Revision IBS-I Lecture 1-6 PDF

Revision IBS-I Lecture1-6 Assoc. Prof. Eman Ramadan  The cell A. Nucleus B. Cytoplasm a) Inclusions : Stored food and pigments b) Organells : Non-membranous organelles: Ribosomes, Microtubules, Filaments, centrioles, cilia and flagella. Membranous : Cell membrane (Plasma mem...

Revision IBS-I Lecture1-6 Assoc. Prof. Eman Ramadan  The cell A. Nucleus B. Cytoplasm a) Inclusions : Stored food and pigments b) Organells : Non-membranous organelles: Ribosomes, Microtubules, Filaments, centrioles, cilia and flagella. Membranous : Cell membrane (Plasma membrane), Mitochondria Endoplasmic reticulum, Golgi complex, Lysosomes and Endosomes 2 http://people.eku.edu/ritchisong/RITCHISO/301notes1.htm  Cell membrane The plasma membrane is composed of: 1. lipids, arranged as a phospholipid bilayer 2. Proteins ( integral, peripheral) 3. Carbohydrates (glycolipids or glycoproteins). 3 http://diagram.monfch.com/diagram-of-a-cell-membrane/  Glycocalyx Is the sugar coat located on the outer surface of the cell membrane Responsible for the fuzziness seen on electron microscope Consists of oligosaccharides side chain covalently linked to proteins and some lipids of the plasma membranes Function: Attachment of cells to the extracellular matrix Binding antigen and enzymes to the cell surface. Facilitates cell – cell recognition. Protects cells from injury. 4 http://www.keyword-suggestions.com/Z2x5Y29jYWx5eCBjZWxsIGJpb2xvZ3k/ https://www.studyblue.com/notes/note/n/kn251-exam-ii-lecture/deck/15772407  Cell membrane:1-Lipids The phospholipid bilayer: Arranged into a lipid bilayer. Each of the phospholipid molecule is composed of a polar head (hydrophilic) and two non polar (hydrophobic) tails. 5 http://biology.stackexchange.com/questions/34679/why-dont-phospholipid-bilayers-dissolve  Cell membrane “selective permeability” Passes certain substances through while restricting the passage of others Types of cellular transport: I. Passive transport (cell does not use energy) Substances move down their concentration gradient 1. Diffusion 2. Facilitated diffusion 3. Osmosis II. Active transport (cell uses energy) Substance across a cell membrane against its concentration gradient 1. Protein pumps 2. Endocytosis 3. Exocytosis 6 I. Passive transport (cell does not use energy) 1. Simple diffusion Small non charged molecules such as H2O, O2 and CO2 or lipid soluble molecules as steroids Moving from areas of high concentration to areas of low concentration (they move down their concentration gradient). http://www.biologymad.com/cells/cellmembrane.htm 7 I. Passive transport (cell does not use energy) 2. Osmosis (diffusion of water) Water molecules diffuse through a selectively permeable membrane from areas of high water concentration to areas of lower water concentration (or diffusion of water from low solute concentration to high solute concentration). 8 https://online.science.psu.edu/bisc004_activeup002/node/545 I. Passive transport (cell does not use energy) 3. Facilitated diffusion Substances move down their concentration gradient through protein channels in the cell membrane. Allows polar and charged molecules, as carbohydrates, amino acids, nucleosides, and ions. Two classes of proteins Channel proteins: Carrier proteins: http://www.ck12.org/biology/Facilitated-Diffusion/lesson/Facilitated-Diffusion-BIO/ 9  II. Active transport (cell does use energy) Active transport is the energy-demanding transfer of a substance across a cell membrane against its concentration gradient. Major examples of Active Transport Sodium/potassium pump in cell membranes (especially nerve cells) http://www.mun.ca/biology/desmid/brian/BIOL2060/BIOL2060-08/CB08.html 10  Bulk transport Bulk transport requires energy A. Endocytosis B. Exocytosis https://www.studyblue.com/notes/note/n/ch-3b-transport-mechanisms/deck/5477890 11  A. Endocytosis Endocytosis occurs as: 1. Phagocytosis: for solid particles (cell eating) 2. Pinocytosis: engulfing fluids (cell drinking) 3. Receptor –mediated endocytosis: specific particles https://www.studyblue.com/notes/note/n/ch-3b-transport-mechanisms/deck/5477890 12  A B 1. Phagocytosis The cell is able to engulf solid particle forming a vesicle called phagosome Occur in certain types of cells e.g macrophages Fig: B First: A neutrophil extends a pseudopod toward two pneumococci. Center: these bacteria have been engulfed (arrows), and the neutrophil is beginning to engulf four more pneumococci at the upper right. last: Two pneumococci have escaped. 13 From W. B. Wood, M. R. Smith, and B. Watson, Journal of Experimental Medicine84:387, 1946  2. Pinocytosis The cell engulf a small amount of extracellular fluid forming pinocytotic vesicle. Occur in all types of cells. 14 http://fig.cox.miami.edu/~cmallery/150/memb/c8.7x20b.pinocytosis.jpg  3. Receptor-mediated endocytosis Selective uptake of certain molecules (hormones) by binding to membrane specific receptors in certain cells. http://fig.cox.miami.edu/~cmallery/150/memb/c8.7x20c.receptor.jpg 15  B. Exocytosis Examples: Release of digestive enzymes from cells of the pancreas. Secretion of insulin hormone. Dopamine release at Nerve endings Illustration of an axon releasing dopamine by Exocytosis 16 http://www.biology-pages.info/E/Exocytosis.html  Mitochondria Membranous organelle Present in metabolically active cells as liver cells (hepatocytes) Power house of the cell (ATP production). 17 http://www.basic.northwestern.edu/g-buehler/mito.htm  Lysosomes Produced by Golgi apparatus Membranous vesicles containing hydrolytic enzymes Increases in cells with high phagocytic activity (e.g macrophages).  Lysosomes A. Primary lysosomes are newly formed lysosomes A. Secondary lysosomes: a. Autophagosomes - from the fusion of lysosome with autophagosome that contain worn out, cytoplasmic organelles a. Heterophagosomes - fusion of lysosme with phagosomes that contain ENDOCYTOSED material from out side the cell c. Residual bodies - remanants of digested materials from autophagosomes or heterophagosomes. http://www.auburn.edu/academic/classes/zy/hist0509/html/Lec03Bnotes-the_cell2.html  Cytoskeleton A network of protein filaments Responsible for keeping the cell morphology, helps in cellular motion. Consists of 1. Microtubules, 2. Thin filaments(microfilaments), 3. Intermediate filaments http://biology4isc.weebly.com/cell-organelles.html 20  Inclusions Non living material which are either cell product or metabolite by the cell A. Stored food a. Glycogen b. Lipid B. Pigment a. Endogenous e.g. Haemoglobin and melanin b. Exogenous: Dust, carotene, tattoo and lead poising http://laboratoryinfo.com/periodic-acid-schiff-pas-staining-technique-for-carbohydrates/  Endoplasmic reticulum A system of interconnected tubules and vesicles. It is either Rough Endoplasmic reticulum (rER) Smooth Endoplasmic reticulum (sER) http://www.columbia.edu/itc/hs/medical/sbpm_histology_old/lab/lab04_micrograph.htm l. 22  Endoplasmic reticulum Rough Endoplasmic reticulum: covered Smooth Endoplasmic reticulum: no by polyribosomes for protein synthesis ribosomes Function rER Function of sER Synthesis of secretory protein ,e.g Lipid metabolism, glycogenesis, drug enzymes and hormones detoxification, calcium storage and Post-translational modification of pump and HCl formation proteins (sulfation, folding and Synthesize steroid hormones and glycosylation). phospholipids for all cell membranes Storage and transport of proteins. 23 https://www.quia.com/jg/1212028list.html  Golgi complex A specialized set of membranes Composed of series of: Flattened, slightly curved cisternae, (Golgi stack). 24 https://micro.magnet.fsu.edu/cells/golgi/golgiapparatus.html  What is Homeostasis? The maintenance of a stable internal environment. 37 degrees C, pH 7.3-7.4 Other factors that are regulated? Most organ systems contribute to homeostasis Exception: reproductive system 25 Homeostatic Control Systems Most control systems of the body act by a process of negative feed back. The effect opposite the change 26 Example: Blood glucose and Negative Feedback 27 Positive feedback loops Positive feed back tend to strengthens a change in one of the body control conditions 28 Other Regulatory Mechanisms Positive feedback loops It is the exact opposite of a negative feedback mechanism. The output enhances the original stimulus. Example child birth: during labor, a hormone called oxytocin is released that intensifies and speeds up contractions. The increase in contractions causes more oxytocin to be released and the cycle goes on until the baby is born. Feed forward mechanisms Anticipate change and responds to that change before it happens Examples : Thought or smell of food triggers salivation and increased respiratory rate in anticipation of exercise 29 Body Fluids Total amount of fluid in the human body is approximately 70% of body weight Body fluid has been divided into two compartments – Intracellular fluid (ICF) Inside the cells 55% of total body water Extracellular fluid Outside the cells 45% of total body water 30 Difference ECF ICF ⚫ Most abundant cation - Na+, ⚫ Most abundant cation - K+ – muscle contraction – Resting membrane potential – Impulse transmission – Action potentials – fluid and electrolyte – Maintains intracellular volume balance ⚫ Most abundant anion - Cl- ⚫ Anion are proteins and – Regulates osmotic pressure phosphates (HPO42-) – Forms HCl in gastric acid ⚫Na+ /K+ pumps play major role in keeping K+ high inside cells and Na+ high outside cell 31  Lecture II Cell Injury, Cell Death, and Adaptations 32 Causes of Cell Injury 1. Hypoxia and ischemia: Hypoxia (oxygen deficiency) and ischemia (blood flow deficiency) 2. “Chemical” agents: including drugs and alcohol 3. “Physical” agents: including trauma and heat 4. Immunological reactions: including anaphylaxis and loss of immune tolerance that results in autoimmune disease. 5. Infections 6. Genetic defects:hemoglobin S in SS disease, inborn errors of metabolism 7. Nutritional defects: vitamin deficiencies, obesity leading to type II DM, fat leading to atherosclerosis 8. Aging: including degeneration as a result of repeated trauma, and intrinsic cellular senescence  Common Mechanisms of Cell Injury 1. Loss of energy (ATP depletion, O2 depletion) leading to loss of energy-dependent cellular functions (frequently associated with both hypoxic & chemical injury). 34  Common Mechanisms of Cell Injury…cont. Loss of ATP Causes: a) Failure of the active cell membrane transport e.g. the sodium-potassium pump & the sodium-calcium exchange, causing ▪ Increased intracellular calcium & sodium (diffuses into the cell down its concentration & electrical gradients) ▪ Decreased potassium. b) Switch to anaerobic cellular metabolism, leading to the accumulation of lactic acid & inorganic phosphates causing ↓intracellular pH  Common Mechanisms of Cell Injury…cont. 2. Mitochondrial damage (“permeability transition”) 36  Common Mechanisms of Cell Injury…cont. 3.Loss of calcium homeostasis Increased Intracellular Calcium (influx from extracellular fluid or release from intracellular stores such as mitochondria & endoplasmic reticulum). This is frequently associated with injurious agent such as ischaemia & certain toxins.. Common Mechanisms of Cell Injury…cont. 4) Altered Cell Membrane Permeability due to reduced energy production & membrane distortion. 5) Formation of Intracellular Toxic Reactive Oxygen Species (ROS) as superoxide anion & hydroxyl radicals, hydrogen peroxide frequently caused by radiation & certain chemicals.  Responses of Cell to Injury Mild (Minor or Brief) Injury causes stress but does not lead to death of the cell, it is a reversible injury. Such cells develop Adaptation (Structural or Functional Changes to Overcome Injury). Adaptive Responses Include: Hyperplasia (Increase in the Number of cells). Hypertrophy (Increase in the Size of cells). Atrophy (Decrease in the Size & Function of cells). Metaplasia (replacement of one cell type with another) Responses of Cell to Injury Severe (Intense or Prolonged Injury) causes death of cell and Irreversible Injury. Irreversible Cell Injury occurs when the cell membrane or the organelles can no longer function. Changes Include: Necrosis (always Pathological). Apoptosis (mainly Physiological) - occurs when a cell dies through activation of an internally suicide program.  I- Atrophy(decrease in cell size). Example: Atrophy of Skeletal muscles (mass & tone) in individuals with prolonged bed rest (disuse) or with paralyzed extremities (denervation). Atrophy of breasts in women after menopause due to decreased hormonal stimulation. Atrophy of fat & muscle in malnourished or starved people. 2. Hypertrophy: increase in the size of a cell or tissue due to an increase in workload Types of hypertrophy are: 1. Physiologic: increased size of skeletal muscles during exercise 2. Compensatory: kidney enlargement due to dt non-functioning of other kidney 3. Pathologic: left ventricular muscle as the heart pumps against high pressure. 3-Hyperplasia An increase in the number of cells increased mitosis caused by: Increased workload, Hormonal stimulation, or Decreased tissue density (↓crowding). An adaptive process associated with activation of genes that control cell proliferation & intracellular messengers that control replication & growth. Can only occur in cells that undergo mitosis, such as liver, kidney, & connective tissue cells It is a vital component in wound healing & blood vessel proliferation 4. Metaplasia The replacement of one cell type with another. A common cause is continual irritation or injury that starts a chronic inflammatory response. The new cell type can better endure the stress or change of chronic inflammation. Although metaplastic cells are not cancer cells, the irritants that cause the initial change may be carcinogenic & metaplasia is a significant cellular irritation. 4. Metaplasia…Cont. The types of metaplasia are: 1.Physiologic: is a normal response to changing conditions & is usually transient. e.g in inflammation, monocytes that migrate to inflamed tissues change into macrophages. 2.Pathologic: is a response to an extrinsic toxin or stressor & is usually irreversible. e.g. stratified squamous epithelial cells replace the normal ciliated columnar epithelial cells of the respiratory passages. 5. Dysplasia Derangement in cell growth or abnormal differentiation of dividing cells leading to cells that are abnormal in size, shape, & appearance. Due to chronic irritation & inflammation. Although this cell change is not cancerous, but can turn into cancerous condition. It is abnormal, but adaptive, & possibly reversible. The most common sites of dysplasia are: ▪ Respiratory tract (especially the squamous cells present as a result of metaplasia). ▪ Cervix (usually results from infection of the cells with the human papilloma virus (HPV).  Lecture III The Central Dogma and Genetic Variation 46  The Central Dogma Genetic information flow: 1) From DNA to DNA (Genome): Genetic information is preserved and transmitted from generation to generation by a duplication process called replication. 2) From DNA to Protein: during its phenotypic expression in an organism. Transcription: DNA to RNA (transcriptome) (sometimes reversible). Translation: RNA to protein (proteome) (irreversible). https://www.carolguze.com/images/biomolecules/centraldogma2.gif 47 DNA & RNA 48 https://ib.bioninja.com.au/standard-level/topic-2-molecular-biology/26-structure-of-dna-and-rna/nucleotides.html  Cont… ▪ Ribose is a single-ring pentose [5- Carbon] sugar. ▪ The numbering of the carbon atoms runs clockwise ▪ Note the absence of the hydroxyl (- OH) group on the 2’ carbon in the deoxy-ribose sugar in DNA as compared with the ribose sugar in RNA. 49 Phosphodiester bond is the covalent bond on the DNA back bone The phosphodiester bond is the linkage between the 3' carbon atom of one sugar molecule and the 5' carbon atom of another. 50 Hydrogen bonding in DNA The Hydrogen bond inforce hydrophobic bases inside of the helix, whereas the polar exterior is touching the solvent water. Cytosine and Guanine are held together by three hydrogen bonds. Adenine and thymine share two hydrogen bonds Hydrogen bonds are fairly weak, but millions of hydrogen bonds in DNA make it a stable molecule. 51 https://socratic.org/questions/how-do-hydrogen-bonds-contribute-to-the-structure-of-dna  Transcription Transcription is the first step of gene expression. During this process, the DNA sequence of a gene is copied into mRNA 52 https://www.nature.com/scitable/topicpage/translation-dna-to-mrna-to-protein-393/  Transcription Before transcription can take place, the DNA double helix must unwind near the gene that is getting transcribed. The region of opened-up DNA is called a transcription bubble. Steps: 1. Initation 2. Elongation 3.Termination 4.Post-transcription modification https://www.khanacademy.org/science/biology/gene-expression-central-dogma/transcription-of-dna-into- rna/a/stages-of-transcription 53  Which strand ??? Transcription uses one of the two exposed DNA strands as template strand. The RNA product is complementary to the template strand and is almost identical to the other DNA strand, called the non template (or coding) strand. In RNA, all of the T nucleotides are replaced with U nucleotides. https://www.khanacademy.org/science/biology/gene-expression-central-dogma/transcription-of-dna-into-rna/a/stages-of-transcription 54  Transcription initiation…How transcription start??? To begin transcribing a gene, RNA polymerase binds to the DNA of the gene at a region called the promoter. https://www.khanacademy.org/science/biology/gene-expression-central-dogma/transcription-of-dna-into-rna/a/stages- of-transcription 55  Termination…when to stop transcription??? The termination of transcription Require termination signals https://www.easynotecards.com/notecard_set/74835  Untranslated region Untranslated region (or UTR) are two sections, one on each side of a coding sequence on a strand of mRNA. On the 5' side, it is called the 5' UTR or if it is found on the 3' side, it is called the 3' UTR The 5' and 3' UTRs usually not translated into protein. Within the 5' UTR is a sequence that is recognized by the ribosome which allows the ribosome to bind and initiate translation. The 3' UTR plays a critical role in translation termination https://en.wikipedia.org/wiki/Untranslated_region#/media/File:MRNA_structure.svg 57  Post-transcriptional modification Alternative splicing, or differential splicing, is a regulated process during gene expression that results in a single gene coding for multiple proteins 58 https://www.khanacademy.org/science/biology/gene-expression-central-dogma/transcription-of-dna-into-rna/a/stages-of-transcription  Translation Translation is a process by which the genetic code contained within an mRNA molecule is decoded to produce the specific sequence of amino acids. 59  Genetic Code There are 61 codons for amino acids Each 3 nucleotide are codons specify an amino acid. Three "stop" codons mark the end of a protein. One "start" codon, AUG, marks the beginning of a protein and also encodes the amino acid methionine mRNA codons are read from 5' to 3' , and they specify the order of amino acids in a protein from N-terminus (methionine) to C-terminus. https://www.khanacademy.org/science/biology/gene-expression-central-dogma/transcription-of-dna-into-rna/a/stages-of-transcription 60 Types of RNA Recent research has also revealed the presence of small, single-stranded and double-stranded RNA molecules that play important roles in regulating which genes get expressed. These types of RNA include small interfering RNA (siRNA) and microRNA (miRNA).  Chromatin Chromatin is a complex of DNA and protein. Its primary function is packaging very long DNA molecules into a more compact, denser shape, which prevents the strands from becoming tangled. https://classconnection.s3.amazonaws.com/478/flashcards/3105478/png/chromatin- 1414CCB24AD4DE4B71E.png 62  Histones Histones These small proteins are positively charged at physiologic PH as a result of their high content of lysine and arginine (+vely charged) so they form ionic bonds with negatively charged phosphate group in DNA 63 https://www.ncbi.nlm.nih.gov/books/NBK26834/figure/A632/?report=objectonly  GENE ACTIVATION (Epigenetics) In addition, METHYLATION of certain regions of a gene can TURN OFF or SILENCE that gene. DEMETHYLATING the region can ACTIVATE that gene & lead to the production of the protein for which it codes. 64  RNA Interference (RNAi) RNAi: 21-25 nt fragments, which bind to the complementary portion of the target mRNA and tag it for degradation 65 Epigenetic phenomena are changes in gene expression and chromatin configuration which are independent from DNA sequence, hence genetics. The non genetic influence to gene expression Schematic of the mechanisms of epigenetic regulation Homologous chromosomes Diploid (2n) Cellular condition where each chromosome type is represented by two homologous chromosomes. Haploid Cellular condition where each chromosome type is represented by only one chromosome.  Two important terms... Phenotype: The outlook of an organism Genotype: The genetic information written in DNA Phenotypes Genotype Genotype GCCAAGAATGGCTCCCACC ATGTTTCCACCTTCAGGTTCC T ACTGGGCTGATTCCCCCCTC GGCTCTCAGACATTCCCCT C GGTCCAACCCCCAGGCCAT CACTTTCAAGCTCGGCCCCT CAAGATGTCTCAGAGAGGC T GGCTAGACACCCAGAGACC TCAACTCAGAGAGGCGGCTA TCAAGTGACCATGTGGGAA GACACCCAGAGACCTCAAGT CGGGATGTTTCCAGTGACA GACCATGTGGGAACGGGATG GGCA TTTCCAGTGACAGGCAG  CELL CYCLE A sequence of stages that a cell goes through during its lifetime. The cell cycle is divided into TWO parts: - Interphase ( G0,G1,S and G2) - Mitosis. 71  MEIOSIS It is the process during which germ cells of the ovary (primary oocytes) or testicle (primary spermatocytes) give rise to MATURE eggs or sperms. It involves DNA replication, followed by 2 cell divisions, which results in 4 daughter cells, each with 23 (unpaired haploid) chromosomes. 72  Genetic diversity 2 meiotic events are the cause of genetic diversity in gametes Shuffling of genetic material/recombination event/crossing over Independent assortment Meiosis I: New chromosomes consisting of Chromosomes segregate independently of alternating portions of the grandmother's one another during meiosis and the grandfather's chromosomes Mutation If a MISTAKE is: IDENTIFIED: proof-reading or other enzymes remove & correct it, OR the cell may initiate its own death (APOPTOSIS). IDENTIFIED BUT NOT REPAIRED & the cell DOES NOT UNDERGO APOPTOSIS → a mutation will exist. 74 Point mutation Point mutations are the most common type of mutation. A single point mutation, also called a base substitution, occurs when a single nucleotide is replaced with a different nucleotide. There are three types of point mutations: Silent mutation Missense mutation Nonsense muation 75 Results of point mutations Silent mutations Causes no change in the activity of the protein Because the genetic code is degenerate (most amino acids are coded for by several alternative codons), the resulting new codon may still code for the same amino acid. 76 Results of point mutations Missense mutations = produces Nonsense mutations = produces a change in amino acid in protein but STOP codon in the midst of the does not change the function of the mRNA transcript; can produce a non- protein functional protein 77 Pathophysiology CANCER Lecture 5 Ass. Prof. Eman Ramadan & Yasmeen M Attia, PhD Department of Pharmacology, BUE  Cancer Arises From Gene Mutations Germline mutations Somatic mutations Parent Child All cells Somatic Mutation mutation affected in in egg or offspring (eg, breast) sperm Present in egg or sperm Occur in nongermline Are heritable tissues Cause cancer family Are nonheritable syndromes 79 80  Cancer All cancer involve changes in genes….. During mitosis and DNA replication. Mutations are normally corrected by DNA repair mechanisms If repair mechanisms or cell cycle regulation is damaged Cell accumulates too many mutations….tumor develops 81 The principal targets of genetic Mutations Four classes of normal regulatory genes: Growth-promoting ( proto-oncogenes ) Growth-inhibiting (tumor suppressor genes) Genes that regulate programmed cell death (apoptosis) Genes involved in DNA repair 82 Physiological Concepts 1- Cellular Reproduction 2- Cellular Differentiation 3- Cellular Recognition & Adhesion to Like Cells 4- The Cell Clock  1- Cellular Reproduction In Fact, the Two Broad Categories of Genes whose end products ultimately control the cell cycle are: Tumor Proto- Suppressor Oncogenes Genes  Control of Cellular Reproduction 1- Hormones, Growth Factors, & Chemicals 2- Physical Cues 3- Cytoplasmic Second Messenger System 4- Tumor Suppressor Genes 5- Proto-Oncogenes  Control of Cellular Reproduction 1- Hormones, Growth Factors, & Chemicals 2- Physical Cues by releasing locally active chemicals, & by passing ions & other small molecules through channels (Gap Junctions)  Control of Cellular Reproduction 3- Cytoplasmic Second Messenger System The Cytoplasmic Signal Cascade begins after a protein hormone, growth factor, or other chemical binds to a cell membrane receptor & Turns on a Specific Second Messenger System Activated Cytoplasmic Second Messenger Proteins (e.g. ras Protein) relay the growth-controlling signal to the Nuclear Transcription Proteins The Normal ras Protein Transmits Stimulatory Signals from bound growth factor receptors on a cell’s membrane To Other Proteins down the line that ultimately Turn on Cell Cycling  Control of Cellular Reproduction 3- Cytoplasmic Second Messenger System Many Cancer Cells show a Mutation in the Gene that produces the ras Protein, such that it is always produced (Uncontrolled Cellular Proliferation even when growth factors are not present) This Gene Mutation was discovered as the First Human Oncogene in Bladder Cancer Cells - Hyperactive ras Proteins are found in about 1/4 of All Human Tumors  Control of Cellular Reproduction 4- Tumor Suppressor Genes Code for Proteins that Slow Down or Stop the second messenger, including proteins that Interfere with the Functioning of the Stimulatory ras Protein Some including the Rb Gene & the p53 Gene produce Proteins that Code for Important Brakes that act directly on cells about to commit to going through the cell cycle  Examples for Tumor Suppressor Genes 1- The Rb Gene Codes for the Rb Protein, the Master Brake of the Cell Cycle - without this protein, the cell cycle is constantly in the: “on mode” & cellular reproduction can occur non-stop Its Mutations have been Identified in a Variety of Human Cancers including bone, bladder, pancreatic, small cell lung, & breast cancer, + the cancer after which the gene was named, retinoblastoma Mutations in the Rb Locus have been identified in up to 70% of individuals with osteosarcoma  Examples for Tumor Suppressor Genes 2- The p53 Gene 1- Codes for p53 protein 2- Protein acts as a powerful brake 3- Protein causes the cell either to pause or undergo apoptosis 4- Ensures that a genetic error is not passed on 5- Its mutations occur in 75% of colorectal p53 cancers gene 6- Most common genetic cause of human cancer (50% of all tumor types)  Control of Cellular Reproduction 5- Proto-Oncogenes ✓ Are genes found in all cells that, when activated, stimulate a cell to go through the cell cycle, resulting in: Cellular Growth Proliferation  Examples for Proto-Oncogenes The myc Genes Are a Family of Proto-Oncogenes that code for transcription factor proteins that drive cellular reproduction In Healthy Cells, they are activated ONLY in response to growth factors acting on the cell surface In Many Types of Cancer, they are turned on constantly, even in the absence of growth factors When Normal Proto-Oncogenes become Overactive & cause Uncontrolled Cell Division, they are called Oncogenes (Cancer- Causing Genes)  Examples for Proto-Oncogenes The myc Genes Typically, after early embryonic life Oncogenes are turned off or tightly controlled Exposure to a Carcinogen can damage the cell’s DNA & cause overstimulation of the oncogene resulting in development of Cancer Cells - Overstimulated Oncogenes produce Excess Cyclins that Interfere With Suppressor Genes & thus interrupt the balance between cell growth initiation & suppression App. 70 Oncogenes have been identified & it is noteworthy that these Are Not Abnormal Genes - they are part of a normal cell & Only Become Problematic When Exposed to a Carcinogen Physiological Concepts 1- Cellular Reproduction 2- Cellular Differentiation 3- Cellular Recognition & Adhesion to Like Cells 4- The Cell Clock  2- Cellular Differentiation Is the process of development in which cells acquire specialized characteristics including Structure & Function Normal Cells differentiate during development & aggregate with similar differentiated cells  2- Cellular Differentiation The More Highly Differentiated a cell, the less frequently it will go through the cell cycle to reproduce & divide Neurons are highly specialized cells & do not retain the ability to reproduce after the nervous system is completely developed - Skin & Mucosal Cells continue to be proliferative Cells that seldom or never go through the cell cycle are unlikely to become cancerous, whereas cells that go through the cell cycle frequently are more likely to become cancerous  3- Cell Recognition & Adhesion to like cells Normal Cells adhere to others of the same type & group together The mechanisms by which cells recognize each other may involve chemical cues secreted only by certain cells & bound by receptors present only on similar cells These Surface Proteins (Cell Adhesion Molecules)  4- The Cell Clock Telomeres, are the end pieces of chromosomes that shorten with each division - when the Telomere length becomes sufficiently short (indicating that it has divided a certain number of times) the cell stops dividing Putting the brakes on cell division in response to Telomere Shortening requires that the cell has Functioning Rb & p53 Proteins ( stop dividing). Pathophysiological Concepts 1- Uncontrolled Cellular Reproduction and Autonomy 2- Anaplasia 3- Loss of the Cell Clock 4- Nuclear & Cytoplasmic derangement  1- Uncontrolled Cellular Reproduction and Autonomy Cancer Cells Spend little time in the G Stages of Interphase & are frequently found in the S Stage of Interphase as well as M Stage - this Information is vital When Selecting Treatment for different types of cancer Uncontrolled Cellular Reproduction occurs when cells become independent of normal growth control signals - this Characteristic = Autonomy  2- Anaplasia A change in the cell's structure with loss of differentiation By undergoing Anaplasia Cancer Cells lose ability to perform previous functions & bear little resemblance to their tissue of origin Some Cancer Cells may become Ectopic Sites of hormone production - - e.g Lung Cancers frequently become ectopic sites of hormone production (ADH or parathormone)  3- Loss of the Cell Clock Many Cancer Cells secrete an enzyme, Telomerase, that acts to replace the telomere ends of chromosomes that shorten with each cell division = a Destruction of the Cell Counting System & Immortality of the cell Telomere replacement allow Cancer Cells to continue to divide, increasing its number Also it gives time to accumulate more mutations, some of which may improve the cell’s ability to evade the immune system or produce newer, more potent growth-stimulatory factors