MCB Lecture PDF - Molecular Biology Lecture Notes Fall 2024

Lecture I Lecture 1: Overview of Molecular Biology Lecture Outline Overv...

Lecture I Lecture 1: Overview of Molecular Biology Lecture Outline Overview of What are the chemical and physical Molecular Biology structures of nucleic acids? Nucleic Acid Structure How do these structures contribute to the storage and expression Base-pairing as an of genetic information? organizing principle Reading: Ch. 8.1-2 Secondary, tertiary structure Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 7 Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 8 The Mendelian gene Genes are made of DNA - conserved across conserve Physical / chemical a ll organisms & ↳ gene seg. differ evolve Gregor Mendel pea plants Similar DNA genes encode proteins Same “machinery” for Heritable traits are discrete genes inheritance & expression expressed in an individual dominance and recessivity Different DNA in different genes inherited by offspring encodes different proteins segregation Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 9 Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 10  central dogma A biochemical view of genetics Lecture Outline Replication Overview of Molecular DNA = info storage Biology & turn into Transcription Nucleic Acid MRNA Structure Translation ↓ proteins Base-pairing as an Having or lacking an enzyme organizing principle is a heritable trait One gene / one enzyme hypothesis Secondary, tertiary structure Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 11 Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 12 Nucleic acids Nucleotides are the monomers ↓ of NA O monomer Backbone is constant C sugar-phosphate O The structure and chemistry of Ester linkage nucleic acids enables information storage in a polymer O O Bases vary P specific pairing O * no OH in DNA Phosphoester linkage Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 13 Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 14  Nomenclature pedantry The nucleic acid backbone imparts directionality RNA has hydroxyl group 5’ S less stable blo * DNA hydroxyl can be polymerase makes cleared/hydrolyzed Nucleoside (no phosphate) polymer 3’ Nucleotide (with phosphate) O nucleophile Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 15 Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 16 Nucleic acid components can adopt varying conformations The pentose (sugar) conformations matter Tetrahedral DNA “prefers” (lowest RNA “prefers” (lowest (like sp3 carbon) energy) 2’-endo energy) 3’-endo DNA 2'endo - double helix ring = ribose : RNA = 3'endo > - diffstMG Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 17 Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 18 Of on RNA close to phosphate group-leave  accept protons ↑ The Properties of Nucleotide Bases Affect the Three- There are two classes of nitrogenous Bases Dimensional Structure of Nucleic Acids OUT AG flat > - can stack Pyrimidine Purine & weakly basic compounds aromatic molecules because most bonds in the ring have partial double-bond character: pyrimidines are planar purines have a slight pucker Aromatic nature = UV absorbance (deoxy)ribose (deoxy)ribose S detect wsur 5-methyl uracil Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 19 Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 20 - 200 nm-amut of nucacids Bases are often enzymatically modified; methylation Lecture Outline common in DNA regulation plu A and G Overview of Molecular gene intermediate allow Biology ↑ -expression Nucleic Acid Structure Base-pairing as an organizing principle (But not driving force of stability…) Secondary, tertiary structure Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 21 Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 22  Bases pairing is core structural characteristic of DNA Hierarchical Levels of Nucleic Acid Structure (and central to duplication of genetic information) Sequence 2H bonds primary structure = covalent structure and nucleotide sequence Watson secondary structure = regular, stable structure taken up by some or all the nucleotides Crick tertiary structure = complex folding of large chromosomes or the elaborate folding of tRNA or rRNA structures complex 3 H ponds Franklin folded Model was based on Franklin’s iconic data! Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 23 Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 24 Hydrogen bonding of base pairing interactions Schematic view of anti-parallel structure double-helical DNA strands are Adenine Thymine (Uracil) complementary: when A occurs in one chain, T is found in the other when G occurs in one chain, C is found in the other hydrogen bonding contributes less to stability of the structure than one might expect (next section); stability is mediated largely by stacking of bases Guanine Cytosine Do not as important as stacking Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 25 Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 ↓ 26 Hond in blu  thumb-direction of strand 8 Watson-Crick-Franklin double-stranded B-form DNA Double helix is right- handed 3’ 5’ RNA and DNA adopt slightly different forms DNA Forms are often sequence (or RNA (usually) sometimes salt/water content) 10.5 bp / turn (usually) dependent antiparallel = run in 2 welix opposite directions offset pairing of the two strands creates a major groove and a minor groove 3 hydrogen bonds form between G and C; 2 hydrogen bonds form between A and T 10.5 base Don’t have to memorize all Note packing of bases 3’ 5’ pairs parameters Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 27 Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 28 Lecture Outline Double-Helical DNA and RNA Can Be Denatured Overview of Molecular denaturation, or melting, of the double Biology helix: due to pH extremes or high temperatures disrupts hydrogen bonds and base- Nucleic Acid Structure stacking interactions monitoring UV absorption at 260 nm can detect the transition from double- stranded to single-stranded DNA Base-pairing as an organizing hypochromic effect = decrease in the absorption of UV light when principle complementary strands are paired hyperchromic effect = observed increase in UV absorption when Secondary, tertiary denatured structure Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 29 Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 30  Example: one can measure the DNA can adopt structure such as temperature denaturation hairpins and cruciforms hairpin and cruciform structures = form from the self- Melting temperature complementarity within each strand (TM) is stabilized by: G C > A T RNA double longer > shorter helix more RNA RNA > RNA DNA Stable than > DNA DNA DNA G C, A U > G U > mismatches Major finding: base stacking, not hydrogen bonding, contributes majority of favorability. Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 31 Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 32 DNA can also form more elaborate Many RNAs Have More Complex Three- structures, e.g. with three DNA strands Dimensional Structures Hoogsteen positions = N-7, O6, and N6 of purines participate in the hydrogen bonding with a third DNA strand Hoogsteen pairing = the non-Watson-Crick pairing triplex DNAs = form from Hoogsteen pairing still helical ~ mRNA is generally single-stranded right-handed helical conformation dominated by base-stacking interactions strongest between two purines can base pair with complementary regions of DNA or RNA paired strands are antiparallel Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 33 Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 34  RNA can adopt elaborate 3D structures Nucleic acid secondary structure more like a protein Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 35 Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 36 Gel electrophoresis, a method There are various methods for detecting nucleic for visualizing molecular size acids using fluorescence or radiation UV Visible negative Fluorescence Radiation 2,000 base pairs 32P O-PO2--O 1,000 base pairs Ethidium ☢ Bromide 32S 500 base pairs 250 base pairs positive Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 37 Lecture 01: Nucleic Acids: Structure MCB102 Fall 2024 38  Lesture 2 Lecture 2: Nucleic Acid Chemistry Lecture outline What chemical reactions Common Chemical occur to nucleic acids? Reactions How do these reactions help or hurt Making and Breaking the transmission of genetic information? Phosphoester Bonds Sequencing of Nucleic Acids How do we learn the sequence of a DNA molecule? Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 1 Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 2 Our abstracted information carrier has a physical layer; Deamination is a common spontaneous reaction these molecules can partake in chemical reactions Car T-equiva convert Most prevalent Also in base editing deamination = spontaneous loss of exocyclic amino groups Important in evolution deamination of cytosine to uracil = ~100 events/day recognized as foreign in DNA and removed Notable in base almost certainly why DNA editing contains thymine rather than uracil common mutation in genome Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 3 Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 4  Cytosine deamination can lead to mutation Deamination and distinguishing thymine vs uracil cell can't G≡C Uracil in DNA ~ Repair distinguish G=U Cytosine Uracil ≠ Spontaneous cytosine deamination: G≡C A=U Cytosine Uracil Thymine Rate ~5×10-13 s-1 = 1 / 50000 years Spontaneous cytosine deamination: ~3 billion cytosines / cell After C→U, DNA Thymine methyl distinguishes it from C→U replication inserts A Uracil in DNA efficiently removed and repaired 5 C→U / cell / MCB102 lecture Mutation: C→U and G→A always checking genome Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 5 Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 6 Ancient DNA highlight (2022 Nobel Prize for former Enzymatic cytosine deamination Berkeley research fellow Svante Paabo!) Cytosine Uracil Cytosine Uracil Enzymatic cytosine deamination: Spontaneous cytosine deamination: Activation-induced deaminase: 50,000 year timescale for ancient DNA sequencing mutates antibody genes in B lymphocytes High frequency C→U changes in ancient DNA APOBEC enzymes: mRNA editing by C→U changes encoded protein in some genes anti-viral “editing” C→U Related to a type of genome editing called base editing Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 7 Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 8  Adenine can also be deaminated Cytosine methylation Donor Acceptor 5-Methylcytosine: Analogous to thymine Uracil Cytosine No change to H-bonding Adenine Hypoxanthine Guanine No change to base pairing (Base in inosine) Adenine deamination: Hypoxanthine nucleoside is called inosine Adenosine deaminase: A→I editing in mRNA Thymine 5-methylcytosine Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 9 Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 10 More on cytosine and methylation Methylation and deamination Uracil in DNA Repair Cytosine methylation: S-adenosylmethionine source of methyl Bacterial cytosine (and adenine) methyl: Mark “self” DNA versus bacteriophage DNA Eukaryotic cytosine methylation (5MeC): Cytosine Uracil Cytosine Occurs at CpG sites Important in controlling gene expression Non-base-pairing information in DNA Thymine in DNA 5-MeCytosine Thymine What’s the problem? 5-methylcytosine Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 11 Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 12  Lecture outline Transesterification Cutting, extending, and joining nucleic acid sequences Essentially one chemistry for all backbone changes: Transesterification Common Chemical Reactions Nucleophilic attack on a phosphate Pentavalent phosphate intermediate or transition state Resolved by a different group leaving the phosphate Making and Breaking Phosphoester Bonds Sequencing of Nucleic Acids Intermediate Nucleophile Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 13 Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 14 RNA self-cleavage - 2’ OH is a built-in nucleophile Enzymes The kinds of enzymes that make or break backbone bonds Named according to reactions they carry out Nuclease Breaks apart DNA or RNA backbone Hydrolysis — transesterification onto water Exonuclease cuts only at the ends of molecules Endonuclease cuts in the middle of molecules Many specificities — DNA vs RNA, ss vs ds, sequences Polymerase Joins nucleotides into nucleic acid polymers Usually adds to the end of existing DNA or RNA Always adds at the 3’ end, on a 3’-OH Uses nucleotide 5-triphosphates: NTPs or dNTPs The 2’-OH on RNA can act as a nucleophile 25º C, neutral pH: 4-year half-life Ligase Joins 3’ end of one polymer to 5’ end of another Heat, alkali, cations accelerate this Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 15 Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 16  Restriction endonucleases: enzymes that cut DNA Restriction endonucleases: enzymes that cut DNA HO:⊖ 5’ Cuts in the middle 5’ P P P P P P P P P P P P of dsDNA at a specific “recognition sequence” 4 - 8 bases long P P P G A G A A T T C T A C C C T C T T A A G A T G G 3’ P P P P P P P P P P P P 3’ 1’ (deoxy-)ribose HO:⊖ G A 5’ Cuts each strand 5’ P P P P P P P P P P P P OH A A T T C T A C C Often cuts only unmethylated DNA G A T G G G A G Bacterial genome is methylated C T C T T A A Virus (bacteriophage) DNA is not methylated OH P P P P P P P P P P P P Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 17 Lecture 02: Nucleic Acids: Chemistry and Reactions 3’ MCB102 Fall 2024 18 Polymerases synthesizes nucleic acid polymers Polymerases in detail DNA and RNA Polymerases: Adding nucleotides to DNA (or RNA): 3’-OH activated for nucleophilic attack on the first (α) phosphate of dNTP (or NTP) with 5’-triphosphate Inorganic pyrophosphate (PPi) leaves Pyrophosphate typically hydrolyzed, which improves thermodynamics 3’ end of primer strand grows (5’ → 3’ on synthesized strand) Base pairing of dNTP with template nucleotide Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 19 Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 20  Sequencing with ddNTPs Sequencing with ddNTPs 5’-GAG-3’ 5’-GAG-3’ 3’-CTCTTAAGATCG-5’ 3’-CTCTTAAGATCG-5’ DNA Polymerase DNA Polymerase DNA Polymerase dATP, dCTP, dGTP dATP, dCTP, dGTP dATP, dGTP, dTTP dideoxyTTP dideoxyTTP dideoxyCTP 5’-GAGA-3’ 5’-GAGAAT-3’ 5’-GAGAA-3’ 5’-GAGAAT-3’ 5’-GAGAATTC-3’ 3’-CTCTTAAGATCG-5’ 3’-CTCTTAAGATCG-5’ 3’-CTCTTAAGATCG-5’ Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 25 Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 26 Thought experiment on adding Now, consider adding in a small ddNTPs to polymerase reaction amount of ddNTPs 5’-GAG-3’ 3’-CTCTTAAGATCG-5’ 5’-GAG-3’ ⊖ ddATP ddCTP ddGTP ddTTP 3’-CTCTTAAGATGG-5’ DNA Polymerase dATP, dCTP, dGTP 12 5’-GAGAATTCTAG-3’ 5’-GAGAAT-3’ a small amount 3’-CTCTTAAGATGG-5’ 5’-GAGAATTC-3’ dideoxyTTP 5’-GAGAAT-3’ or … 4 5’-GAGA-3’ mostly dTTP 5’-GAGAAT-3’ 3 3’-CTCTTAAGATGG-5’ 2 1 ⊕ Gel Electrophoresis Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 27 Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 28  Now, consider adding in a small Now, consider adding in a small amount of ddNTPs amount of ddNTPs 5’-GAG-3’ 5’-GAG-3’ 3’-CTCTTAAGATGG-5’ 3’-CTCTTAAGATGG-5’ DNA Polymerase DNA Polymerase dATP, dCTP, dGTP dATP, dCTP, dGTP 5’-GAGAAT-3’ 5’-GAGAAT-3’ a small amount 3’-CTCTTAAGATGG-5’ a small amount 3’-CTCTTAAGATGG-5’ dideoxyTTP dideoxyTTP mostly dTTP 5’-GAGAATT-3’ mostly dTTP 5’-GAGAATT-3’ 3’-CTCTTAAGATGG-5’ 3’-CTCTTAAGATGG-5’ or 5’-GAGAATT-3’ 5’-GAGAATTCT-3’ 3’-CTCTTAAGATGG-5’ 3’-CTCTTAAGATGG-5’ Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 29 Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 30 Sanger sequencing uses fluorescent ddNTPs Sanger sequencing uses fluorescent ddNTPs and capillary electrophoresis and capillary electrophoresis “Modern” Sanger sequencing One reaction Different dyes per ddNTP Simultaneously terminate and label DNA Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 31 Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 32  DNA sequencing is changing rapidly: Illumina bandwidth is possible because sequencing Reversible Terminator Sequencing occurs at small physical scale on a miscroscope aka Illumina sequencing Time in cycles Uses four different modified deoxynucleotides (A, T, G, and C), each with a particular fluorescent label and a 3′ blocking group Advantage: millions to billions of molecules are sequenced Each dot is a small cluster of many of the same DNA molecules being sequenced Disadvantage: reads are short, e.g. ~150 base pairs Flow cell Example reversible terminator Fluorescent, zoomed-in view of flowcell Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 33 Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 34 DNA sequencing is changing rapidly: Single Molecule Sequencing aka PacBio (or SMRT) Advantage: single molecule processisivity allows read length averages >10,000 bp which can be VERY helpful in many cases Disadvantages: physical complexity of flow cell results in lower throughput (~10 millions reads) and higher cost Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 35  Lect 2. Continued: DNA Sequencing DNA sequencing is changing rapidly: Reversible Terminator Sequencing aka Illumina sequencing >4 methods in use; we’ll talk about 3 Uses four different modified deoxynucleotides (A, T, G, and C), each with a Sanger (Old school): 1 ‘read’ of 1000 bp for $10 particular fluorescent label and a 3′ blocking group Illumina (short read): 108 reads of 100 bp for $1000 Advantage: millions to billions of molecules are sequenced PacBio (long read): 107 reads of 10000+ bp for $1000 Disadvantage: reads are short, e.g. ~150 base pairs Nanopore (not covered here) Wikipedia Ultimately, this is just a text file in a computer: ATGAGTGACTGACTGATGTGTGTCGATAGCTAC… Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 1 Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 2 Illumina bandwidth is possible because sequencing DNA sequencing is changing rapidly: occurs at small physical scale on a miscroscope Single Molecule Sequencing Time in cycles aka PacBio (or SMRT) Each dot is a small cluster of many of the same DNA molecules being sequenced Advantage: single molecule Flow cell Example reversible terminator processisivity allows read length averages >10,000 bp which can be VERY helpful in many cases Disadvantages: physical complexity of flow cell results in lower throughput (~10 millions reads) and higher cost Fluorescent, zoomed-in view of flowcell Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 3 Lecture 02: Nucleic Acids: Chemistry and Reactions MCB102 Fall 2024 4  Lecture 3 Lecture 3: DNA Topology and Chromosomes Lecture Outline Chromosomes include dedicated sequences that ensure their replication, transcription, packaging, and transmission from one generation to the next. They are more than a long stretch of protein-encoding genes. Chromosomes Chromosomes are large. To constrain them in a small space can require multiple layers and multiple modes of tertiary structure. Chromosomes in all cells are maintained in a state of torsional stress. DNA is underwound relative to the stable B-form Topology and Supercoiling structure, facilitating both the packaging of DNA and access to the genetic information contained within it. Specialized proteins and RNAs maintain chromosome structure. Topoisomerases control DNA underwinding. Histones, Topoisomerases condensins, cohesins, and other DNA-binding proteins provide scaffolds to organize chromosome structure. Certain long, noncoding RNAs also play important roles in chromosome structure and function. Chromatin How do cells cope with “tangled” DNA? How do cells package and compact their genome? Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 5 Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 6 Modern Molecular Definitions Reminder on colinearity of DNA, mRNA, and Protein mutations = alterations in DNA sequence each amino acid of a polypeptide chain the one gene-one enzyme hypothesis = a gene is a segment of genetic is coded for by three consecutive material that determines, or codes for, one enzyme nucleotides in a single strand of DNA later broadened to one gene-one polypeptide hypothesis (“codon”) gene = all the DNA that encodes the primary sequence of some final gene a polypeptide chain of 350 amino acid product (polypeptide or RNA with a structural or catalytic function) residues (an average-size chain) corresponds to 1,050 base pairs (bp) genome = the complete (haploid) set of genetic material of an organism of coding DNA regulatory sequences = segments of sequences of DNA that have a purely regulatory function phenotype = observable property of the biological system Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 7 Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 8  Chromosomes: Bacteria Reference of genome sizes E. coli: 4,435 genes in 4.6 Mbp genome ~1 kb / gene 1.7 mm DNA in a 2 µm cell Circular chromosome Small circular “plasmids” Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 9 Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 10 Human genome is more complex, e.g. chromosomes Eukaryotic genes are also more complex Humans: ~25,000 (?) genes in 3,100 Mbp genome ~125 kb / gene (!!!) Human proteins aren’t 100× bacterial Introns and exons: 1 meter DNA in a ~6 µm nucleus Bacterial genes are typically uninterrupted 2 sets of 23 linear chromosomes in each Eukaryotic genes split by many introns diploid cell In animals, introns usually larger than exons Human genome ~1/3 introns + exons ~2/3 simple or complex repeats Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 11 Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 12  Centromere and telomeres are important features of linear, eukaryotic chromosomes Lecture Outline Chromosomes Topology and centromere = a DNA sequence that functions during cell division as an attachment point for proteins that link the chromosome to the mitotic spindle Supercoiling essential sequences in yeast are ~130 bp long and are very rich in A=T pairs sequences of higher eukaryotes are longer and generally consist of thousands of tandem Topoisomerases copies of one or several sequences of 5 to 10 bp telomeres = sequences at the ends of eukaryotic chromosomes that help stabilize the chromosome shortened after each round of replication and end with multiple repeated sequences of the form: (5′)(TxGy)n Chromatin (3′)(AxCy)n (where x and y are generally between 1 and 4 and n is in the range of 20 to 100 for single- celled eukaryotes and >1,500 in mammals) Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 13 Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 14 DNA and topology DNA Winding Is Defined by Topological Linking Number (Lk) topology = the study of the properties Linking number (Lk) of an object that do not change under Circular backbones cannot untwist continuous deformations (for DNA this means breaking covalent bonds) Circles have an integer number of links DNA is naturally coiled (i.e. it is helical) Lk is positive for strands interwound in a which can be quantified right-handed helix Moreover, it also displays supercoiling Lk is negative for strands interwound in a = the coiling of a coil left-handed helix (not normally encountered in DNA) Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 15 Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 16  Linking Number (Lk) applied to closed-circular DNA Linking number is a function of Twist and Writhe without supercoiling when relaxed (not supercoiled), linking number is Coiling of the double helix gives designated Lk0 rise to twist (Tw) Lk0 = # of bp / # of bp per turn Supercoiling gives rise to writhe (Wr) if there is a break in either strand, no topological logical bond exists and Lk is undefined Total linking = Twist of individual strands + Writhe of helix DNA naturally adopts Lk +1 every 10.5 bp Twist Lk = Tw + Wr B-form Writhe (supercoil) Confusing part: Tw: Right-handed is positive linking / left is negative 10.5 bp Wr: right is negative / left is positive DNA underwound = if Lk < Lk0 Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 17 Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 18 Positive and negative supercoiling Most Cellular DNA Is Underwound Lk = Tw + Wr Tw = +200 Wr = 0 If DNA topology is modified (e.g. untwisted) it will adopt altered Wr to compensate and keep Tw at the favored value Tw = +200 Tw = +200 To reach favorable twist Wr = -2 Wr = +2 Observed as underwound / negatively (one twist / 10.5 bp) supercoiled (these mean the same) add or subtract writhe of the when isolated from cells whole double helix Negative supercoil Negative supercoiling = Why?? right-handed helix Allows for access to DNA strands right-handed supercoil Fundamental to DNA packaging in DEMO chromatin Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 19 Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 20  DNA topology and RNA polymerase DNA topology and RNA polymerase DNA Topology Total Lk unchanged Transcription elongation removes Tw adds Wr ahead adds Tw removes Wr behind Retwist In a simple circle, these cancel Total Lk unchanged In most chromosomes, Transcription requires Slight negative supercoil: melting DNA DNA constrained in domains 5% - 7% underwound Supercoiling cannot cancel Superhelical density σ σ = (Lk - Lk0) / Lk0 ≈ -0.05 to -0.07 Favors melting DNA Tw decreases (-1 / 10.5 bp melted) Untwist Wr increases (less negative) Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 21 Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 22 Lecture Outline Topoisomerases: topology changing enzymes Topoisomerases: Enzymes that change DNA topology by cleaving and re-ligating DNA Chromosomes Type I topoisomerases often relax DNA (eliminate negative supercoils; increasing Lk) but depends on enzyme Topology and Supercoiling Type II topoisomerases often introduce negative supercoils (i.e. decreasing Lk) but also depends on specifics Topoisomerases Chromatin Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 23 Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 24  Topoisomerase mechanism Type II topoisomerases Type I Topoisomerase: breaks 1 strand (Lk +/-1) Type II Topoisomerase: breaks 2 strands (Lk +/-2) Nucleophilic attack Nucleophilic attack by 3’ OH by tyrosine hydroxyl Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 25 Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 26 DNA intercalating dyes can alter Twist/Writhe Example: putting concepts together Lk = 200 Tw = 175 (1 / 12 bp) Intercalating agents Lk = 200 Wr = +25 (positive sc) e.g., ethidium bromide Tw = 200 (1 / 10.5bp) 2100 bp Add Ethidium Binds DNA Wr = 0 (relaxed) to 30º twist flat, aromatic character (1 turn / 12 bp) Alters structure: DNA favors having less twist Add type I topoisomerase Wash out Lk = 175 topoisomerase Tw = 175 (1 / 12 bp) then ethidium Wr = 0 (relaxed) Lk = 175 Tw = 200 (1 / 10.5 bp) Wr = -25 (negative sc) Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 27 Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 28  Lecture Outline Aside: Bacterial DNA topology Chromosomes Plectonemic Topology and Supercoiling supercoiling from gyrase Topoisomerases Chromatin E coli (bacterial) genome Organized into ~10,000 bp looped domains NO consistent boundaries Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 29 Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 30 Towards eukaryotes: solenoidal supercoiling DNA in eukaryotes is stored in chromatin, which consits of DNA, Proteins, and RNA Two freely interchangeable Right-handed plectonemic = shapes of supercoiling (Wr) chromatin = eukaryotic negative supercoil chromosomal material composed of Left-handed DNA, RNA, and proteins solenoidal = amorphous in G0 and interphase negative supercoil (G1, S, and G2) phases In the S phase of interphase, the amorphous DNA replicates to produce sister chromatids Plectonemic Solenoidal DEMO Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 31 Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 32  Chromatin DNA Wrapped Around a Histone Core Solenoidal supercoiling Histone octamer: 2 each of core histones 146 bp DNA Eukaryotic DNA is packaged H2A, H2B, H3, and H4 1.67 turns into chromatin histones = proteins that are tightly associated with chromatin Proteins and function to package and order DNA the DNA nucleosomes = the fundamental structural unit of chromatin composed of core histone Histones bind DNA proteins bound to DNA DNA = acidic = ⊖ at pH 7 Histones = basic = ⊕ at pH 7 Rich in basic (Arg, Lys) residues Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 33 Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 34 Nucleosome organization Nucleosomes and supercoiling 146 bp wrapped ~200 bp around nucleosome between nucleosomes very uniform quite variable Histones maintain negative supercoiling in eukaryotic DNA DNA wrapping around the histone core requires removal of ~1 helical turn in the DNA Eukaryotes: no gyrase Only “relaxing” topoisomerase plus solenoidal supercoiling linker DNA around histone octamers Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 35 Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 36  Histone tails (later we’ll see involved in gene regulation) Chromosomal Organization in Eukaryotic Nucleus Chromosomes are highly Histone “tails”: condensed and organized just Amino-terminus of histone before cell division. Unstructured Chromosomes appear dispersed Many post-translational modifications: during interphase. serine phosphorylation lysine and arginine methylation Active / inactive compartments lysine acetylation (heterochromatin) are organized Etc. into topologically associating domains (TADs) = large These ‘epigenetic’ modifications can alter segments of DNA which are gene expression organized in loops Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 37 Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 38  Lecture Outline - Lecture 3 Cont. Aside: Bacterial DNA topology Chromosomes Plectonemic Topology and Supercoiling supercoiling from gyrase Topoisomerases Chromatin E coli (bacterial) genome Organized into ~10,000 bp looped domains NO consistent boundaries Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 1 Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 2 Towards eukaryotes: solenoidal supercoiling DNA in eukaryotes is stored in chromatin, which consits of DNA, Proteins, and RNA Two freely interchangeable Right-handed plectonemic = shapes of supercoiling (Wr) chromatin = eukaryotic negative supercoil chromosomal material composed of Left-handed DNA, RNA, and proteins solenoidal = amorphous in G0 and interphase negative supercoil (G1, S, and G2) phases In the S phase of interphase, the amorphous DNA replicates to produce sister chromatids Plectonemic Solenoidal DEMO Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 3 Lecture 03: DNA Topology and Chromosomes MCB102 Fall 2024 4  Chromatin DNA Wrapped Around a Histone Core