BIOL1XX8_2024_L24_Genetic disorders.pdf

Genetic disorders Lecture 24 BIOL1XX8/MEDS001 Human Biology Dr. Hong Dao Nguyen School of Life and Environmental Sciences Learning objectives Distinguish between autosomal dominant, autosomal recessive, X-linked recessive, X-linked dominant and Y-linked modes of inheritance. Predict the pro...

Genetic disorders Lecture 24 BIOL1XX8/MEDS001 Human Biology Dr. Hong Dao Nguyen School of Life and Environmental Sciences Learning objectives Distinguish between autosomal dominant, autosomal recessive, X-linked recessive, X-linked dominant and Y-linked modes of inheritance. Predict the probability of an offspring’s genotype and phenotype for autosomal and sex- linked traits and disorders Determine the phenotype and genotype of individuals in a pedigree for autosomal and sex- linked traits and disorders Describe the role of sex chromosomes in human sex determination Explain how X chromosome inactivation can lead to haemophilia manifestation in female carriers Key terms = blue Terms for your own interest = pink Sickle cell disease: an autosomal recessive disorder Mutation in HBB gene resulting in abnormal haemoglobin beta subunit Heterozygotes exhibit the sickle cell trait and are carriers of the abnormal allele – Half of haemoglobin is normal – Mixture of normal and sickle red blood cells (co-dominant phenotype) – Lower blood oxygen levels (incomplete phenotype) Images from Adobe Stock Carrier: an individual who has a heterozygous genotype and can pass on an allele associated with a recessive trait or disease. - May have unaffected phenotypes or Normal red blood cell Sickle cell red blood cell exhibit disease symptoms of varying severity Images modified from http://www.publicdomainfiles.com  Why does the sickle cell allele persist in human populations? Sickle cell disease (recessive phenotype) affects millions of people worldwide – Major symptom is severe pain from obstruction of blood flow Heterozygous individuals (sickle cell trait phenotype) have greater resistance to malaria – Malaria infected red blook cells tend to sickle à removed by macrophages Image from Piel et al. (2010) Nature Communications https://doi.org/10.1038/ncomms1104 Pedigrees A family tree indicating the presence of absence of a trait for each member Conventions Unaffected male Unaffected female Affected male Affected female Pedigree question Q3. The son of Anne and Rob has sickle cell disease (recessive phenotype). What is the genotype of Anne? A. Homozygous dominant B. Heterozygous Anne Rob C. Homozygous recessive D. Not sure = affected male = affected female = unaffected male = unaffected female Huntington’s Disease: an autosomal dominant disorder Healthy individuals are homozygous recessive Affected individuals are homozygous dominant or heterozygous Normal alleles of the HTT gene encodes for a normal HTT protein Normal protein …CAGCAGCAGCAGCAGCAG… 7-35 trinucleotide repeats Mutant alleles characterised by additional CAG repeats in the sequence Protein prone to misfolding …CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG… >40 trinucleotide repeats How does the abnormal HTT allele persist in human populations? Affected individual passes ~20 years after onset of symptoms Symptoms manifest between 30-45 years of age – Patients may have had children before diagnosis Rare cases of disease manifesting in children Worldwide prevalence varies – 5-7 people per 100,000 affected in Western countries Highest incidence in Lake Maracaibo region, Venezuela – 18, 000 individuals over 10 generations affected Q4. Huntington’s Disease is an autosomal dominant disorder. If a child has a 50% chance of inheriting Huntington’s Disease, what are the genotypes of the parents? Let’s say: h is the normal allele for the HTT gene H is the abnormal allele for HTT gene Genotype of Parent 1 A. HH and hh Genotype of Parent 2 B. Both are hh C. Both are Hh D. Hh and hh Autosomes and Sex chromosomes Homologous chromosomes Most of our cells are diploid - 2 sets of chromosomes Chromosomes 1-22 are autosomes - don’t determine our sex - Homologous X and Y chromosomes are the sex chromosomes - X and Y are not homologous Key Orange = inherited maternal chromosome Blue = inherited paternal chromosome 23rd pair are the sex chromosomes or X/X Image modified from Wikimedia Sex determination Sex in humans is determined by X and Y chromosomes Sex determining region on the Y chromosome (SRY gene) is responsible for the initiation of male sex determination Orange = inherited maternal chromosome Blue = inherited paternal chromosome X/X X/Y Female human Male human Image modified from Wikimedia Commons https://www.nature.com/scitable/topicpage/genetic-mechanisms-of-sex-determination-314/ Sex linked disorders X-linked dominant – Let’s say the A represents the abnormal allele while a represents the normal allele – Affected females can have a homozygous dominant (XAXA) or heterozygous genotype (XAXa) – Affected males are hemizygous (XAY) i.e. one abnormal allele is sufficient to cause the disorder – e.g Rett syndrome, hypophosphatemic rickets X-linked recessive – Let’s say a represents the abnormal allele while A represents the normal allele – Affected females have a homozygous recessive genotype (XaXa) – Affected males are hemizygous (XaY) – Heterozygous females are carriers Y-linked – Abnormal allele exists on the Y chromosome and can only be passed from father to son Red-green colour blindness: an X-linked recessive disorder Insensitivity to green light resulting from mutations in the OPN1LW or OPN1MW gene Abnormal opsin pigments in cone cells of retina Affected individuals have trouble distinguishing between some shades of red, yellow, and green. Images from Wikimedia Commons X-linked recessive questions Q5: A man and his daughter both have red-green colour blindness, an X-linked recessive disorder. The mother is not affected. What is the probability that their next child will be a son with red-green colour blindness? Let’s say: XA is the allele for the normal pigment Genotype of the mother Xa is the allele for the abnormal pigment Genotype of the father A. 0.25 B. 0.50 C. 0.75 D. 1.00 Haemophilia A and Haemophilia B: X-linked recessive disorders Clotting deficiency Abnormal alleles code for proteins that cannot participate effectively in blood clotting process Haemophilia A Most common type of haemophilia Deficiency of clotting factor VIII Haemophilia B (Christmas disease, Royal disease) Deficiency of clotting factor IX Haemophilia manifestation in female carriers Female carriers have a heterozygous genotype – Generally have a healthy phenotype – Some have mild symptoms of haemophilia – Severe symptoms of haemophilia is rare but possible One epigenetic mechanism that influences the diversity in phenotypes for female carriers is X chromosome inactivation (lyonisation) – One of the two X chromosomes in each diploid cell becomes inactivated during early development – Selection is random – Prevents females from having twice as many X chromosome gene products as males – On average, 50% of maternal X chromosome and 50% of paternal X chromosome is inactivated https://www.youtube.com/watch?v=veB31XmUQm8 Q6: Below is a pedigree for a sex-linked disorder. What is the mode of inheritance? A. Y-linked B. X-linked recessive C. X-linked dominant D. Not sure Unaffected male Unaffected female Affected male Affected female