Techniques in Genetic Analysis 9-9-24.pdf

Recombinant DNA/Genomic Technologies Daniel Brazeau, PhD Dept BioMedical Sciences w/Dr. Primerano 1...

Recombinant DNA/Genomic Technologies Daniel Brazeau, PhD Dept BioMedical Sciences w/Dr. Primerano 1 Outline: Restriction endonucleases Gel electrophoresis Recombinant DNA Vectors – plasmids, cosmids, BACs & YACs cDNA libraries – expression vectors DNA sequencing Sanger and NGS sequencing Detection of DNA/RNA Southern, RNA (northern) & protein (western) PCR Gene Function Quantitative PCR Mutagenesis and Expression Manipulation Gene Transfer/Gene Therapy CRISPR Silencing RNA Metagenomics Epigenetics 2 1  Understanding Disease Understanding Proteins Gene Expression 3 1st advance: Restriction Enzymes Restriction endonucleases (RE’s): enzymes that cleave DNA at specific sequences. First identified in bacteria, where they provide defense against the entry of foreign DNA. Bacteria have a variety of restriction endonucleases that cleave DNA at more than 100 distinct recognition sites. Alternative cloning and sequencing technologies have minimized the need for RE’s 4 2  Restriction Enzymes Example: EcoRI recognizes the NNNGAATTCNNN sequence GAATTC. (1 site NNNCTTAAGNNN every 4096 bases on average) This sequence is present at EcoRI five sites in DNA of bacteriophage λ, so the DNA is digested into 6 NNNG AATTCNNN fragments ranging from 3.6 NNNCTTAA GNNN to 21.2 kb long (1 kilobase (kb) = 1000 base pairs) Note: complementary overhangs 5 Gel Electrophoresis The fragments can be separated by gel electrophoresis: A gel of agarose or polyacrylamide is placed between two electrodes and the sample is added to the gel. Nucleic acids are negatively charged so they migrate toward the positive electrode. Smaller molecules move more rapidly, allowing the fragments to be separated by size. For larger DNA molecules, restriction endonuclease digestion alone does not provide enough resolution. For example, the human genome would yield more than 500,000 EcoRI fragments, which can’t be separated by gel electrophoresis. 6 3  Recombinant DNA Restriction endonucleases cleave recognition sequences at staggered sites, leaving single-stranded tails that can associate with each other by complementary base pairing. DNA ligase can then seal the ends permanently. Synthetic DNA “linkers” containing desired restriction endonuclease sites can be added to the ends of any DNA fragment (including sheared DNA). This allows virtually any fragment of DNA to be ligated to a vector and isolated as a molecular clone. 7 Molecular cloning Purified DNA fragments can be obtained by gel electrophoresis In molecular cloning, a DNA fragment is inserted into a DNA molecule (a vector) that can replicate independently in a host cell. The result is called a recombinant molecule or molecular clone. The fragment can be isolated from the plasmid DNA by restriction endonuclease digestion and gel electrophoresis. This allows a pure fragment of human DNA to be analyzed and further manipulated. 8 4  Cloning: Vectors Plasmids are often used for cloning DNA inserts up to a few thousand base pairs long. Plasmids have an origin of replication (ori)—the DNA sequence that signals the host DNA polymerase to start replication. Plasmid vectors also carry genes that confer resistance to antibiotics, so bacteria carrying the plasmids can be selected for. 9 Cloning: Vectors Many different types of vectors with specific purposes Some vectors are designed to accommodate large DNA inserts Cosmids (phage cos sites + plasmid) – up to 50 kilobses Bacterial Artificial Chromosomes (BACs) – 150 to 300 kilobases Yeast Artificial Chromosomes (YACs) – 200 to 500 kilobases Others are designed to allow for high levels of expression of the inserted gene (Expression Vectors) 10 5  RNA “cloning” RNA can also be “cloned” RNA is copied using reverse transcriptase. The resulting DNA (cDNA) is ligated to a vector DNA. This allows mRNA to be isolated as a molecular clone, and the noncoding sequences in eukaryotic genes (introns) can be explored. Production of clinically useful proteins  Expression in eukaryotic cells instead of bacteria may be needed, (e.g., if posttranslational modification of the protein is required).  Gene therapy in humans 11 Sequencing 2001 Human Genome Project 5 yrs, $2.7 billion 2nd generation sequencing “massively parallel sequencing by synthesis” 2011 1 month, $3,000 3rd generation sequencing “single molecule” 2014 human genome 1 hr $100 ‐ $1000 12 6  DNA sequences/machine/week next next single cells gen 300 sequencing 3rd 250 200 next gen sequencing 150 2nd 100 Sanger 50 sequencing 0 1990 2000 2010 13 Next gen sequencing applications: 1) Genome Projects ‐ Whole genome sequencing (WGS) - Resequencing - Targeted sequencing 2) Whole Exome Sequencing All of the (coding) exons in the genome Represents about 2-3% of the entire genome = ~200,000 exons A good place to look for relevant variants because these changes lead to changes in protein structure and function. 14 7  Next gen sequencing applications: 3) RNA Sequencing (RNA seq) – characterizing the transcriptome 4) Chip Seq – DNA protein interaction Cross‐link protein to DNA  Shear DNA  Immunoprecipitate  Remove protein  Sequence DNA 15 Next gen sequencing applications: 6) Genomic Medicine ‐ monitoring and guiding therapy ‐Characterization of tumor cells ‐Assessing intra tumor heterogeneity 7) Epigenetics – assessing the epigenome bisulfite sequencing National Institutes of Health - http://commonfund.nih.gov/epigenomics/figure.aspx 16 8  Next gen sequencing applications: 8) Metagenomics We’re mostly made up of microbes 100 trillion cells, ~3x more than “human” cells (all microorganisms) Humans ~23,000 genes Microbiome ~ 8,000,000 genes Gut microbiome plays a role in Vitamin & amino acid biosynthesis Dietary energy harvest Immune development Norman R. Pace, A Molecular View of Microbial Diversity and the Biosphere. Science 276, 734 (1997) 17 Metagenomics: 16s rRNA gene 16S ribosomal RNA, essential structural prokaryotic ribosomes, similar in sequence to eukaryote ribosome as well gene for 16S rRNA highly conserved in all bacteria 16s rRNA gene has regions of conserved sequence common to all bacteria & several regions of variable sequences. Useful for study evolutionary relationships and also for ID Variable regions or Least variable polymorphisms, have unique specie’s specific sequences. Most variable Usable as a diagnostic tool to identify bacteria at the species level. 18 9  Detection of Nucleic Acids The key to detection of specific nucleic acid sequences is base pairing. In nucleic acid hybridization, DNA strands are initially separated by high temperature; when cooled, they re‐form double‐stranded helices by complementary base pairing. 19 Detection of Nucleic Acids Southern blotting: Cloned DNA can be labeled with radioactive nucleotides or nucleotides modified to fluoresce. This labeled DNA is then used as a probe that hybridizes with complementary DNA or RNA in complex mixtures. Also: “Northern” blot -RNA Griffiths et al. ©2014 by Steven M. Carr “Western” blot - protein 20 10  Accessing Gene Expression: DNA Arrays Prior to the mid 1990’s hybridization assays used flexible membranes Nitrocellulose Nylon 2000’s – glass as substrate Non‐porous – minute deposition No absorption of reagents Small sample volumes – rapid hybridization kinetics Solid substrate allows for high density and high scanning abilities Low intrinsic fluorescence – allows fluorescent labeling Photolithography - Affymetrix® 21 Nucleic Acid Detection: Polymerase Chain Reaction (2nd advance) PCR – first described in mid 1980’s An in vitro method for the enzymatic synthesis of specific DNA sequences Selective amplification of target DNA from a heterogeneous, complex DNA/cDNA population Requires Two specific oligonucleotide primers Thermo‐stable DNA polymerase dNTP’s Target DNA Sequential cycles of usually three steps (temperatures) 22 11  PCR Applications 1) DNA amplification 2) Assessing Gene expression ‐ mRNA analysis Real‐time PCR or Quantitative PCR (QPCR) ‐ The formation of a PCR product is monitored continuously during amplification by means of fluorescent primers, fluorogenic probes, or fluorescent dyes that bind to double‐stranded DNA. Note: mRNA must first be reverse transcribed to cDNA prior to PCR amplification 23 PCR Applications TAQMAN Probes 3) Genotyping SNP ID rs776746 CYP3A5*3 Location Chr.7:99270539 on NCBI Build 37 Polymorphism T/C, Transition Substitution Probe Sequences [VIC/FAM]: ATGTGGTCCAAACAGGGAAGAGATA[TFAM]TGAAAGACAAAAGAGCTCTTTAAAG ATGTGGTCCAAACAGGGAAGAGATA[CVIC]TGAAAGACAAAAGAGCTCTTTAAAG 24 12  PCR Applications 4) in situ PCR Amplification of the target nucleic acid sequences in Fluorescence in situ hybridization with chromosome cells or tissue samples that are fixed and specific probes permeabilized to preserve morphology 25 Retroviral vectors Gene Function in Eukaryotes In classical genetics, gene function has been revealed by the altered phenotypes of mutant organisms. It is now possible to study the function of a cloned gene directly by reintroducing it into eukaryotic cells. Gene function can be studied by introducing cloned DNA into plant and animal cells (gene transfer). Methods were initially developed using infectious viral DNA; thus it is called transfection In most of the cells, the DNA is transported to the nucleus, and is transcribed for several days: transient expression. In about 1% of cells, the foreign DNA is integrated into the genome and transferred to progeny cells at cell division. 26 13  Gene Function in Eukaryotes – Gene transfer Cloned genes can also be introduced into the germ line of multicellular organisms (but not humans). Mice that carry foreign genes (transgenic mice) are produced by microinjection of cloned DNA into the pronucleus of a fertilized egg. 27 Gene Function in Eukaryotes – Gene transfer Embryonic stem (ES) cells are also used to get cloned genes into mice. Cloned DNA is introduced into ES cells in culture, then transformed cells are introduced back into mouse embryos. The offspring are chimeric: a mixture of cells that arise from normal and transfected embryonic cells. 28 14  Gene Function in Eukaryotes – “Gene knockout” Genes can be inactivated in mouse embryonic stem cells, which can grow into transgenic mice. The mice yield progeny with mutated copies of the gene on both homologous chromosomes. Effects of gene inactivation can then be studied in the context of the intact animal. 29 Gene Function in Eukaryotes – “Conditional Gene knockout” Methods have also been developed to conditionally “knockout” genes in specific mouse tissues, allowing the function of a gene to be studied in a defined cell type. Cre-Lox system – takes advantage of a site-specific recombinase to introduce gene deletions, inversions or translocations. Cre-Lox system relies on two components to function: a Cre recombinase, and its recognition site, loxP. These components have been adapted from the P1 bacteriophage for use in genetic manipulation. Outcome based upon orientation of loxP sites 30 15  Gene Function in Eukaryotes – “Gene editing” The CRISPR/Cas system is a relatively new approach for introducing targeted gene mutations into mammalian cells. Specific target sequences are recognized by a synthetic RNA molecule, and Cas (CRISPR‐associated system) proteins cleave the targeted DNA. Plasmids expressing a guide RNA (gRNA) with sequences homologous to the target gene and the Cas9 nuclease are introduced into cells, along with a mutated copy of the gene. 31 RNA Interference – Silencing RNAs RNA Seq Quantatitive PCR Silencing RNA technologies RNAi – gene specific silencing that occurs posttranscriptionally 32 16  Posttranscriptional Inhibition Transcriptional gene silencing Many problems (TGS) ‐ RNA stability ‐ Potent antiviral response in mammals 33 MicroRNA (miRNA) Processing and Activity ancient, highly conserved mechanism humans have 300‐800 miRNA genes regulates the expression of ~30% of all protein encoding genes miRNAs involved in early development, cell proliferation/death, fat metabolism, cell differentiation aberrant miRNA expression may be correlated with cancers final step is incorporation of strand into RNA induced silencing complex (RISC) miRNA target sites seem to be in mRNAs 3’UTR 34 17  siRNA: small interfering RNAs requires a dsRNA ~21‐22 nt long works in catalytic manner works post‐transcriptionally works at very low concentrations more effective than conventional antisense RNAs works by activating endonuclease that digests a dsRNA target containing mRNA "Potent and specific genetic interference by double‐stranded RNA in Caenorhabditis elegans." Fire, A, S Xu, MK Montgomery, SA Kostas, SE Driver, CC Mello (1998) Nature 391(6669): 806‐11. 35 Thank You 36 18