CH Notes PDF

L1 (expts to discover genetic material): ======================================== **The Central Dogma** A diagram of a sequence of sequence of sequence of sequence of sequence of sequence of sequence of sequence of sequence of sequence of sequence of sequence of sequence of sequence of sequence of...

L1 (expts to discover genetic material): ======================================== **The Central Dogma** A diagram of a sequence of sequence of sequence of sequence of sequence of sequence of sequence of sequence of sequence of sequence of sequence of sequence of sequence of sequence of sequence of sequence of sequence of sequence Description automatically generated What is [not] known in a biological system? - From protein template to protein - From DNA template directly to protein What is [reverse genetics]? - Study to find all functions of a particular gene **Discovery of genetic material** Genetic material is passed from parent to offspring  Genetic material must: 1. **Information**: contain the information necessary to make an entire organism 2. **Transmission**: be passed from parent to offspring through cell division in the form of chromosomes 3. **Replication**: be copied - In order to be passed from parent to offspring 4. **Variation**: be capable of changes - To account for the known phenotypic variation in each species Chromosome consists of DNA and proteins - [Is genetic material DNA or proteins?] In the past, people believed genetic material to be DNA; scaffold of DNA with proteins docked & dur DNA replication, both proteins & DNA segregated into two daughter cells - Chromosomes contain less DNA than protein by weight - Protein has 20 different subunits (amino acids) so it has a greater potential for variety of combinations - Diverse proteins were identified, responsible for different functions e.g. enzymes, transporters, receptors, etc. - DNA consists of only four different subunits (A, T, C, G) -- 'the stupid molecule'. **Three classic experiments** - Frederick Griffith experiments (1928) with Streptococcus pneumoniae - The experiments of Avery, MacLeod and McCarty (1944), transformation principle - Hershey and Chase experiments (1952) with Bacteriophage T2 **Frederick Griffith experiments (1928) with Streptococcus pneumoniae\ **S. pneumoniae causes pneumonia (before the time of antibiotics) [S. pneumoniae comes in two strains] - S -- smooth - Produce smooth colonies on solid media - Secrete a polysaccharide capsule (sugar coat) - protects bacterium from the immune system of animals VIRULENT - Protects surface proteins of bacteria from being recognised by antibodies - R -- rough - unable to secrete a capsule - Produce colonies with a rough appearance (Trying to produce vaccine using R strain) [Conducted experiment using two strains of type S and type R] - inject mouse with live type S bacteria - mouse died - inject mouse with live type R bacteria - mouse survived - inject mouse with heat-killed type S bacteria - mouse survived - inject mouse with live type R + heat-killed type S bacteria - **mouse died** (why did he conduct expt? Wanted to use inactivated proteins to trigger immune response though that "live" R trigger immune response + type S has sugar coat)  - **Transformation**: transfer of genetic material - something from the dead type S was transforming type R into type S **The Experiments of Avery, MacLeod and McCarty (1944)** Using transformation identify the genetic material - to identify that DNA is the genetic material and not a contaminant (RNA or protein) - At that time, it was known that DNA, RNA, proteins and carbohydrates are major constituents of living cells - prepared cell extracts from type S cells containing each of these macromolecules - DNA, RNAse & protease to cleave DNA, RNA, and protein - Centrifugation and cell disruptors to release cytoplasmic contents into supernatant; precipitate will contain genetic material - An antibody for type R bacteria (not transformed), form aggregate + precipitated these bacteria upon centrifugation to the bottom of the tube removed - Left with bacteria that have been transformed to be plated A diagram of different types of samples Description automatically generated [Understanding Avery et al's experiments:] - S. pneumoniae bacteria can take up extracellular DNA and to be 'transformed' by this DNA - Type R bacteria can take up DNA from Type S bacteria and become Type S - Criticism: have not accepted that proteins are NOT genetic material, DNA is the genetic material **Hershey and Chase Experiment with Bacteriophage T2 (the blender experiment)** - Evidence that DNA is the genetic material - studied the bacteriophage T2 - contains only DNA and protein   Hypothesis: only the genetic material of the phage is injected to the bacterium - isotope labelling will reveal if it is DNA or protein [The experiment] Used radioisotopes to distinguish DNA from proteins - 32P-nucleotides label DNA specifically - 35S-amino acids label protein specifically A diagram of a chemical structure Description automatically generated A pulse-chase experiment - **pulse**-label DNA and protein - radioactively labelled phages used to infect non radioactive Escherichia coli cells - After allowing sufficient time for infection to proceed, the residual phage particles were sheared off the cells (using a blender) Phage ghosts and E. coli cells were separated - **chase** the fate of each type of molecule - Radioactivity was monitored using a [scintillation counter]  A diagram of a cell division Description automatically generated - 35S labelled proteins not injected into E.coli cells and remain extracellular (supernatant) proteins not genetic material - 32S labelled DNA injected into E.coli cells (sinks as pellet) DNA is the genetic material - When empty phages sheared off bacterial cells, bacteria remains intact and should not be lysed to prevent genetic material from being extracellular (entering supernatant) if not, both 35S proteins and 32S DNA in supernatant and cannot distinguish which is genetic material  \*longer you blend, more phage particles sheared from cells - Extracellular 32P in supernatant is lower than 35s - Less 32P in phages - More 32P DNA in E.coli cells - Injected genetic material is DNA **RNA functions as the genetic material in some viruses** isolated RNA from the tobacco mosaic virus (TMV), a plant virus - Purified RNA caused the same lesions (abnormal/damaged tissue caused by infection) as intact TMV viruses - viral genome is composed of RNA (does NOT have DNA) - Notable human pathogenic RNA viruses: SARS, Influenza viruses, Ebola virus, and ZIKA virus **Nucleic Acid Structure** A diagram of different types of molecules Description automatically generated **DNA** **RNA** ---------------------------------------------------------------------- ----------------------------------------- 5C connected to phosphate group and 1C connected to nitrogenous base Nitrogenous base: A, G, C, T Nitrogenous base: A, G, C, U 2C connected to hydrogen atom (no O) 2C connected to hydroxyl group (with O) **Nucleic acid strands** - Nucleotides are covalently linked together by phosphodiester bonds - A phosphate connects the 5' carbon of one nucleotide to the 3' carbon of another - strand has directionality -- 5' to 3' - The phosphates and sugar molecules form the backbone of the nucleic acid strand - Nitrogenous bases at one strand forms complementary base pairs with bases of other strand  - **DNA structure** [Linus Pauling] In the early 1950s, he proposed that regions of protein can fold into a secondary structure (polymers) - Alpha-helix A diagram of a dna structure Description automatically generated - Stabilised by H bonds and covalent peptide bonds between aa - Used X ray crystallography to visualise protein structures (shine light) - **Suggested a helical structure for DNA** [Erwin Chargaff's expt] - already known then that DNA contained the four bases: A, G, C and T - **Tetranucleotide hypothesis: all four bases in DNA were in equal amounts** - analyzed the base composition of DNA in different species - isolated multiple DNA & acid to digest nucleotides - thin layer chromatography to separate different nucleotides in organic solvent  - **Chargaff's rule:** - **% of A = % of T** - **% of C = % of G** [Rosalind Franklin] - X-ray diffraction pattern of DNA fibers suggested structural features of DNA: - Helical - More than one strand - 10 base pairs per complete turn [Watson & Crick] A dna helix drawing with writing Description automatically generated with medium confidence  **DNA double helix** - Two strands of DNA form a right-handed double helix - bases in opposite strands hydrogen bond according to the A/T and G/C rule - C-G triple bond more stable than A-T double bond - The two strands are antiparallel with regard to their 5' to 3' directionality - There are \~10.0 nucleotides in each strand per complete 360º turn of the helix - Van der Waals forces between flattened bases - Minor grooves shallower than major grooves [DNA-protein interaction] - Most bindings occur at major groove - Binding can be: - Nucleotide sequence specific e.g. binding of proteins that regulate gene transcription OR - Non-specific e.g. binding of histones  - **RNA Structure** RNA strand - primary structure of an RNA strand is much like that of a DNA strand - RNA strands are typically several hundred to several thousand nucleotides in length (shorter than DNA) - In RNA synthesis, only one of the two strands of DNA is used as a template A diagram of chemical formulas Description automatically generated - usually single-stranded - BUT can form short double-stranded regions - This secondary structure is due to complementary basepairing: A to U and C to G - allows short regions to form a double helix - base pairing and base stacking (orientation of adjacent base pairs with their planes parallel and with their surfaces nearly in contact) within RNA itself to hold double helixes stable  A diagram of a structure Description automatically generated L2 (DNA replication): ===================== **DNA Replication** Process in which one ds DNA molecules used to create two ds DNA molecules with identical DNA seq (copying mechanism based on structure) **Semi-conservative replication:** A. Double helix unwinds B. Each strand acts as template C. Complementary base pairing ensures that T signals addition of A on new strand, and G signals addition of C D. Two daughter helices are produced after replication a. Daughter helices identical to parental strand  +-----------------------------------+-----------------------------------+ | **Structure** | **Function** | +===================================+===================================+ | **helicase** | Breaks hydrogen bonds between two | | | strands | | | | | | - unwinds double helix | +-----------------------------------+-----------------------------------+ | **Single strand binding protein** | Bind to separated DNA strands to | | | keep parental strands apart | | | | | | - To protect from annealing | | | back into ds | | | | | | - To protect other ptns from | | | binding to ss | +-----------------------------------+-----------------------------------+ | topoisomerase | Alleviates supercoiling | +-----------------------------------+-----------------------------------+ | **Primase** | Synthesises a short RNA primer | | | (10-12 nucleotides) | +-----------------------------------+-----------------------------------+ | **DNA polymerase III** | Synthesises daughter DNA strands | | | in PROKARYOTES | | | | | | 1. enzymes that catalyse | | | attachment of nucleotides to | | | make new DNA | | | | | | 2. requires a 3'OH end | +-----------------------------------+-----------------------------------+ | **DNA ligase** | Covalently links DNA fragments | | | together | +-----------------------------------+-----------------------------------+ | (DNA poly I | Replaces short RNA primer with | | | nucleotides after replication) | +-----------------------------------+-----------------------------------+ [Process:] - Helicase - Breaks hydrogen bonds between two strands & unwinds double helix - Ss binding protein - Bind to separated DNA strands to keep parental strands apart - Primase -- synthesis short RNA primer (10-12 nt) - Primers start or prime DNA synthesis - Later removed or replaced w DNA - DNA Poly -- enzymes that catalyse attachment of nucleotides to make new DNA - **Synthesises a strand only in the 5' to 3' direction** - **Leading strand** - strand synthesised in the same direction as movement of replication fork - one RNA primer made at origin - **Lagging strand** - strand synthesised in the opposite direction as movement of replication fork - synthesis of small DNA fragments (1000 to 2000 nucleotides each) known as **Okazaki fragments** (refer to diagram) - DNA ligase -- covalently links Okazaki fragments together  [Mechanism of DNA Polymerases] - Reaction occurs between the **free 3'-OH group** at the end of the primer strand and the interior P atom of the nucleotide triphosphate being added, with removal of a pyrophosphate (PP) - Extension of the strand is always in the **5' --\> 3' direction** A diagram of a chemical reaction Description automatically generated with medium confidence  - DNA Poly cannot initiate DNA synthesis without free 3' OH group - Primase synthesises RNA primers that provide 3'OH group - DNA poly attach nucleotides attach in 5' to 3' direction **Reducing error rate of nucleotide synthesis** A white background with black text Description automatically generated **Proofreading mechanism of DNA Polymerase** - DNA polymerases can identify a mismatched nucleotide and remove it from the daughter strand - The enzyme uses its 3' to 5' **exonuclease** activity to remove the incorrect nucleotide - It then changes direction and resumes DNA synthesis in the 5' to 3' direction **DNA Repair Mechanisms** - Repairs DNA replication mistakes and random DNA damages caused by heat, metabolic accidents, radiations and exposure to substances in the environment. - Many human diseases are linked with decreased DNA repair ability. - Major DNA repair pathways (not req to know in depth): - Base excision repair - Nucleotide excision repair -- can be multiple nucleotides - Nonhomologous end joining (NHEJ) and homologous recombination to repair double-strand breaks (DSBs) (Topic 4 WJL) [Common mutation caused by chem modifications] - Deamination substitution of bases - Depurination loss of nucleotide pair [Pyrimidin dimers caused by UV irradiation] - UV irradiation Dimer formed between two neighbouring pyrimidine bases ( C or T) deletion or base pair substitution  [Base Excision and Nucleotide Excision Repair Mechanisms (no need to know in depth)] A screenshot of a computer Description automatically generated [Repair mechanisms for ds breaks (DSBs)]  **Mutation rates** - Low mutation rates are necessary for life to pass on genetic info A diagram of a mother and mother Description automatically generated - BUT mutations also results in variation evolution (excess mutations repaired) **Questions** - **Write the nucleotide sequence of a DNA strand complementary to 5' -- ATGCGTAGCTTT -- 3'. Write the replication product of the dsDNA. Indicate old and new strands.** Complementary strand:3' -TACGCATCGAAA -- 5' Old strands: 5' -- ATGCGTAGCTTT -- 3' 3' -TACGCATCGAAA -- 5' Replication product (new strands): 3' -TACGCATCGAAA -- 5' 5' -- ATGCGTAGCTTT -- 3' - **Given the following nucleotide sequence, 5\'-CATTAGATCG-3\', what sequence will be the correct complementary strand.** 3'-GTAATCTAGC-5' - **Both DNA and RNA can be genetic materials. But DNA is the genetic material found in most organisms. Any idea why?** - DNA has proofreading mechanism -- allows it to repair mismatched nucleotides - DNA ds -- one copy can be used as template to synthesise another for DNA replication + as back-up for DNA repair - DNA less reactive as it does not have hydroxyl group at 2C of ribose ---\> a more stable molecule to store genetic material ChatGPT answer:  **Stability**: DNA is more chemically stable than RNA due to its double-stranded structure and the presence of deoxyribose sugar. This stability helps protect the genetic information from degradation, making it better suited for long-term storage of genetic data.  **Replication Fidelity**: DNA has a high fidelity during replication, thanks to proofreading mechanisms. This reduces the chances of mutations, ensuring that genetic information is accurately passed on to future generations.  **Structural Complexity**: The double helix structure of DNA allows for a more complex organization of genetic information. It can be tightly packed into chromosomes, which is essential for efficient packaging in cells.  **Functionality**: While RNA can serve as genetic material in some viruses, DNA is more versatile in terms of functions. It can act as a template for transcription into RNA, which then guides protein synthesis. This separation of roles allows for more intricate regulation of gene expression.  **Evolutionary Perspective**: The transition from RNA-based life forms to DNA-based ones might have provided evolutionary advantages, leading to greater stability and complexity in genetic information management. - **Write out a sequence of an RNA molecule that could form a stem loop with 22 nucleotides in the stem and 8 nucleotides in the loop.** 3' -- AAAAAAACGCGCGCGAAAAAAA (WRONG) Stem has c.b.p Loop does not have c.b.p -- projected outwards  5. **If an organism has a G+C contents of 64% in its DNA, what are the percentages of A, T, G, and C?** - \% of G: 32% - \% of C: 32% - \% of A: 18% - \% of T: 18% 6. **Can a DNA strand pair up with an RNA strand following the same base pairing rule?** - A (in DNA) to U (in RNA) - C (in DNA) to G (in RNA) - G (in DNA) to C (in RNA) - T (in DNA) to A (in RNA) Different rules  L3 (transcription and translation in bacteria): =============================================== **[How cells read genome -- from DNA to protein]** A diagram of a cell Description automatically generated **Genetic Material**  **Genome (DNA) in nucleus** - Other types of genome e.g. mitochondrial genome in mitochondria - Chromosomes contain both DNA & histone proteins **Gene is a transcriptional unit** i.e. piece of DNA that can be transcribed into RNA, but does [not] always result in protein product - **Structural gene**: encodes a polypeptide - Gene RNA transcript[: messenger RNA (mRNA)] polypeptide - 90% of all genes that we know of are structural genes - **Non-structural genes**: transcribes RNA transcripts that are not translated (*e.g.* tRNA, rRNA, microRNA (controls gene expression)) - have important cellular functions - In some cases, the RNA transcript becomes part of a complex that contains protein subunits - Ribosomes (rRNA) - Spliceosomes DNA strands - **Template strand**: strand that is transcribed - Read by RNA Poly from DNA's 3' to 5' end - RNA strand is synthesised in 5' to 3' direction - **Coding or sense strand**: opposite strand - base sequence is identical to the RNA transcript, except for the substitution of uracil in RNA for thymine in DNA A close-up of a dna Description automatically generated **Genetic code table** **Transcription & Translation**  **Transcription in BACTERIA** **Three main elements:** - promoter in DNA of gene - RNA polymerase - Transcription factors (sigma factor) **OVERVIEW:** A diagram of a dna sequence Description automatically generated **Initiation:** - The promoter functions as a recognition site for transcription factors - The transcription factors enable RNA polymerase to bind to the promoter forming a [closed promoter complex] - Sigma factor (tf) bind to core enzyme to form holoenzyme - Following binding, the DNA is denatured (and unwinds) into a bubble known as the [open promoter complex], or simply an [open complex] **Elongation:** - RNA polymerase slides along the DNA in an open complex to synthesize the RNA transcript - DNA strand known as template strand is used to make complementary copy of RNA as an RNA-DNA hybrid - Synthesised in 5' to 3' direction using ribonucleoside triphosphate as precursor (pyrophosphate released) - Complementary rule: A/U and C/G - Sigma factor released **Termination:** - termination signal is reached that causes RNA polymerase to dissociate from the DNA - e.g. of termination mechanism: stem loop formed between Rho recognition site & Rho termination site halts movement of RNA Polymerase Rho protein moves towards RNA Poly to terminate at Rho termination site **Promoter:**  - +1 is first nucleotide to be transcribed (no base numbered 0) - highly conserved sequences: - -35 box (consensus sequence: TTGACA) - -10 box (consensus sequence: TATAAT) - **The higher the agreement with consensus sequences, the higher the rate of transcription** - Why are promoters generally AT-rich? - A-T double bond less strong than C-G double bond easier to unwind double stranded DNA for transcription **RNA Polymerase:** **DNA dependent-RNA Polymerase** - Can synthesise long chain of RNA - Use all 4 ribonucleotides (ATP, GTP, CTP and UTP) to produce RNA chain - DNA-dependent (i.e. use DNA as template) Can Primase be responsible for elongation during transcription? 1. No. 2. DNA dependent RNA Polymerase 3. SHORT chain of RNA **The assay:** - Cell fractionation of *E. coli* lysates (separates cellular proteins by cellular location, solubility, size, charge etc.) - Incubate each protein fraction with a DNA template and radio-labeled NTPs (nucleotide triphosphates - substrates) - Monitor incorporation of radio-labeled NTPs into RNA - Use different DNA (with different AT/GC ratio) as templates and analyze the AU/GC ratio in RNA products - in order to monitor that DNA is used as the template A diagram of a number of fractions Description automatically generated If AU/GC ratio in RNA matches with DNA, particular fraction has a DNA-dependent RNA Polymerase (can keep analysing fractions subfractions more subfractions to dxm which protein is DNA-dependent RNA Polymerase) In BACTERIA (E.coli), **RNA Poly holoenzyme**: Composed of - - core enzyme - Five subunits = a~2~bb'ω - sigma factor (transcription factor) - One subunit = sigma - But diff sigma factors used in response to diff env conditions - **σ70:** the "housekeeping" sigma factor that transcribes most genes in growing bacteria (always there) - **σ28:** the flagellar sigma factor that transcribes genes involved in flagellum formation. - **σ32:** the heat shock sigma factor that transcribes genes when bacteria are exposed to heat -- only synthesised under env stress allowing certain genes to be expressed - **σ38:** the starvation sigma factor -- only synthesised under env stress allowing certain genes to be expressed - Subunits play distinct functional roles  **How holoenzyme aids in transcription?** 1. RNA Poly holoenzyme binds loosely to DNA 2. Scans along DNA, until it encounters promoter region 3. Sigma factor recognises both -35 and -10 regions (TATA boxes) a. Region within sigma factor that contains helix-turn-helix structure is involved in tighter binding to DNA 4. Transcription begins **Translation in BACTERIA** **Three main elements:** - Codons - tRNA - ribosomes **Codons:** **Genetic code:** 1. translation of the mRNA codons into amino acid sequences leads to the synthesis of proteins. 2. Only structural genes that are transcribed into messenger RNA (mRNA) will be translated. 3. Translation relies on the genetic code written in sets of 3 nucleotides known as [codons] a. Genetic code can be expressed as either RNA or DNA codons A close-up of a dna Description automatically generated 4. codons are degenerate, the "wobble" 3rd position. 5. Translation requires the co-ordinated functions of mRNA, [tRNA] and rRNA, in complex with [ribosomes] How can 3 nucleotides encode 20 amino acids? - 1 nucleotide/amino acid = 4^1^ = 4 combinations - 2 nucleotides/amino acid = 4^2^ = 16 combinations - 3 nucleotides/amino acid = 4^3^ = 64 combinations - Must be at least 3-letter codon that code for each amino acid (Why cannot have many nt in codon? To conserve energy) Discovery of the genetic code - Extracts from bacterial cells consisting of all components required for protein synthesis (ribosomes, tRNAs, amino acids, GTP, etc) - Treat the extracts with DNase - To prevent the synthesis of RNA before addition of synthetic RNA - Why not RNase? Do not want to degrade other types of RNA req for translation e.g. tRNA, rRNA - Addition of synthetic RNA to DNase-treated extracts from bacteria cells restores polypeptide synthesis - Synthetic mRNA and in vitro translation determines which codons designate which aa e.g. evidence that UUU codes for Phe - Polymononucleotides - Polydinucleotides e.g AU/AU/AU - Polytrinucleotides e.g ACC/ACC/ACC - Polytetranucleotides Read amino acid sequence and deduced codons  Wobble 3^rd^ position - Can change nucleotide in 3^rd^ position and aa will remain the same - Why is the 3^rd^ position wobble? - On going research - To lessen amino acid-coding codons as only 45 tRNA species - 61 amino acid-coding codons & 45 tRNA species **tRNA** A diagram of a structure Description automatically generated Two functions: 1. Recognizing a 3-base codon in mRNA 2. Carrying an amino acid that is specific for that codon a. Amino acid incorporated into nascent protein  Discovery: - Francis Crick predicted its presence in 1955 - Proteins are made on ribosomes. - Amino acids are found in cytosol. - Some adaptor molecule must be able to bring the amino acids to the growing polypeptide chains on the ribosomes. - In 1958, Zamecnik and Hoagland discovered tRNA. - A cell-free system, i.e. partially purified ribosomes. - Monitor 14C-labelled free amino acids incorporation into newly synthesized proteins. - Noticed a population of soluble RNA became labeled with 14C amino acids, before the 14C-label was found in proteins. **OVERVIEW of translation in bacteria:** [Charging of tRNA] - enzymes that attach amino acids to tRNAs are known as [aminoacyl-tRNA synthetases] - 45 different tRNA 45 diff aminoacyl-tRNA synthetases - amino acid is attached to the 3' end of the tRNA by an ester bond. - Aminoacyl-tRNA synthetases ensure that each tRNA is charged with the correct amino acid. (low error rate: 1/40,000) A diagram of a cell culture Description automatically generated [Synthesis and assembly of ribosome components] - Occurs in cytoplasm in bacterial cells  A diagram of a human brain Description automatically generated [Initiation] - binding of mRNA to the 30S subunit (small subunit) is facilitated by a [ribosomal-binding site] or [Shine-Dalgarno sequence] - sequence highly conserve (able to distinguish bet diff species based on seq) - Shine-Dalgarno seq complementary to seq in 16S rRNA of 30S ribosomal small subunit - to know which AUG is the start codon (the one closest to Shine-Dalgarno seq) - initiation factors (e.g. IF2, IF3) promote binding of initiator tRNA & mRNA  - association of initiator tRNA, small and large ribosomal subunits and mRNA form a complex - initiator tRNA binds to AUG start codon at P site of ribosome A diagram of a human brain Description automatically generated [Elongation] - chain elongation begins with binding of tRNA, which recognises the next codon in mRNA, to A site of ribosome - mRNA is [read from 5' to 3' direction] - polypeptide synthesised [from amino end to carboxyl end] - [condensation] reaction where water molecules released - [peptidyl transferase] forms peptide bond between growing chain of aa  A diagram of a chemical reaction Description automatically generated [Termination] - stop/nonsense codon appears in A site - UAG, UAA, UGA (u are good, u are awesome, u are good and awesome) - Codons not recognised by tRNAs, but by proteins called release factors - Release factors mimic structure of tRNAs  - since no tRNA corresponding to stop codon, release factor binds in A site **Polypeptides:** - 20 amino acids that may be found in polypeptides - Each contains the [same backbone] and a [different side chain, or R group] - R groups determine biochem properties & folding - Non-polar amino acids are hydrophobic - Often buried within interior of folded proteins - Non-polar/hydrophobic R group - Polar amino acids are hydrophilic - More likely to be on surface of proteins - R groups are hydrophilic A diagram of different types of chemical formulas Description automatically generated **Coupling of tranlsation and transcription in bacteria** - Bacteria lacks membranous compartnments (unlike eukaryotes) -- has other form of sub-cellular ogranisaiton - Bacteria [lacks nucleus] - both transcription and translation occur in cytoplasm - as soon as mRNA strand long enough, ribosome will attach to 5' end - [coupling]: translation begins before transcription ends - [polyribosome] or [polysome:] mRNA transcript that has many bound ribosomes in the act of translation  - RNA transcript becomes longer as RNA polymerase moves from start to end of gene - Protein chain becomes longer as ribosome moves from 5' end to 3' end of Mrna **Questions** - **Given the following coding strand sequence 5'-GAATCTTATCC-3', what is the template strand sequence? The RNA transcript sequence?** Template strand sequence: 3' -- CTTAGAATAGG-5' RNA transcript sequence: 5'-GAAUCUUAUCC-3' - **What are the differences between prokaryotic transcription and eukaryotic transcription processes (initialization, elongation, termination and modification)? How about translation?** (refer to Lecture 4) - **Consider the actions of RNA polymerase II and polyA polymerases. What do they share in common, and how are they different?** RNA Polymerase II and Poly A polymerases both produce RNA sequences using nucleoside triphosphates. RNA Poly II produce seq with different nucleotides vs polyA polymerase only produce Adenine nuceltoides. RNA Poly II uses a DNA template (DNA dependent RNA Poly) vs polyA polymerase does not use template. ChatGPT: **Similarities:** - **Nucleotide Addition**: Both enzymes add nucleotides to a growing RNA strand. RNA polymerase II synthesizes RNA by adding ribonucleotides complementary to the DNA template, while poly(A) polymerase adds adenine nucleotides to the 3\' end of the pre-mRNA. - **Role in Transcription/Processing**: Both are involved in the post-transcriptional modification of mRNA, contributing to the maturation of the mRNA molecule before it is translated into protein. - **Use of NTPs**: Both enzymes utilize nucleoside triphosphates (NTPs) as substrates. RNA polymerase II uses ATP, UTP, CTP, and GTP to synthesize RNA, while poly(A) polymerase specifically uses ATP to add adenine residues. **Differences:** - **Function**: - **RNA Polymerase II**: Primarily responsible for synthesizing messenger RNA (mRNA) from a DNA template during transcription. - **Poly(A) Polymerase**: Specifically adds a poly(A) tail to the 3\' end of the pre-mRNA after transcription is complete, which is important for mRNA stability, nuclear export, and translation. - **Mechanism**: - **RNA Polymerase II**: Moves along the DNA template, unwinding the DNA strands and incorporating complementary RNA nucleotides based on the DNA sequence. - **Poly(A) Polymerase**: Lacks a template; it catalyzes the addition of multiple adenine residues directly to the 3\' end of the RNA without needing a DNA template. - **Location and Timing**: - **RNA Polymerase II**: Functions in the nucleus during the transcription phase. - **Poly(A) Polymerase**: Acts after transcription in the mRNA processing phase, also within the nucleus. - **Describe the role of tRNA and the role of aminoacyl-tRNA synthetase in translation** tRNA binds to correct amino acid to be incorporated into chain and anticodon of tRNA c.b.p with codon of mRNA transcript to be translated aids in translation. Aminoacyl-tRNA synthetase binds correct amino acid to correct tRNA. ChatGPT: ChatGPT: **tRNA (Transfer RNA):** 1. **Function**: tRNA serves as the adaptor molecule that translates the genetic code from mRNA into the amino acid sequence of proteins. Each tRNA molecule is specific to one amino acid and has a corresponding anticodon that pairs with a codon on the mRNA. 2. **Structure**: tRNA has a characteristic cloverleaf structure, which includes an anticodon loop and an acceptor stem. The anticodon is a three-nucleotide sequence that base-pairs with a complementary codon on the mRNA, while the acceptor stem is where the specific amino acid is attached. 3. **Amino Acid Delivery**: During translation, tRNA transports the appropriate amino acid to the ribosome, where the mRNA is being translated. The tRNA recognizes the codon on the mRNA through its anticodon, ensuring that the correct amino acid is incorporated into the growing polypeptide chain. - **Activation**: The enzyme binds to the amino acid and ATP, leading to the formation of an aminoacyl-adenylate intermediate and the release of pyrophosphate. - **Charging**: The enzyme then transfers the activated amino acid to the 3\' end of the appropriate tRNA, forming an aminoacyl-tRNA. This charged tRNA is now ready to participate in translation - **tRNA** brings amino acids to the ribosome, matching them with the codons in the mRNA through its anticodon. - **Aminoacyl-tRNA synthetase** ensures that each tRNA is charged with the correct amino acid, maintaining the fidelity of protein synthesis. A close-up of a letter Description automatically generated  A close-up of a white board Description automatically generated L4 (viral replication + eukaryotes vs prokaryotes): =================================================== **Variations in the Central Dogma** **Prokaryotes**: circular DNA genome, ds (e.g. Archaea, bacteria) **Eukaryotes**: linear DNA genome, ds **Virus**: DNA or RNA genomes - single-stranded or double-stranded - circular or linear **How would virus replicate its genome?**  [Viral RNA genome] - ss Positive strand virus (sense strand virus) - The genome RNA is also the mRNA - Can be used by host ribosomes to translate - Ss Negative strand virus (antisense strand) - Has to first be converted to sense RNA strand to be translated - \*Double-stranded RNA virus [RNA Polymerase for viral replication] 1. Replicase -- **RNA dependent** RNA Polymerase (e.g. SARS-CoV2) e.g. SARS-Cov 2: (+) strand; Whole virus endocytosed - Replicase made from SARS-Cov 2 (+) strand - SARS-Cov 2 (+) strand and other mRNAs made from replicase A diagram of a cell Description automatically generated 2. Reverse transcriptase - RNA-dependent DNA Polymerase - Converts ss RNA to RNA-DNA duplex (hybrid) - RNase - Degrade only RNA (leaving ss DNA) - DNA-dependent DNA Polymerase - Use ss DNA to form complementary DNA becomes ds DNA e.g. HIV viruses -- cause hepatitis - (+) strand RNA virus -- encodes for - Reverse transcriptase -- converts ss RNA to ds DNA - Integrase -- integrates ds DNA into host genome - whole virus endocytosed  - A diagram of a dna sequence Description automatically generated **Transcription and Translation in Eukaryotes vs Prokaryotes** +-----------------------------------+-----------------------------------+ | **In Eukaryotes** | **In Prokaryotes** | +===================================+===================================+ | Larger organisms | Smaller organisms | | | | | - more proteins, more genes | | +-----------------------------------+-----------------------------------+ | Cellular complexity | Less cellular complexity (no | | | compartmentalisation) | | - cell compartmentalisation | | | | | | - bound by membrane e.g. | | | nucleus that bounds genetic | | | material) | | +-----------------------------------+-----------------------------------+ | Multicellularity | Single cell | | | | | - different cell, different | | | transcripts and proteins | | | made) | | +-----------------------------------+-----------------------------------+ | Transcription in nucleus and | Coupling of transcription and | | translation in cytosol/RER -- | translation in cytosol | | separated in space & time | | +-----------------------------------+-----------------------------------+ | **Transcription** | | +-----------------------------------+-----------------------------------+ | Extensive processing of primary | No processing of mRNA transcript | | RNA transcripts before exporting | before export | | of mRNA from nucleus to cytoplasm | | | | | |  | | +-----------------------------------+-----------------------------------+ | 3 types of RNA Polymerases: | One RNA Poly | | | | | - RNA pol I | | | | | | - Transcribes all rRNA | | | genes (except for the 5S | | | rRNA) | | | | | | - [RNA pol II] | | | | | | - Transcribes all | | | structural genes Thus, | | | synthesizes all mRNAs | | | | | | - Transcribes some snRNA | | | genes | | | | | | - RNA pol III | | | | | | - Transcribes all tRNA | | | genes | | | | | | - And the 5S rRNA gene | | | | | | All three similar structurally | | | and composed of many subunits. | | | | | | Similarity between bacterial RNA | | | Poly & eukaryotic counterparts. | | +-----------------------------------+-----------------------------------+ | Core promoter has many elements | Only two elements of promoters | | | (-10 & -35 box) | | \+ upstream/at/downstream of | | | transcription start site | \+ upstream of transcription | | | start site | | \+ has enhancers/silencers that | | | affect binding of RNA poly to | \+ no enhancers/silencers that | | promoters | affect binding of RNA poly to | | | promoters | |  | | | | | | - Each element binds to a | | | general transcription factor. | | | | | | - Basal transcription: core | | | promoter by itself produces a | | | low level of transcription | | | | | | - additional regulatory | | | elements affect the binding | | | of RNA polymerase to the | | | promoter | | | | | | - Enhancers- stimulate | | | transcription | | | | | | - Silencers- inhibit | | | transcription | | +-----------------------------------+-----------------------------------+ | RNA Poly II requires [general | Bacterial RNA Polymerase just | | transcription | needs sigma factor | | factors] & other | | | accessory proteins to initiate | | | transcription (more complex) | | | | | |  | | | | | | - presence of transcription | | | [activator | | | protein]s that | | | bind to specific | | | [enhancer] sites | | | determine rate of | | | transcription | | | | | | - [Chromatin remodeling | | | complex] and | | | [histone modifying | | | enzymes] are also | | | required due to the chromatin | | | organization of eukaryotic | | | DNA | | | | | | - [Mediator] | | | coordinates the assembly of | | | all these proteins at the | | | promoter | | +-----------------------------------+-----------------------------------+ | Coupling of transcription and | Coupling of transcription and | | [RNA Processing] | translation | | | | |  | | +-----------------------------------+-----------------------------------+ | More complex regulation | Less complex regulation | | | | |  | | +-----------------------------------+-----------------------------------+ **RNA processing in eukaryotes** [5' capping] - Even [before transcription completed] - mediated by enzymatic complex - 5' cap important for [mRNA stability and translation] [3'poly A tailing] - added enzymatically [after gene completely transcribed] - enzyme recognises polyadenylation signal (consensus sequence: AAUAAA) - endonuclease cleave occurs - polyA-polymerase adds adenine nucleotides (length varies between species) - poly A tail important for [mRNA stability and translation] - **no template** A diagram of a red line Description automatically generated [RNA splicing] - before or after transcription completed - mediated by [spliceosome]: complex of snRNAs (small nuclear RNAs, \ - RNA [Introns are removed] - [exons are connected] by a phosphodiester bond - splicing is highly flexible, allowing exons to be joined together in different ways to form different mRNA products - splicing is still regulated to form diff mRNA polymerase  Discovery: A close-up of a cell Description automatically generated *How is hnRNA/mRNA sequence compared to the original DNA coding strand sequence?* R-looping method: Incubate RNA in ds DNA  - to map regions of DNA that are actively being transcribed locate exons & introns in DNA during RNA splicing (when R loop formed, find out which regions are spliced out?) (in vitro: R loops form during transcription & during replication (when make Okazaki fragments) Incubate RNA in ss DNA: A diagram of dna and dna Description automatically generated with medium confidence - some parts of RNA complementary to DNA & some not some RNA spliced out What is the advantage of splicing? [Alternative splicing] - A pre-mRNA with multiple introns can be spliced in different ways to generate mature mRNAs with different combinations of exons  - This variation in splicing can occur in different cell types or during different stages of development - biological advantage of alternative splicing is that two (or more) polypeptides can be derived from a single gene can convey diff functions - allows an organism to carry fewer genes in its genome e.g. *Drosophila melanogaster gene Dscam has 38,016 potential splice variants.* *Drosophila genome has only \~15,000 genes.* *Dscam encodes a surface glycoprotein on neurons. The splice variants allow each neuron to display a unique set of Dscam proteins, so to guide neural circuit development (each neuron diff)* +-----------------------------------+-----------------------------------+ | **In Eukaryotes** | **In Prokaryotes** | +===================================+===================================+ | **Translation** | | +-----------------------------------+-----------------------------------+ | Eukaryotic ribosomal subunits | Bacterial ribosomal subunits | | slightly larger | slightly smaller | | | | | - except ribosomes in | | | mitochondria and chloroplasts | | | similar to ribosomes in | | | bacteria | | +-----------------------------------+-----------------------------------+ | | | +-----------------------------------+-----------------------------------+ | Translation initiation | Translation initiation | | | | | - usually start codon is first | - Shine-Dalgarno sequence | | AUG after 5' cap | determines AUG that is start | | | codon | | - Both the 5' CAP and 3' polyA | | | are involved in binding to | | | initiation factors (eIFs) and | | | assembly of tRNA | | | mRNA-ribosome complex | | | | | | - Kozak's rule (if multiple AUG | | | near 5' end): | | | | | | If [-3 position has an A or | | | G] AND [+4 | | | position has a G] | | | corr AUG is likely to be | | | start codon | | | | | |  | | +-----------------------------------+-----------------------------------+ | Translation termination | Translation termination | | | | | - One release factor eRF -- | - Three release factors | | recognises UAG, UAA, UGA | | | | - RF1 -- recognises UAA and | | | UAG | | | | | | - RF2 -- recognises UAA and | | | UGA | | | | | | - RF3 -- does not recognise | | | any of the three codons | | | | | | - Binds GTP and helps | | | facilitation | | | termination | +-----------------------------------+-----------------------------------+ **Summary**  A diagram of a cell division Description automatically generated Close-up of bacteria Description automatically generated  A close-up of a text Description automatically generated  L5 (forward genetics): ====================== **Study Gene Expression and Function** ***Why do different cell types arise from the same genome?*** - Gene expression is tightly regulated, in space & time - **Transcriptional** - *Activators/repressors (transcriptional factors)* that bind to *enhancers/silencers* differently differential gene expression: different transcription factors expressed in diff parts of body or different times \[mRNA of diff [abundance\]] - **Post-transcriptional** - *Alternative mRNA splicing:* diff exons connected together \[mRNA of diff [forms\]] - **Post-translational** - Co-translational protein folding (folding happens during translation) determines tertiary structure - *Hydrophilic aa* -- facing cytosol - *Hydrophobic aa --* buried in interior of protein Diagram of a protein folding diagram Description automatically generated - Cofactor binding (non-covalent interactions) e.g. bivalent metals needed for enzymes - Covalent modification by glycosylation, phosphorylation, acetylation, etc, - Bidning to other protein subunits ***Mutations*** [Error rate]  - Why are there higher error rates in transcription and translation than replication? - Have not discovered repair/proofreading mechanisms in RNA/protein + degradation(?) ChatGPT: **1. Proofreading Mechanisms:** - **DNA Replication**: DNA polymerases have robust proofreading abilities. They possess 3\' to 5\' exonuclease activity, allowing them to detect and correct errors during replication. This significantly reduces the error rate. - **Transcription**: RNA polymerases lack extensive proofreading capabilities. While they can correct some mistakes, the efficiency is much lower than that of DNA polymerases, leading to a higher error rate in RNA synthesis. **2. Template Stability:** - **DNA Replication**: The DNA double helix is stable, providing a clear template for replication. The fidelity of base pairing is high, and the structural integrity of the DNA helps minimize errors. - **Transcription and Translation**: RNA is single-stranded and more susceptible to structural variations. Additionally, during translation, the mRNA is translated by the ribosome, where the interaction between the mRNA codon and the tRNA anticodon can be less stringent, allowing for mistakes. **3. Enzyme Complexity:** - **RNA Polymerase vs. DNA Polymerase**: RNA polymerases are simpler enzymes compared to DNA polymerases. They do not have the same level of complexity in their active sites for error checking, which contributes to their higher error rates. - **Ribosome Function**: The ribosome, responsible for translation, relies on the matching of tRNA anticodons to mRNA codons. While there is some degree of selectivity, it is not as stringent as the base-pairing fidelity seen during DNA replication. **4. Biological Context:** - **Gene Expression Regulation**: Transcription and translation are tightly regulated processes that can be influenced by various factors, including cellular conditions and the need for rapid responses to environmental changes. This flexibility may come at the cost of increased error rates. - **Amino Acid Tolerance**: The genetic code is redundant, meaning that multiple codons can specify the same amino acid. This redundancy allows some level of error in translation without drastically affecting the final protein\'s function, further contributing to a higher tolerance for mistakes. - Transcription/translation errors be left unrepaired and degraded -- why not DNA? - DNA is genetic material -- more important to have lower error rate (?) ChatGPT: **Nature of the Errors:** - **Transcription and Translation**: Errors in transcription (such as incorrect RNA nucleotides) or translation (incorrect amino acids) can lead to the production of faulty proteins. However, cells often have mechanisms to deal with these errors, such as degrading misfolded proteins or using them in a regulated manner. Since RNA and proteins are transient molecules, the potential impact of errors is often manageable. - **DNA Replication**: Errors in DNA replication can lead to permanent mutations in the genetic material. If these mutations are not repaired, they can be passed on to daughter cells during cell division, potentially leading to long-term consequences like diseases, including cancer. **2. Repair Mechanisms:** - **DNA Repair**: Cells have evolved extensive repair mechanisms for DNA, including proofreading by DNA polymerases and various repair pathways (like base excision repair and mismatch repair) that can correct errors. These mechanisms are crucial for maintaining genomic integrity and preventing mutations from being propagated. - **RNA and Protein Quality Control**: While there are mechanisms for monitoring RNA and protein quality (like nonsense-mediated decay for faulty mRNA and chaperones for misfolded proteins), the expectation is that any errors will be transient. Therefore, there is less emphasis on repairing RNA or correcting protein errors, as they are often eventually degraded. **3. Functional Implications:** - **Transitory Nature of RNA and Proteins**: RNA is not meant to be a permanent fixture; it is synthesized, used, and then degraded. Similarly, proteins have a finite lifespan within the cell. This means that the impact of errors in these processes is often limited to specific instances rather than having lasting repercussions. - **DNA's Role as Genetic Blueprint**: DNA serves as the long-term repository of genetic information. Any errors here can affect future generations of cells, making it crucial for the cell to maintain the accuracy of DNA replication and repair any errors that arise. [Sources of mutation] - **Chemicals and free radicals** - can cause point mutations e.g. ethylmethanesulfonate (EMS) - In coding sequence: - *nonsense* (introduce a premature stop codon) - OR *mis-sense* (cause an amino acid replacement) - In noncoding sequence: affecting splicing signals or regulatory elements that control gene expression Pros Cons ---------------------------------------------------- ------------- Allows for many diff mutations within gene regions Diff to map - **Irradiation (X-ray or UV) -- high energy** - X-ray can cause *breaks in double-stranded DN*A - large *deletions* of pieces of chromosome OR - *chromosomal re-arrangements OR* - *base changes of nucleotides* - more serious mutations +-----------------------------------+-----------------------------------+ | Pros | Cons | +===================================+===================================+ | Easy to map by cytological | Not limited to single genes | | examination of chromosomes | | | | - Not good for fine-scale | | | mutagenesis | +-----------------------------------+-----------------------------------+ - **Transposons or viruses that insert into random places in the genome** - Transposable elements (TEs) (jumping gene) or viruses e.g. retroviruses can - insert within a *coding* region disrupt the amino acid sequence nonfunctional protein OR - insert into neighboring non-coding DNA affect intron splicing or gene expression (transcription & translation) +-----------------------------------+-----------------------------------+ | Pros | Cons | +===================================+===================================+ | Easy to map -- find out which | | | gene is disrupted by finding out | | | where transposon inserted | | | | | | Easy to clone region of genome | | +-----------------------------------+-----------------------------------+ [Type of mutation] **Chromosomal mutations** - large fragments of DNA mutated - have serious mutations drastic phenotype changes **DNA mutations** - **Point mutations** - **Deletions** - **Insertions** **\*indel mutations**: insert or delete may cause **frameshift mutation:** shifting of how codons are read (more serious mutation) ***Study of gene function and expression*** Mostly a study of gene's protein products  A diagram of a diagram of a variety of genetic modification Description automatically generated with medium confidence - **Forward genetics (classic genetics)** - *From phenotype to gene(s) responsible for phenotype* - Phenotype usually of medical or commercial interests e.g. diseases, pathogen virulence, drug resistance, etc. (usually mutant phenotype) - E.g. phenotype: drug resistance find genes responsible for drug resistance - Phenotype easily 'screened' by counting, imaging or other biochemical tools 1. Generate a [mutant library] w **random** mutations 2. Screen library for particular phenotype & identify few mutants that show desired phenotype (e.g. screening for penicillin resistant bacteria add penicillin to bacterial culture) 3. In selected mutants, find out which gene(s) are mutated 4. Clone & obtain the sequence of the gene(s) - Efficient screening is rate-limiting step  - Inherited, neurological disorder - Premature death of some types of neuron loss of control of movement and mental/behavioral changes - Late-onset disease: begins to show \~40-50, and becomes progressively worse over time - *Autosomal dominant trait --* disease as long as inherit one copy of gene (i.e. mutant allele) - found through analyses of the pedigrees of families with the disease -- linkage analysis - Venezuela family with 18,149 individuals spanning 10 generations was identified in 1970's - Discovery - 1983: **DNA polymorphism** between family members with Huntington's disease and those without was found to be located to a region (\~4Mb) on human chromosome **4** large region, not precise location - eventually identify the single Huntington's gene in 1992, on chromosome 4 from base pair 3,074,510 to base pair 3,243,960 - - What happens to Huntington's gene in patients with the disease? - Among the first human diseases with causal genes mapped and cloned - WT phenotype: HD gene contains 9-35 **CAG repeats**: CAG codes for **glutamine** (9-35 copies of glutamine) - Function of WT HD protein not clear - HD phenotype: HD gene contains \36 repeats (\~250 the highest) (\>36 copies of glutamine) - Mutated HD proteins form *aggregates in neuron cells* & cause *neuronal cell death* - Proteosome no longer as functional in old cells to remove protein aggregation A table with text on it Description automatically generated - So, genomic sequencing of model organisms - People started using ['reverse genetics']  *Human genome* - \~3.2x109 base/haploid genome (many repeats at the end of genome hard to seq) \~8-9% of human genome is derived from viral DNA (may be due to viral infections in the past) \~20,000 genes coded by the human genome, much less than previously estimated (\~100,000) due to alternative splicing - [Protein-coding genes]: make up only \~1.5% of the genome - [Non-coding DNA: ] - International project ENCODE (encyclopedia of DNA elements) - RNA products, regulatory elements that control the expression of genes, etc. - From person to person, the difference in genome is \~0.2%, and many differences are present in the form of [Single Nucleotide Polymorphisms (SNPs)] - Can disease be predicted based on genome information? Genome-wide association study (GWAS), focuses on associations between SNPs and major diseases - **Reverse genetics** - *From genes to phenotype* - E.g. have nucleotide/amino acid sequence find out function of such genes/aa seq phenotype **Questions** 1. Unlike DNA, RNA and proteins do not have a repair mechanism (at least not known yet) that allows wrong nucleotides or amino acids to be corrected. Why is that OK? - DNA is genetic material -- more important to have lower error rate for genetic material - RNA and proteins with wrong nucleotides or amino acids will be targeted for degradation instead ChatGPT: **Nature of the Errors:** - **Transcription and Translation**: Errors in transcription (such as incorrect RNA nucleotides) or translation (incorrect amino acids) can lead to the production of faulty proteins. However, cells often have mechanisms to deal with these errors, such as degrading misfolded proteins or using them in a regulated manner. Since RNA and proteins are transient molecules, the potential impact of errors is often manageable. - **DNA Replication**: Errors in DNA replication can lead to permanent mutations in the genetic material. If these mutations are not repaired, they can be passed on to daughter cells during cell division, potentially leading to long-term consequences like diseases, including cancer. **2. Repair Mechanisms:** - **DNA Repair**: Cells have evolved extensive repair mechanisms for DNA, including proofreading by DNA polymerases and various repair pathways (like base excision repair and mismatch repair) that can correct errors. These mechanisms are crucial for maintaining genomic integrity and preventing mutations from being propagated. - **RNA and Protein Quality Control**: While there are mechanisms for monitoring RNA and protein quality (like nonsense-mediated decay for faulty mRNA and chaperones for misfolded proteins), the expectation is that any errors will be transient. Therefore, there is less emphasis on repairing RNA or correcting protein errors, as they are often eventually degraded. **3. Functional Implications:** - **Transitory Nature of RNA and Proteins**: RNA is not meant to be a permanent fixture; it is synthesized, used, and then degraded. Similarly, proteins have a finite lifespan within the cell. This means that the impact of errors in these processes is often limited to specific instances rather than having lasting repercussions. - **DNA's Role as Genetic Blueprint**: DNA serves as the long-term repository of genetic information. Any errors here can affect future generations of cells, making it crucial for the cell to maintain the accuracy of DNA replication and repair any errors that arise. 2. The same number of yeast cells are cultured in two flasks. Flask 1 contains only cultivation medium; and flask 2 contains medium as well as a drug that can kill all cells except for those that are resistant mutants. Both flasks are allowed to grow for two days so that cells have gone through several rounds of cell division. Same number of yeast cells were collected from each flask and spread on agar plates, with or without the drug. Yeast cells collected from Flask 2 can grow on agar plates with or without the drug. But for yeast cells collected from flask 1, a few colonies are also found on the agar plate with drug. How would you explain this? - Evolution has occurred where a few strains from flask 1 were resistant to the drug due to a mutation, able to survive and reproduce and pass on their drug-resistant trait to offspring thus a few colonies from flask 1 were able to survive on the agar plate with drugs **ChatGPT said:** Your explanation touches on the concept of mutation and natural selection, which is central to understanding how some yeast cells in Flask 1 could survive the drug treatment. Here's a more detailed breakdown of the situation: **Context of the Experiment:** 1. **Flask 1**: Contains only cultivation medium. All yeast cells in this flask are subjected to normal growth conditions without any selective pressure from a drug. 2. **Flask 2**: Contains a drug that kills all yeast cells except those that have developed resistance. This environment creates a strong selective pressure for resistant mutants. **Observations:** - Yeast cells from **Flask 2** can grow on agar plates with and without the drug because they are the resistant mutants that survived the selective pressure imposed by the drug. - Yeast cells from **Flask 1** show a few colonies on agar plates with the drug, which is unexpected since they were not exposed to the drug during their growth phase. **Explanation:** 1. **Mutation**: It's important to recognize that mutations can occur spontaneously in any population. In Flask 1, a few yeast cells may have had pre-existing mutations that provided resistance to the drug, even though they were not exposed to it during the two days of growth. 2. **Natural Selection**: The cells that are resistant to the drug in Flask 1 could survive when exposed to the drug on the agar plates. This suggests that while the drug was not present in Flask 1, some cells still carried mutations that conferred resistance. When these cells were plated on agar containing the drug, they had the opportunity to survive and proliferate. 3. **Chance**: The fact that only a few colonies from Flask 1 are able to grow in the presence of the drug indicates that the mutation conferring resistance was rare. The presence of these few resistant strains demonstrates the randomness of mutation and how chance events can result in survival under selective conditions. A close up of a piece of paper Description automatically generated  L6 (reverse genetics): ====================== **Forward Genetics** **Reverse Genetics** ---------------------- ----------------------- Random manipulation Specific manipulation **Reverse Genetics** - gene with known sequence but unknown function - Find all functions that requires the gene-of-interest - specific manipulation of the gene-of-interest - characterize phenotypic changes associated with different gene manipulations [Gene-specific modifications] 1. Alter the level of expression of the gene-of-interest (and observe the phenotypic changes when the gene function is absent or upregulated) - Reduce expression: some or all alleles of the gene are disrupted in the genome, thus less or no RNA/protein product is produced from this gene - Weak promoter - Disrupt one or more copies of genomic DNA for the gene of interest, usually 'knockout' - RNA interference (RNAi) - Overexpression: produce more protein product is produced from this gene - Add more copies of DNA coding sequences for the gene of interest - Put the gene of interest under control of a strong promoter - Remove silencer (remove inhibitory regulation) - Add more enhancer 2. Tag the gene-of-interest with a reporter (e.g. Gren Fluorescent Protein) - Observe when & where the protein product is made (localisation) - Dynamic behaviour of the protein in LIVE cells 3. Site-directed mutations to certain parts of the gene e.g. gene editing - change a small region in the gene and observed changes in activity, useful for genes with multiple functional domains. **Alter the level of expression of the gene-of-interest (and observe the phenotypic changes when the gene function is absent or upregulated)** A diagram of a diagram of a four leaf clover Description automatically generated [Reduce expression]: some or all alleles of the gene are disrupted in the genome, thus less or no RNA/protein product is produced from this gene - Weak Promoter - Disrupt one or more copies of genomic DNA for the gene of interest, **usually 'knockout' (through homologous recombination)** - Start with 2 copies of gene of interest, one on each homologous chromosomes - Engineer DNA fragment containing DRUG-resistant gene(pink), flanked by *terminal fragments from the gene of interest (blue)* (identical sequence as gene of interest) - Homologous recombination occurs where one copy of gene of interest replaced by DRUG-resistant gene(pink) - Fragment of gene of interest that is replaced cannot replicated by itself - End with one copy of gene of interest and one copy of DRUG-resistant gene(pink) continues to replicate BUT less of protein product of gene of interest  Limitation: - If want to replace 2 copies, must do knockout 2 times time-consuming - Organisms might die after knock-out genes cannot be studied Solution: - Discovery of RNAi - **RNA interference (RNAi)** - Involved specific degradation of (m)RNA A diagram of a dna molecule Description automatically generated - In-vivo function: defense mechanism where any viral genome that looks "viral" /abnormal will be degraded & cell will degrade anything that looks like the viral genome - Engineer functions: - Used to turn off bad genes that cause diseases - To study function of gene (when it does not work) [Overexpression]: produce more protein product is produced from this gene - Add more copies of DNA coding sequences for the gene of interest - Put the gene of interest under control of a strong promoter - Remove silencer (remove inhibitory regulation) - Add more enhancer **Tag the gene-of-interest with a reporter (e.g. Gren Fluorescent Protein)** - Observe when & where the protein product is made (localisation) - Dynamic behaviour of the protein in LIVE cells [Green Fluorescent Protein]  - \~28KDa - Tight beta-barrel - Requires no co-factor - Derived from jellyfish - Used as marker for gene expression - E.g. reporter when want to express foreign gene in target organism Limitation: GFP does not fluoresce as bright compared to WT Thus... [To increase GFP expression] - Change codon to more efficiently be read improve translocation efficiency of GFP brighter expression - Insert 'GTG' to fulfil the Kozak's rule A screenshot of a computer Description automatically generated e.g. recombinant-GFP tubulin - Combine GFP and tubulin - Remove stop codon for tubulin so that translation will include GFP and tubulin into one protein product - Remove start codon of GFP  **Site-directed mutations to certain parts of the gene e.g. gene editing** - change a small region in the gene and observed changes in activity, useful for genes with multiple functional domains. Genome editing utilises DSB DNA Repair mechanisms (uses homologous recombination) - Zinc finger nucleases (ZFNs) - Transcription activator-like effector nucleases(TALENs) - CRISPR/CAS9 Repair mechanisms for double strand breaks A screenshot of a computer Description automatically generated For the three genome editing techniques above, how to introduce foreign genes into living cells? - Incubate recombant plasmid with host cell  - Transformation: uptake of foreign DNA - Microinjection (inject DNA, mRNA or proteins into a cell) A close-up of a faucet Description automatically generated  e.g. transgenic animals -- fluorescent monkeys and fish e.g. GE plants e.g. transgenic plants and GM food A collage of pictures of food Description automatically generated **Genetic projects shifted to reverse genetics** - Due to lower cost of genome sequencing  A close-up of a computer screen Description automatically generated **Forward genetics is back**  **Limitations:** - 3 and 4 time-consuming genomic sequencing to produce random mutants at a faster rate This is reverse genetics? A diagram of a dna Description automatically generated with medium confidence RNA (or mRNA) can be sequenced too, directly or after being converted to DNA - To study gene expression e.g. in different cell types  **Rate of gene transcription and mRNA translation different for each gene** - The most direct way to analyse gene expression: analyse proteins A diagram of dna and protein Description automatically generated - Each gene produces 3-6 final modified proteins - Post-translational modifications (PTMs) - Alternative splicing - A single genome can give rise to different proteomes depending on variables such as cell/developmental cycle, stress response, pathological conditions - Genomes are static, but proteomes are dynamic