, the DNA sample will contain a one has 10 repeats. Primers are specific for sequences flank- small amount of the original template DNA sample and a ing the STR locus and are labeled with an orange fluorescent large amount of fluorescently labeled amplification prod- dye. The double-stranded DNA is denatured, the primers are ucts (Figure ST 5.3). The sizes of the amplified fragments annealed, and each allele is amplified by PCR in the presence of all four dNTPs and Taq DNA polymerase. After amplifica- are measured by capillary electrophoresis. This method tion, the labeled products are separated according to size by uses thin glass tubes that are filled with a polyacrylamide gel capillary electrophoresis, followed by fluorescence detection. M05A_KLUG8414_10_SE_ST05.indd 493 16/11/2018 21:42  494 5 SPECIAL TOPIC: DNA FORENSICS A D3S1358 D1S1656 D2S441 D10S1248 D13S317 Penta E 80 160 240 320 400 480 1200 800 400 0 D16S539 D18S51 D2S1338 CSF1PO Penta D 80 160 240 320 400 480 1200 800 400 0 TH01 vWA D21S11 D7S820 D5S818 TPOX DYS391 80 160 240 320 400 480 1200 800 400 0 D8S1179 D12S391 D19S433 FGA D22S1045 80 160 240 320 400 480 1200 800 SPECIAL TOPICS 5 400 0 F I G U R E ST 5. 4 An electropherogram showing the results double peaks, and homozygous loci as single, higher peaks. of a DNA profile analysis using the 24-locus STR profile The sizes of each allele can be calculated from the peak, loca- kit shown in Figure ST 5.2. Heterozygous loci show up as tions relative to the size axis shown at the top of each panel. sizes of the fragments and their quantities, and these are DS1358 vWA FGA represented as peaks on a graph (Figure ST 5.4). Typically, 900 Suspect 600 automated systems analyze dozens of samples at a time, and 300 the analysis takes less than an hour. 15 18 15 18 22 25 After DNA profiling, the profile can be directly com- pared to a profile from another person, from crime scene 600 Person assaulted 400 evidence, or from other profiles stored in DNA profile 200 databases (Figure ST 5.5). The STR profile genotype 16 17 16 21 26 of an individual is expressed as the number of times Fluorescence the STR sequence is repeated. For example, the profiles Epithelial cell fraction shown in Figure ST 5.5 would be expressed as shown in 900 600 Table ST 5.1. 300 16 17 16 21 26 An electropherogram showing the STR F I G U R E ST 5. 5 profiles of four samples from a rape case. Three STR loci were Sperm fraction examined from samples taken from a suspect (male), the per- 400 son who was sexually assaulted (female), and two fractions 200 from a vaginal swab taken from the female. The x-axis shows the DNA size ladder, and the y-axis indicates relative fluo- 15 18 15 18 22 25 rescence intensity. The number below each allele indicates the number of repeats in each allele, as measured against 120 140 160 180 200 220 240 260 the DNA size ladder. Notice that the STR profile of the sperm sample taken from the female matches that of the suspect. STR size (base pairs) M05A_KLUG8414_10_SE_ST05.indd 494 16/11/2018 21:42  ST 5.1 DNA PROFILING METHODS 495 TABLE ST 5.1 STR Profile Genotypes from the Four Profiles generation. Therefore, all cells in an individual contain mul- Shown in Figure ST 5.5 tiple copies of specific mitochondrial variants derived from Profile Genotype from the mother. Like Y-chromosome DNA, mtDNA undergoes Person Epithelial Sperm little if any recombination and is inherited as a single unit. STR Locus Suspect Assaulted Cells Fraction Scientists create mtDNA profiles by amplifying regions DS1358 15, 18 16, 17 16, 17 15, 18 of mtDNA that show variability between unrelated indi- vWA 15, 18 16, 16 16, 16 15, 18 viduals and populations. After PCR amplification, the DNA FGA 22, 25 21, 26 21, 26 22, 25 sequence within these regions is determined by automated DNA sequencing. Scientists then compare the sequence with Scientists interpret STR profiles using statistics, prob- sequences from other individuals or crime samples, to deter- ability, and population genetics, and these methods will be mine whether or not they match. discussed in the section Interpreting DNA Profiles. The fact that mtDNA is present in high copy numbers in cells makes its analysis useful in cases where samples are small, old, or degraded. mtDNA profiling is particularly Y-Chromosome STR Profiling useful for identifying victims of mass murders or disasters, In many forensic applications, it is important to differentiate such as the Srebrenica massacre of 1995 and the World the DNA profiles of two or more people in a mixed sample. For Trade Center attacks of 2001, where reference samples from example, vaginal swabs from rape cases usually contain a mix- relatives are available. The main disadvantage of mtDNA ture of female somatic cells and male sperm cells. In addition, profiling is that it is not possible to differentiate between some crime samples may contain evidence material from a the mtDNA from maternal relatives or from siblings. Like number of male suspects. In these types of cases, STR profiling Y-chromosome profiles, mtDNA profiles may be shared by of Y-chromosome DNA is useful. There are more than 200 STR two apparently unrelated individuals who also share a dis- loci on the Y chromosome that are useful for DNA profiling; tant ancestor—in this case a maternal ancestor. Researchers SPECIAL TOPICS 5 however, fewer than 20 of these are used routinely for forensic use mtDNA profiles in scientific studies of genealogy, evolu- analysis. PCR amplification of Y-chromosome STRs uses spe- tion, and human population migrations. cific primers that do not amplify DNA on the X chromosome. One limitation of Y-chromosome DNA profiling is that it cannot differentiate between the DNA from fathers and sons Single-Nucleotide Polymorphism Profiling or from male siblings. This is because the Y chromosome is Single-nucleotide polymorphisms (SNPs) are single- directly inherited from the father to his sons, as a single unit. nucleotide differences between two DNA molecules. They The Y chromosome does not undergo recombination, mean- may be base-pair changes or small insertions or deletions. ing that less genetic variability exists on the Y chromosome SNPs occur randomly throughout the genome, approxi- than on autosomal chromosomes. Therefore, all patrilineal mately every 500 to 1000 nucleotides. This means that there relatives share the same Y-chromosome profile. Even two are potentially millions of loci in the human genome that can apparently unrelated males may share the same Y profile, if be used for profiling. However, as SNPs usually have only they also share a distant male ancestor. two alleles, many SNPs (50 or more) must be used to create Although these features of Y-chromosome profiles pres- a DNA profile that can distinguish between two individuals ent limitations for some forensic applications, they are use- as efficiently as STRs. ful for identifying missing persons when a male relative’s Scientists analyze SNPs by using specific primers to DNA is available for comparison. They also allow research- amplify the regions of interest. The amplified DNA regions ers to trace paternal lineages in genetic genealogy studies. are then analyzed by a number of different methods such as automated DNA sequencing or hybridization to immobilized probes on DNA microarrays that distinguish between DNA Mitochondrial DNA Profiling molecules with single-nucleotide differences. Another important addition to DNA profiling methods is Forensic SNP profiling has one major advantage over mitochondrial DNA (mtDNA) analysis. Between 200 and STR profiling. Because a SNP involves only one nucleotide 1700 mitochondria are present in each human somatic cell. of a DNA molecule, the theoretical size of DNA required for Each mitochondrion contains one or more 16-kb circular a PCR reaction is the size of the two primers and one more DNA chromosomes. Mitochrondria are passed from the nucleotide (i.e., about 50 nucleotides). This feature makes human egg cell to the zygote during fertilization; however, SNP analysis suitable for analyzing DNA samples that are as sperm cells contribute few if any mitochondria to the severely degraded. Despite this advantage, SNP profiling zygote, they do not contribute these organelles to the next has not yet become routine in forensic applications. More M05A_KLUG8414_10_SE_ST05.indd 495 16/11/2018 21:42  496 5 SPECIAL TOPIC: DNA FORENSICS frequently, researchers use SNP profiling of Y-chromosome and mtDNA loci for lineage and evolution studies. ST 5.2 Interpreting DNA Profiles After a DNA profile is generated, its significance must be DNA Phenotyping determined. In a typical forensic investigation, a profile An emerging and controversial method, known as DNA phe- derived from a suspect is compared to a profile from an notyping, is gaining popularity as a new DNA forensics tool. evidence sample or to profiles already present in DNA data- Unlike DNA profiling, which is used to confirm or exclude bases. If the suspect’s profile does not match that of the evi- sample identities, DNA phenotyping uses DNA sequence dence profile or database entries, investigators can conclude information to reveal a person’s physical features and ances- that the suspect is not the source of the sample(s) that gen- tral origins. erated the other profile(s). However, if the suspect’s profile Currently, DNA phenotyping methods can predict a matches the evidence profile or a database entry, the inter- person’s eye, hair, and skin colors based on their DNA SNP pretation becomes more complicated. In this case, one could patterns. For example, scientists have found six SNPs in six conclude that the two profiles either came from the same genes that are related to blue and brown eye color. Using person—or they came from two different people who share statistical models based on these six SNPs, it is possible the same DNA profile by chance. To determine the signifi- to predict with 95 percent accuracy whether a person has cance of any DNA profile match, it is necessary to estimate brown or blue eyes. Using 22 SNPs associated with 11 genes, the probability that the two profiles are a random match. it is possible to predict with 90 percent accuracy whether a The profile probability or random match probability person has black hair and 80 percent accuracy whether a method gives a numerical probability that a person chosen person has red or brown hair. Skin color predictions involve at random from a population would share the same DNA 36 SNPs associated with 15 genes, with prediction accura- profile as the evidence or suspect profiles. The following cies similar to those for hair colors. Both biological sex and example demonstrates how to arrive at a profile probability SPECIAL TOPICS 5 geographic ancestry can also be accurately determined from (Table ST 5.2). a person’s DNA sequence. The first locus examined in this DNA profile (D5S818) Some researchers and private companies have taken has two alleles: 11 and 13. Population studies show that the DNA phenotyping well beyond prediction of these features. 11 allele of this locus appears at a frequency of 0.361 in this Their algorithms claim to predict three-dimensional facial population and the 13 allele appears at a frequency of 0.141. structures which allow them to compile full-color photo- In population genetics, the frequencies of two different graphic representations of a person’s face, based only on alleles at a locus are given the designation p and q, following their DNA sample. the Hardy—Weinberg law described earlier in the text (see At the present time, DNA phenotyping has not been vali- Chapter 21). We assume that the person having this DNA dated sufficiently to be presented in court. However, police profile received the 11 and 13 alleles at random from each are using the method to help identify unknown missing per- parent. Therefore, the probability that this person received sons and to provide leads in cold cases. allele 11 from the mother and allele 13 from the father is TABLE ST 5.2 A Profile Probability Calculation Based on Analysis of Five STR Loci STR Locus Alleles from Profile Allele Frequency from Population Database* Genotype Frequency Calculation D5S818 11 0.361 2pq = 2 * 0.361 * 0.141 = 0.102 13 0.141 TPOX 11 0.243 p2 = 0.243 * 0.243 = 0.059 11 0.243 D8S1179 13 0.305 2pq = 2 * 0.305 * 0.031 = 0.019 16 0.031 CSF1PO 10 0.217 p2 = 0.217 * 0.217 * 0.047 10 0.217 D19S433 13 0.253 2pq = 2 * 0.253 * 0.369 = 0.187 14 0.369 Genotype frequency from this 5-locus profile = 0.102 * 0.059 * 0.019 * 0.047 * 0.187 = 0.0000009 = 9 * 10-7 *A U.S. Caucasian population database [Butler, J. M., et al. (2003). J. Forensic Sci. 48:908–911]. © 2003 John Wiley & Sons, Inc. M05A_KLUG8414_10_SE_ST05.indd 496 16/11/2018 21:42  ST 5.3 TECHNICAL AND ETHICAL ISSUES SURROUNDING DNA PROFILING 497 expressed as p * q = pq. In addition, the probability that percent of cases. Parents and children also share alleles, but the person received allele 11 from the father and allele 13 are less likely than siblings to share both alleles at a locus. from the mother is also pq. Hence, the total probability that When DNA profiles come from two people who are closely this person would have the 11, 13 genotype at this locus, by related, the profile probabilities must be adjusted to take chance, is 2pq. As we see from Table ST 5.2, 2pq is 0.102 or this into account. The allele frequencies and calculations approximately 10 percent. It is obvious from this sample that we describe here are based on assumptions that the that using a DNA profile of only one locus would not be very population is large and has little relatedness or inbreeding. informative, as about 10 percent of the population would If a DNA profile is analyzed from a person in a small inter- also have the D5S818 11, 13 genotype. related group, allele frequency tables and calculations may The discrimination power of the DNA profile increases not apply. when we add more loci to the analysis. The next locus of this person’s DNA profile (TPOX) has two identical alleles— the 11 allele. Allele 11 appears at a frequency of 0.243 in DNA Profile Databases this population. The probability of inheriting the 11 allele Many countries throughout the world maintain national from each parent is p * p = p2. As we see in the table, the DNA profile databases. The first of these databases was genotype frequency at this locus would be 0.059, which is established in the United Kingdom in 1995 and now con- about 6 percent of the population. If this DNA profile con- tains more than 6 million profiles. In the United States, both tained only the first two loci, we could calculate how fre- state and federal governments have DNA profile databases. quently a person chosen at random from this population The entire system of databases along with tools to analyze would have the genotype shown in the table, by multiply- the data is known as the Combined DNA Index System ing the two genotype probabilities together. This would be (CODIS) and is maintained by the FBI. As of August 2018, 0.102 * 0.059 = 0.006. This analysis would mean that there were more than 17 million DNA profiles stored within about 6 persons in 1000 (or 1 person in 166) would have the CODIS system. These include the convicted offender data- SPECIAL TOPICS 5 this genotype. The method of multiplying all frequencies of base, which contains DNA profiles from individuals con- genotypes at each locus is known as the product rule. It is the victed of certain crimes, and the forensic database, which most frequently used method of DNA profile interpretation contains profiles generated from crime scene evidence. In and is widely accepted in U.S. courts. addition, some states have DNA profile databases contain- By multiplying all the genotype probabilities at the ing profiles from suspects and from unidentified human five loci, we arrive at the genotype frequency for this DNA remains and missing persons. profile: 9 * 10-7. This means that approximately 9 people DNA profile databases have proven their value in many in every 10 million (or about 1 person in a million), chosen different situations. As of August 2018, use of CODIS data- at random from this population, would share this 5-locus bases had resulted in more than 400,000 profile matches that DNA!profile. assisted criminal investigations and missing persons searches (Box 2). Despite the value of DNA profile databases, they remain a concern for many people who question the privacy The Uniqueness of DNA Profiles and civil liberties of individuals versus the needs of the state. As we increase the number of loci analyzed in a DNA profile, we obtain smaller probabilities of a random match. Theoret- ically, if a sufficient number of loci were analyzed, we could be almost certain that the DNA profile was unique. At the present time, law enforcement agencies in North America ST 5.3 Technical and Ethical Issues use a core set of 20 STR loci to generate DNA profiles. Using Surrounding DNA Profiling this 20-loci set, the probability that two people selected at random would have identical genotypes at these loci would Although DNA profiling is sensitive, accurate, and powerful, be approximately 1 * 10-28. it is important to be aware of its limitations. One limitation Although this would suggest that most DNA profiles gen- is that most criminal cases have either no DNA evidence for erated by analysis of the 20 core STR loci would be unique analysis or DNA evidence that would not be informative to on the planet, several situations can alter this interpreta- the case. In some cases, potentially valuable DNA evidence tion. For example, identical twins share the same DNA, and exists but remains unprocessed and backlogged. Another their DNA profiles will be identical. Identical twins occur at serious problem is that of human error. There are cases in a frequency of about 1 in 250 births. In addition, siblings which innocent people have been convicted of violent crimes can share one allele at any DNA locus in about 50 percent based on DNA samples that had been inadvertently switched of cases and can share both alleles at a locus in about 25 during processing. DNA evidence samples from crime scenes M05A_KLUG8414_10_SE_ST05.indd 497 16/11/2018 21:42  498 5 SPECIAL TOPIC: DNA FORENSICS are often mixtures derived from any number of people saliva) was indirectly introduced to the site (Box 3). Crime present at the crime scene or even from people who were scene evidence is often degraded, yielding partial DNA not present, but whose biological material (such as hair or profiles that are difficult to interpret. BOX 2 The Kennedy Brewer Case: Two expert dentistry witness testified that Jackson’s murder, as well as to another Bite-Mark Errors and One Hit the marks on Christine’s body were rape and murder—that of a 3-year-old actually postmortem insect bites, girl named Courtney Smith. Levon I the court convicted Brewer of capital Brooks, the ex-boyfriend of Courtney’s murder and sexual battery and sen- mother, had been convicted of murder n 1992 in Mississippi, Kennedy tenced him to death. in the Smith case, also based on bite- Brewer was arrested and charged In 2001, more sensitive DNA profil- mark testimony by the same discred- with the rape and murder of his girl- ing was conducted on the 1992 semen ited expert witness. friend’s 3-year-old daughter, Christine sample. The profile excluded Brewer On February 15, 2008, all charges Jackson. Although a semen sample had as the donor of the semen sample. It against Kennedy Brewer were dropped, been obtained from Christine’s body, also excluded two of Brewer’s friends, and he was exonerated of the crimes. there was not sufficient DNA for profil- and Y-chromosome profiles excluded Levon Brooks was subsequently exon- ing. Forensic scientists were also unable Brewer’s male relatives. Despite these erated of the Smith murder in March to identify the ABO blood group from test results, Brewer remained in prison of 2008. the bloodstains left at the crime scene. for another five years, awaiting a new Since 1989, more than 350 people The prosecution’s only evidence came trial. In 2007, the Innocence Project in the United States have been exoner- from a forensic bite-mark specialist who took on Brewer’s case and retested the ated of serious crimes, based on DNA testified that the 19 ”bite marks” found DNA samples. The profiles matched profile evidence. Seventeen of these SPECIAL TOPICS 5 on Christine’s body matched imprints those of another man, Justin Albert people had served time on death row. made by Brewer’s two top teeth. Even Johnson, a man with a history of sex- In more than 150 of these exoneration though the specialist had recently been ual assaults who had been one of the cases, the true perpetrator has been discredited by the American Board of original suspects in the case. Johnson identified, often through searches of Forensic Odontology, and the defense’s subsequently confessed to Christine DNA databases. BOX 3 A Case of Transference: The a death sentence over his head, for the Several months after Anderson’s Lukis Anderson Story next five months. release, prosecutors announced that The authorities believed that they they had solved the puzzle. The para- O had a solid case. The crime scene medics who had treated Anderson DNA profile was a perfect match to and taken him to the hospital had n November 30, 2012, Anderson’s DNA profile, and the lab then responded to the call at Kumra’s police discovered results were accurate. Prosecutors house, where they had inadvertently the body of Raveesh planned to pursue the death penalty. transferred Anderson’s DNA onto Kumra at his home in Monte Sereno, The only problem for the prosecution Kumra’s fingernails. It is not clear how California. Kumra’s house had been was that Anderson could not have the transfer had occurred, but likely ransacked, and he had suffocated been involved in the murder, or even Anderson’s DNA had been present on from the tape used to gag him. Police present at the crime scene. the paramedics’ equipment or clothing. collected DNA samples from the crime On the night of the murder, Ander- If Lukis Anderson had not been in scene and performed DNA profiling. son had been intoxicated and barely the hospital with an irrefutable alibi, Several suspects were identified conscious on the streets of San Jose and he may have faced the death sentence through matches to DNA database had been taken to the hospital, where based on DNA evidence. His story entries. One match, to a sample taken he remained for the next 12 hours. illustrates how too much confidence from Kumra’s fingernails, was that Given his iron-clad alibi, authorities in the power of DNA evidence can lead of Lukis Anderson, a homeless man were forced to release Anderson. But to false accusations. It also points to who was known to police. Based on they remained baffled about how an the robustness of DNA, which can the DNA profile match, Anderson innocent person’s DNA could have remain intact, survive disinfection, and was arrested, charged with murder, been found on a murder victim—one be transferred from one location to and jailed. He remained in jail, with whom Anderson had never even met. another, under unlikely circumstances.  DISCUSSION QUESTIONS 499 One of the most disturbing problems with DNA profiling their DNA profiles stored on a database and whether police is its potential for deliberate tampering. DNA profile tech- should be able to collect DNA samples without a suspect’s nologies are so sensitive that profiles can be generated from knowledge or consent. only a few cells—or even from fragments of synthetic DNA. Another ethical question involves the use of DNA pro- There have been cases in which criminals have introduced files that partially match those of a suspect. There are cases biological material to crime scenes, in an attempt to affect in which investigators search for partial matches between forensic DNA profiles. It is also possible to manufacture arti- the suspect’s DNA profile and other profiles in a DNA data- ficial DNA fragments that match STR loci of a person’s DNA base. On the assumption that the two profiles arise from two profile. In 2010, a research paper1 reported methods for syn- genetically related individuals, law enforcement agencies thesizing DNA of a known STR profile, mixing the DNA with pursue relatives of the person whose profile is stored in the body fluids, and depositing the sample on crime scene items. DNA database. Testing in these cases is known as familial When subjected to routine forensic analysis, these artificial DNA testing. Should such searches be considered scientifi- samples generated perfect STR profiles. In the future, it may cally valid or even ethical? be necessary to develop methods to detect the presence of As described previously, it is now possible to predict synthetic or cloned DNA in crime scene samples. It has been some facial features and geographic ancestries of persons suggested that such detections could be done, based on the based on information in their DNA sample—a method known fact that natural DNA contains epigenetic markers such as as DNA phenotyping. Should this type of information be used methylation. to identify or convict a suspect? Many of the ethical questions related to DNA profiling As DNA profiling becomes more sophisticated and preva- involve the collection and storage of biological samples and lent, we should carefully consider both the technical and eth- DNA profiles. Such questions deal with who should have ical questions that surround this powerful new technology. SPECIAL TOPICS 5 1 Frumkin, D., et al. (2010). Authentication of forensic DNA samples. Forensic Sci. Int. Genet. 4:95–103. Review Questions 1. What is VNTR profiling, and what are the applications of this 6. Explain why mitochondrial DNA profiling is often the method of technique? choice for identifying victims of massacres and mass disasters. 2. Why are short tandem repeats (STRs) the most commonly used 7. What is a ”profile probability,” and what information is required loci for forensic DNA profiling? in order to calculate it? 3. Describe capillary electrophoresis. How does this technique dis- 8. Describe the database system known as CODIS. What deter- tinguish between input DNA and amplified DNA? mines whether a person’s DNA profile will be entered into the 4. What are the advantages and limitations of Y-chromosome STR CODIS system? profiling? 9. What is DNA phenotyping, and how do law enforcement agen- 5. How does SNP profiling differ from STR profiling, and what are cies use this profiling method? the advantages of SNP profiling? 10. What are three major limitations of forensic DNA profiling? Discussion Questions 1. Given the possibility that synthetic DNA could be purposely you explain to the jury the factors that might alter their inter- introduced into a crime scene in order to implicate an inno- pretation of the crime scene DNA profile? cent person, what methods could be developed to distinguish 4. The phenomena of somatic mosaicism and chimerism are more between synthetic and natural DNA? prevalent than most people realize. For example, pregnancy and 2. Different countries and jurisdictions have different regulations bone marrow transplantation may lead to a person’s genome regarding the collection and storage of DNA samples and pro- becoming a mixture of two different genomes. Describe how DNA files. What are the regulations within your region? Do you think forensic analysis may be affected by chimerism and what mea- that these regulations sufficiently protect individual rights? sures could be used to mitigate any confusion during DNA profil- 3. If you were acting as a defense lawyer in a murder case that used ing. Find out more about genetic chimerism in an article by Zim- DNA profiling as evidence against the defendant, how would mer, C., DNA double take, New York Times, September 16, 2013. M05A_KLUG8414_10_SE_ST05.indd 499 16/11/2018 21:42