Unit-3&4 Protein Structure & Structural Proteins 2 PDF

Unit-3: Globular Protein Structure and Folding Unit-4: Structural Proteins Dr NAVEEN KUMAR 1  Learning Objectives Unit-3: Globular Protein Structure and Folding 3.1 The relationship between functio...

Unit-3: Globular Protein Structure and Folding Unit-4: Structural Proteins Dr NAVEEN KUMAR 1  Learning Objectives Unit-3: Globular Protein Structure and Folding 3.1 The relationship between function and structures as seen in different types of biologically important proteins. Unit-4: Structural Proteins 4.1 Collagen 4.2 Proteoglycans 4.3 Immunoglobulin 4.4 Myoglobin 4.5 Hemoglobin Practice MCQs 2 The proteins speak : “We are the basis of structure and function of life; Composed of twenty amino acids, the building blocks; Organized into primary, secondary, tertiary and quaternary structure; Classified as simple, conjugated and derived proteins.” 3  Proteins are the most versatile macromolecules in living systems and serve crucial functions in essentially all biological processes. They function as catalysts, they transport and store other molecules such as oxygen, they provide mechanical support and immune protection, they generate movement, they transmit nerve impulses, and they control growth and differentiation. In biological proteins, the unique amino acid sequence of a protein is reflected in its unique folded structure. This structure, in turn, determines the protein's function. This is why mutations that alter amino acid sequence can affect the function of a protein. 4 Key points about the structure-function relationship in proteins: Amino Acid Sequence: The primary structure of a protein, which is the sequence of amino acids, dictates how the protein folds into its secondary and tertiary structures, ultimately determining its function. Folding Patterns: Different protein folds, like alpha helices and beta sheets, create specific pockets and grooves on the protein surface, allowing for selective binding with other molecules like substrates, ligands, or other proteins. Active Sites: Enzymes, for example, have specific active sites on their surface, formed by the arrangement of amino acids, which are crucial for binding and interacting with their target substrates to catalyze chemical reactions. 5 Examples of structure-function relationships in different protein types: Antibodies: The Y-shaped structure of antibodies allows them to specifically bind to antigens through their antigen-binding sites, facilitating immune response. Membrane Channels: Transmembrane proteins with specific channel structures allow the selective movement of ions and small molecules across cell membranes. Hemoglobin: The tetrameric structure of hemoglobin with its heme groups enables efficient oxygen binding and transport throughout the body. 6  Myosin: The filamentous structure of myosin, with its head domains, allows for muscle contraction through interaction with actin filaments. Important factors affecting protein function: Post-translational Modifications: Chemical modifications like phosphorylation or glycosylation can alter a protein's structure and therefore its function. Protein-protein Interactions: The specific interfaces formed between proteins due to their structure enable complex signaling pathways and cellular processes. 7 8 9 10 11  From Genes to Proteins DNA (Gene) mRNA Protein 12 A gene codes for a protein CCTGAGCCAACTATTGATGAA CCUGAGCCAACUAUUGAUGAA PEPTIDE 13 Protein Structure Levels 14  Levels of Organization 1. Primary structure of protein refers to the order of amino acids in the polypeptide chain. 2. Secondary structure is the steric relationship of amino acids, close to each other. 3. Tertiary structure denotes the overall arrangement and inter-relationship of the various regions, or domains of a single polypeptide chain. 4. Quaternary structure results when the proteins consist of two or more polypeptide chains are held together by non-covalent forces. Primary Structure of Protein 16 Peptide Bond Formation 17  PEPTIDE BOND R2 H2N CH-CO-NH-CH-COOH R1 1st Amino acid 2nd Amino acid 18  Secondary Structure of Proteins β-Pleated Sheet α-Helix 19 Protein Folding Pathway 20 Protein Structural Motifs 21  MYOGLOBIN Myoglobin is a small, globular protein that stores oxygen in cardiac and skeletal muscle. Myoglobin is a relatively small protein of molecular weight of about 17000 Daltons. It consists of one polypeptide chain of 153 amino acids (apomyoglobin) with one heme group (iron porphyrin complex) embedded their in as prosthetic group (non protein part). The Fe2+ atom present at the center of the heme is bonded by four porphyrin nitrogen atoms and one nitrogen atom from imidazole side chain of histidine residue which is a part of long protein chain of amino acid residues. This polypeptide chain plays an important role in biological fixation of O 2. 22  It was the first protein whose complete tertiary structure was determined by X-tray crystallography. It has 8 α-helical sements and no β-pleated sheet/structure. Hydrogen binding stabilize the α-helical region. Consist of a single polypeptide chain includes prosthetic group- one heme group. 23  HEMOGLOBIN Quaternary Structure of Hemoglobin  Hemoglobin (Hb) is the red blood pigment, exclusively found in erythrocytes. Hemoglobin performs two important biological functions concerned with respiration Delivery of O2 from the lungs to the tissues. Transport of CO2 and protons from tissues to lungs for excretion. Hemoglobin (mol. wt. 64,450 Da) is a conjugated protein, containing globin— the apoprotein part—and the heme—the nonprotein part (prosthetic group). Hemoglobin is a globular tetrameric allosteric protein having 2 alpha chains and 2 beta chains. The Adult Hb (HbA1) has 2 alpha chains and 2 beta chains. Fetal Hb (Hb F) is made up of 2 alpha and 2 gamma chains. Hb A2 has 2 alpha and 2 delta chains.  Normal adult blood contains 90% HbA1, about 5% HbA2 and about 2% HbF. Each alpha chain has 141 amino acids. The beta, gamma and delta chains have 146 amino acids. HbF has 2 alpha chains and 2 gamma chains. Fetal hemoglobin (HbF) is synthesized during the fetal development and a little of it may be present even in adults. In Hb molecule - 36 histidine residues are present; these are important in buffering action. It is evident from the graph that myoglobin has much higher affinity for O2 than hemoglobin. Hence O2 is bound more tightly with myoglobin than with hemoglobin. Further, pO2 needed for half saturation (50% binding) of myoglobin is about 1 mm Hg compared to about 26 mm Hg for hemoglobin.  Sickle Cell Anemia (or) Sickle Cell Hemoglobin Normal red blood cell Sickle cell RBC In sickle cell anemia, the hemoglobin (HbS) has two normal α-globin chains and two abnormal (mutant) β-globin chains. This is due to a difference in a single amino acid. In HbS, glutamate at sixth position of β chain is replaced by valine (Glu β6 → Val).  COLLAGEN * Most abundant insoluble fibrous protein in the connective tissue of mammals. * Makes up about 25% to 35% of the whole-body protein content. * Collagen is the primary building block of our body’s skin, muscles, bones, tendons and ligaments, and other connective tissues. It's also found in your organs, blood vessels and intestinal lining. * Distribution of collagen varies in different tissues. bones tendons skin liver 4% 70% 90% Collagen fibers in muscle tendons 85%  Collagen is protein molecules made up of amino acids. It provides structural support to the extracellular space of connective tissues. Due to its rigidity and resistance to stretching, it is the perfect matrix for skin, tendons, bones, and ligaments. Collagen can be further divided into several groups depending on the type of structures they form. There are 28 various types of collagen that have been discovered, but by far, the most common are types I through IV, with type I comprising over 90% of the collagen in the human body. 31  The amino acid composition of collagen is unique and approximately 1/3rd of the amino acids are contributed by glycine i.e. every third amino acid in collagen is glycine. The primary amino acid sequence of collagen is - [Glycine-Proline-X] (or) [Glycine-X-Hydroxyproline]. X can be any of the other 18 amino acids. Collagen is composed of 3 polypetide chains which are wound together to form a triple helix. Since glycine is the smallest of all the amino acids, it allows the chain to form a tight configuration, and it can withstand stress. The process of collagen synthesis occurs mainly in the cells of fibroblasts which are specialized cells with the main function of synthesizing collagen and stroma. Collagen synthesis occurs both intracellularly and extracellularly. 32  Abnormalities associated with collagen The biosynthesis of collagen is a complex process, involving at least 30 genes (in humans), and about 8 posttranslational modifications. Expectedly, many inherited diseases due to gene mutations, linked with collagen formation have been identified. Ehlers-Danlos syndrome–a group of inherited disorders characterized by hyperextensibility of skin, and abnormal tissue fragility. Alport syndrome–due to a defect in the formation of type IV collagen fibres found in the basement membrane of renal glomeruli. The patients exhibit hematuria 33 Scury-This is a disease due to the deficiency of Vitamin-C (ascorbic acid). Scurvy is characterized by bleeding of gums, poor wound healing and subcutaneous hemorrhages. Although not a genetic disease, scurvy is related to the improper formation of collagen. Vitamin C is needed for the posttranslational modifications and the cross linking of the collagen. Osteogenesis imperfecta–characterized by abnormal fragility of bones due to decreased formation of collagen. Epidermolysis bullosa–due to alteration in the structure of type VII collagen. The victims exhibit skin breaks and blisters formation even for a minor. 34  IMMUNOGLOBULIN Immunoglobulins, also known as antibodies, are Y-shaped proteins that help the body fight infection by identifying and neutralizing antigens like bacteria and viruses. Production: Immunoglobulins are glycoproteins produced by B cells and plasma cells, which are types of white blood cells. Structure: Immunoglobulins are made up of two heavy chains and two light chains linked together by covalent bonds. Types: There are five types of immunoglobulins in humans: IgM, IgG, IgA, IgE and IgD. 35 36 Immunoglobulin Structure 37  PROTEOGLYCANS Tissues are not made up of solely of cells. A substantial volume of their space is extra cellular and filled by an intricate network of macromolecules called Extra Cellular Matrix (ECM). ECM is the non-cellular material present between cells throughout the body. Extra Cellular Matrix 38  Major Constituents of Extra Cellular Matrix Proteoglycans These are the class of polysaccharide chains of the class called Glycosaminoglycans (GAGs) often found covalently linked to protein. Proteins Structural fibrous protein – Collagen & Elastin Adhesive proteins - Fibronectin , Laminin & Integrin Hetero polysaccharides (or) Glycosaminoglycans 40  Proteoglycan A proteoglycan is a protein with multiple covalently attached glycosaminoglycan (GAG) chains. Structure A proteoglycan is made up of a core protein with one or more GAG chains attached. The GAG chains are linear polysaccharides made up of disaccharides, which are made up of an amino sugar and a uronic acid. Functions Proteoglycans are complex molecules that perform many functions in the body, including The proteoglycan function is that it provides structural support to the extracellular matrix as well as surrounding tissues and organs. Tissue structure Hydration 41  Cell signaling Cell adhesion : Embryonic development Blood coagulation Tissue mechanical properties Growth factors Tendon function Skin aging 42 Proteoglycan Structure 43  Aggrecan - The main proteoglycan in cartilage, aggrecan is a member of the aggrecan family of proteoglycans. Versican - A chondroitin sulfate proteoglycan that is found in the extracellular matrix (ECM) of blood vessels. Perlecan - A large heparan sulfate proteoglycan that is found in basement membranes and other ECM structures. Decorin - It is found in tensional tendons, such as the metacarpal region of the digital flexor tendons, it can bind to collagen fibers to control their shape, size, and distribution. Biglycan - A small proteoglycan that is abundant in the aorta. Neurocan - A proteoglycan that is expressed in the late embryonic central nervous system (CNS) and can inhibit neurite outgrowth. Brevican - A proteoglycan that is expressed in the terminally differentiated CNS, particularly in perineuronal nets. 44 1. Which of the following best explains why mutations in the primary structure of a protein can significantly alter its function? A) Mutations cause changes in the DNA structure. B) Primary structure determines how a protein folds into its final shape. C) Mutations change the number of amino acids in the protein. D) Primary structure is not relevant to protein function. 2. Which type of collagen is most abundant in the human body, constituting over 90% of collagen? A) Type I B) Type II C) Type III D) Type IV 3. What is the primary role of glycine in the triple-helix structure of collagen? A) It forms covalent bonds between chains. B) Its small size allows for tight helical formation. C) It increases the rigidity of the collagen fiber. D) It facilitates the binding of water molecules. 4. Which post-translational modification is critical for the stabilization of collagen fibers? A) Phosphorylation B) Methylation 45 C) Hydroxylation 5. What is the role of histidine residues in hemoglobin’s function? A) Binding directly to oxygen molecules. B) Facilitating iron coordination within the heme group. C) Enhancing the affinity of hemoglobin for carbon dioxide. D) Stabilizing the alpha-helical structure. 6. Which of the following is a characteristic feature of proteoglycans? A) They consist of amino acid sequences. B) They are solely composed of protein components. C) They have glycosaminoglycan chains attached to a core protein. D) They form the lipid bilayer of cell membranes. 7. Which of the following statements is true about the role of hydrogen bonds in secondary structures of proteins? A) Hydrogen bonds only occur in the quaternary structure. B) Hydrogen bonds stabilize the alpha-helices and beta-sheets. C) Hydrogen bonds form between side chains in tertiary structures. D) Hydrogen bonds are irrelevant to the stability of protein structures. 8. The role of the heme group in hemoglobin is to: A) Bind directly to carbon dioxide. B) Facilitate the allosteric changes in the protein structure. C) Provide a binding site for oxygen. D) Regulate the synthesis of globin chains. 46 9. The function of immunoglobulin G (IgG) in the immune system is primarily: A) To trigger immediate hypersensitivity reactions. B) To provide long-term immunity after infection. C) To act as the first responder to infections. D) To bind allergens and trigger histamine release. 10) Which of the following disorders is related to the improper formation of collagen due to genetic mutations? A) Alport syndrome B) Osteoarthritis C) Hemophilia D) Sickle cell anemia 11) Which statement accurately describes the difference between primary and tertiary structures of proteins? A) Primary structure involves hydrogen bonding, whereas tertiary structure involves peptide bonds. B) Tertiary structure refers to the sequence of amino acids, while primary structure refers to 3D folding. C) Primary structure is determined by the amino acid sequence, whereas tertiary structure involves the overall 3D folding. D) Primary and tertiary structures are identical for all proteins 12) Which component of the extracellular matrix is most critical for resisting compressive forces in tissues and responsible for tissue hydration? A) Collagen fibers 47 B) Elastin