LO14 - Genetic Basis of Life_The Central Dogma.docx

NANYANG TECHNOLOGICAL UNIVERSITY Hello and Welcome In this online session,you will learn about Genetic Basis of Life: The Central Dogma NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences Describe the steps and components depicted in the central dogma in general; List the characteris...

NANYANG TECHNOLOGICAL UNIVERSITY Hello and Welcome In this online session,you will learn about Genetic Basis of Life: The Central Dogma NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences Describe the steps and components depicted in the central dogma in general; List the characteristics of codons and their relationship to amino acids;and Distinguish between processes that are specific in prokaryotes and eukaryotes. We learnt from the previous LO that the process of "reading"a blueprint (recorded in a set of documents) leads to "carrying out"the instructions provided in it. We have also understood from the of DNAs of an organism)also need to be"read"to "carry out"biological activities. But how exactly are the information coded in DNA processed into biological activities? School of Biological Sciences To understand this,we shall examine a principle referred to as "the central dogma". i s" aries of mechanisms presented in this principle is fundamental to all forms of life . Central Dogma NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences The class of macromolecules that carry out most of the biological activities within an organism are proteins. Proteins are made up of one or more chains of polypeptides (as you have learnt in the module Macromolecules). The region of the DNA that defines the polypeptide/protein is called a gene. NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences In order for the polypeptide to be produced according to the gene,a transient copy of the gene has to be generated as an intermediate step. The central dogma refers to this flow of information from genes (in the form of DNA)to a transient copy of the gene(in the form of messenger RNA) which then directs the sequence of amino acids in a polypeptide/protein. Simply put,the central dogma describes the flow of information as shown below and the direction of flow is absolute and unchanging (no reversal): Select each type of macromolecule to remind yourself of theirrelevant features. Protein (executor of Biological activity) POLYPEPTIDE )DNA (Gene) mRNA NUCLEUS PROTEIN NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences Simply put,the central dogma describes the flow of information as shown below and the direction of flow is absolute and unchanging (no reversal): Select each type of macromolecule to remind yourself of their relevont features. Protein (executor of Biological DNA is a polymer of deoxyribonucleotides. POLYPEPTIDE It carries sequences of 4 bases -A,C,G and T. It has a double helical structure. It exhibits complementary pairing of PROTEIN bases (A:Tand C:G)on the two strands. NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences Simply put,the central dogma describes the flow of information as shown below and the direction of flow is absolute and unchanging (no reversal): Select each type of macromolecule to remind yourself of theirrelevant features. Protein (executor of Biological activity) It exhibits complementary pairing of bases (A:Uand A:T if pairing with DNA and C:G). NUCLEUS PROTEIN NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences Simply put,the central dogma describes the flow of information as shown below and the direction of flow is absolute and unchanging (no reversal): Select each type of macromolecule to remind yourself of theirrelevant features. Proteir (copy of Gene) Protein is a polymer of amino acid residues. It uses 20 types of amino acids in general, but a rare sub-population of them contains 2 other uncommon amino acids. NUCLEUS School of Biological Sciences The 2 stages in this flow of information are referred to as transcription and translation, depicted below. When we say that a gene is expressed,we refer to the outcome when a gene is transcribed,translated and the polypeptide(s)are finally compiled into protein product and made biologically active. Note that some polypeptides are formed as complete protein and become active the moment they are translated,while others may require further modification and activation before becoming biologically functional. The role of a genome is There may be more than one correct option.Please select all options that you think are correct,and then submit. The transient copy of gene is produced in the form of a and the class of macromolecule that eventually carry out the biological activities is There may be more than one correct option.Please select all options that you think are correct,and then submit. A DNA;RNA B RNA;protein C DNA;protein D protein;RNA E protein;DNA NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences You can think of transcription simply as the copying of a part of the larger nucleic acid document,originally set in the DNA dialect,into a transient mobile form,using an RNA dialect. NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences So there must be a system to "translate"information encoded in the 4-base language to the 20-amino acid language. We refer to the"dictionary"of this translation system as The Genetic Code. NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences The genetic code translates the information of RNA presented as a set of three bases (referred to as a codon)into the information of a specific amino acid. The codons run in a continuous sequence (fig.1),and not with extra bases acting as"space"or "punctuation"between one codon and the next (fig.2). NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences Second Bave First Base U A Third Base U UW PHENYLALANINE Ucu 5ERINE UAU TVROSINE UGU CVSTENE U UUC PHENYLALANINE UCC SENINE UAC MHOSINE UGC CVSTUNE C UA LEOAE UCA SERINE UAA STOP UGA STOP UG LEUONE UcG SERINE UAG STOP UGG TRYPTOPHAN G C CUU LtUNE ccu PHOUNE CAU MSNOINE CGU ANONN U ae LFINE cc PBOINE CAC HiS NONE c0c ANNNt C CUA LEUONE CCA PROUNE CAA GLUTAMNE C6A ARGNNF A CUG LEUONE CCG PBOUNE CAG GLUTAMNE CGG ARGNN G AUU socrUoNt ACU TREONINE AAU ASPARAGINL AGU SCRINL U AUC SOEUONE ACC THRtONINE ANC ASPARAGINE AOC SUNE C AUA SOLEUONE ACA TREONUNE AAA LYSINE AGA ARGNNE A AUG ISTART] METHIONINE ACG THREONINE AAG AYSINE AGG ARGNN G G GUU VALINE GCU ALANINE GAU ASPARTATE G0u GLYONE U GUC VALINE GcC ALANINE GAC ASPAKTATE GGC GLYOINE C GUA VALNE GCA ALANINE GAA GLUTAMATL GGA GLYONE A 0U0 VAUNE 000 ALANINE GAO 0UTAMAE 000 GYCNE G Second Basve Art dase U Third Base U UU PHENTLALANINE U SCNINE UAU TVROSINE UGU CVSTENE U UUC PHENLALANINE Ucc SCNINE UAC UGC Codon UCU explicitl represents Serine. UA LEUONE UCA SERINE UG LEUONE UG SERINE C CUU LEUONE ccu PBOUNE a LEUONE coc PNONE CAC HiSNOINE coc ARG C CUA LEUONE CCA PROUNE CAA GLUTAMNE C6A ARGNNE A CUG LEUONE CcG PROUNE CAG GLUTAMNE C66 ARGNNE G AUU SOLUONE ACU TREONINE AAU ASPARAGINL AGU SERINE U AUC sotU0Nt ACC TMMtONINE AAC ASPANAOINE AOC SUNE C AUA ISOLEUONE ACA THRFOAINE AAA USINE AGA ARGNNE A AUG ISTART] METHIONINE ACG THREONINE AAG LVSINE AGG ARGNNE G G Guu VALINE GCU ALANINE GAU ASPARTATE GGU GLYONE U GUC VAUNE Gcc ALANINE GAC ASPARTATE GGC GLYOINE C GUA VAUNE GCA ALANINL GAA GLUTAMAT GGA GLYOINE GU0 VAUNE 000 NLANINt GAG OLUTAMATE 000 GLYONE G NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences Second Bave First Base U A Third Base U UU PHENTLALANINE UCU SERUNE UAU TROSINE UGU CYSTDNE U UUC PHENUALANINE Leucine is represented by these 6 codons. C UA LEUONE A SERINE STOP STOP UUG EUONE UG SERUINE UAG STOP UGG THVPTOPHAN G C CUU LLUONE ccu PHOUNE CAU MSHOINE COU ARONNE U a LFUONE cc PNOINE CAC HS hONt C0C ANONNt C CuA LEUONE CUG LEUONE CCA PROUNE CAA GLUTANE C6A ARx%A A CCG PBOUNE CAG GU A CGG ARC NNE G AUU 150UONE ACU TMLONINL AAU ASPARAGINE AGU SUNINL U AUC Glycin by t METHIUNINF ACC e is repre hese 4 cod THREOAINE AAC sented ons LSINE AOC SINE C AGA ARGNNf A AGG ARGNNE G GUN VALINE GCU ALANINE GAU ASPARTATE GGU GLTOINE U GUC VALINE GCC ALANINE GAC ASPARTATE GGC GLYONE C GUA VAUNE GCA ALANINT GAA GLUTAMATL CGA GLTONE 0U0 VAUNE 000 ALANINE GA0 GLUTAMAT 000 oVoNt G Second Base Third Base First Base U C U UUU PHENLALANINE Ucu SERINE UAU TVROSINE UGU CVSTENE U UUC PHENLALANINE UCC SCHINE UAC THOSINL UGc VSTUN C UA LEUONE UCA SERINE UAA STOP UGA STOP UUG LEUONE UCG SERINE UAG STOP UGG TRVPTOPHAN G CUU LEUONE ccu PROUNE C0U AHNA U c ccc CoC C LH speclic codons that s lgnal the start and E the stop of a olypeptide formation ARGNNE CGA ARGNNE C6G ARGNNE A G AGU SCRINE U AUC 1SOEU ACC THREONINE AAC ASPARAGINE AOC SEHINE C AUW 1SOEU E ACA THREONINE AAA LVSINE A6A ARGNNE RA] WETHONE ACG THREONINE AAG UVSINE AGG ARGNNE G 6U VALINE 60U ALANINE GAU ASPARTATE G6U GLYOINE U GUC VALINE GCC ALANINE GAC ASPARTATE GGC GLYOINE C GUA VAUNE GCA ALANINE GAA GUUTAMATT GGA GLYONE 0U0 VANE 000 ALANINE 0AG OUTAMATE 000 GLYCINE G The part of a gene that defines the amino acid sequence for the protein product is called the coding region. The complete coding region will have to begin with a start codon and end with any one of the stop codons. There are various other ways to refer to the coding region.Open reading frame (ORF) is one example. In eukaryotes,the term exons are used to refer to coding regions when they are associated with the non-coding regions (introns)-we shall see the context of this in the later part of this section. 3' 5' NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences Beyond the coding regions,there are DNA sequences in the non-coding regions that are important for the control of gene expression,which we will cover in the next section on Regulation of Gene Expression. It is important to always keep in mind that DNA consists of both coding and non-coding regions. The statement"one gene,on polypeptide"is often used,and this may give the impression that "gene"refers only to the coding region. However,when we refer to a stretch of DNA sequence as a"gene",it actually includes(1)the complete coding region for that polypeptide and (2)some associated non-coding regions. School of Biological Sciences Check Your Understanding The information flow from RNA to protein is called · A transcription B translation C enzyme reaction D replication E complexification NANYANG TECHNOLOGICAL UNIVERSITY Consider the series of bases in the DNA region below: AGCGTAGAGAGGGGCGTTGAA Which of the following statement(s)is/are true? There may be more than one correct option.Please select all options that you think are correct,and then submit. A It has the right length to code for 7 amino acids. B It has the right length to code for 5 amino acids. 【 》 D E None of the above Which of the following statements describe(s)the redundant nature of the genetic code? There may be more than one correct option.Please select all options that you think are correct,and then submit. A The codon AGG may represent either glycine or arginine. B The codon AGG represents arginine and only arginine. C Phenylalanine may be encoded by the codons UUU or UUC. D The start codon is AUG. E The stop codons are UAG,UAA and UGA. NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences You may learn in greater details the mechanisms of transcription and translation in other courses.In this course, however,we will only cover some of the key steps and components that characterize these two processes. The table below shows the key starting materials and the end products of the 2 processes. Transcription Key Starting materials Deoxyribonudeic Acid (DNA) RNA Polymerase,an enzyme Ribonucleotides (also referred as NTPs) Resulting RNA transcript product Translation Key Starting materials Messenger Ribonucleic Acid (mRNA) Ribosome Transfer Ribonucleic Acids (tRNAs) Amino acids Resulting Polypeptide product School of Biological Sciences School of Biological Sciences Transcription RNA polymerase ,NTPs DNA mRNA RNA transcript CYTOSOL NUCLEUS Select to view the video on transcription. The region where the RNA polymerase binds is called the promoter and transcription starts some distance downstream from it. The RNA polymerase will unwind the DNA duplex so that DNA will stay single- stranded for that short region. It then synthesises RNA by adding on sequentially (ribo)nucleotides which are pairing with the bases on the DNA.As it does that,it moves along the template strand. NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences School of Biological Sciences Ribosome Structure RIBOSOME P-site E-site 5' Large subunit A-site 3' mRNA Small subunit They come together as an mRNA is bound to the small small subunit. Within the ribosome,there are parts which we refer to as A site,P site and E site.The rRNAs that makes up the sites are responsible for catalysing the formation of the polypeptide Select to view the video on aspects of ribosome structure that are relevant to translation. NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences In prokaryotic cell,the chromosome (genetic material)is not separated from the cytoplasm by a nuclear envelope. Hence,the two processes -transcription and translation -are occurring in one common cellular space. NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences On the other hand,in a eukaryotic cell,RNA transcripts are produced within the nucleus which is separated by a nuclear envelope. The RNA transcript therefore needs to migrate out from the nucleus to the cytoplasm in order to bind to ribosome to start translation. NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences TRANSCRIPTION-TRANSLATION COUPLING IN PROKARYOTIC CELL Ribosom subunits mRNA transcript )Transcription DNA RNA Polymerase NO NUCLEUS Let's consider the implication of this. In a prokaryotic cell,there is no nucleus.As the DNA is transcribed by the RNA polymerase and a mRNA transcript is formed,it is exposed to ribosomes present in the cytoplasm. Binding to the ribosome is therefore possible,even when transcription is on- going,as long as the ribosome binding site on the mRNA is exposed. Select to view the video on coupling. NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences TRANSCRIPTION-TRANSLATION COUPLING IN PROKARYOTIC CELL Ribosom subunits mRNA transcript )Transcription DNA RNA Polymerase Select to view the video on coupling. NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences Promoter DNA Coding Strand Eion3 TRANSCRIPNON txant intren 1 mtran 2 Primary Transoript MODIFICATION OF mRNA TRANSCRIPT In a eukaryotic cell,mRNA transcript needs to undergo a series of modifications prior to translation. This is known as post-transcriptional processing. The RNA transcript first produced within the nucleus is known as pre-mRNA because it carries regions which are not meant to be translated. These regions are called introns,and the regions which will eventually be translated are called exons. NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences P DNA Coding Strand Exon3 $ TRANSCRPION Primary Transcript mtran 2 Lxon] sor cooo PyATa Mature mRNA START COOON STOP CODON MODIFICATION OF mRNA TRANSCRIPT Within the nucleus,the pre mRNA is processed in the following ways to form a mature mRNA transcript. 1. Modification of the 5'end (by adding a5'cap of a modified G) 2. Modification of the 3'end (by adding a poly-A tail) 3. Removal of the introns (known as" splicing")to join the exons together Note:In prokaryotes,such processing is unnecessary because genes are not organised in an exon/intron manner. NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences The mature mRNA transcript then migrates out to the cytoplasm where it gets bound by a ribosome to start the process of translation. NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences Translation NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences School of Biological Sciences POST-TRANSLATION MODIFICATION SIGNAL CHAIN peptide B-CHAIN peptide C-CHAIN peptide Polypeptide -Preproinsulin A-CHAIN peptide Select to view the video on post-translation modification of insulin. Insulin is first formed as a single polypeptide,called preproinsulin. Post-translational modification then occurs. Disulphide bonds are formed to secure the A and B segments,and the signal peptide is cleaved off,giving rise to proinsulin. Cleavage of the C segment follows,giving rise to a fully functional insulin molecule. NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences NANYANG TECHNOLOGICAL UNIVERSITY The component(s)that is/are the product of transcription is/are There may be more than one correct option.Please select all options that you think are correct,and then submit. A DNA B RNA transcript C D E RNA polymerase ribonucleotides polypeptide/protein School of Biological Sciences Check Your Understanding The component(s) that is/ are participating in the process of translation is/ are A DNA B mRNA C tRNA rRNA D E polypeptide/ protein Which of the following correctly matches the process to the site where it occurs,with reference to a eukaryotic cell? There may be more than one correct option.Please select all options that you think are correct,and then submit. A Transcription -cytoplasm;translation -cytoplasm B Transcription -cytoplasm;translation -plasma membrane C Transcription -nucleus;translation -nucleus D Transcription -plasma membrane;translation -nucleus Which of the following would you find in a prokaryotic cell but not a eukaryotic cell? There may be more than one correct option.Please select all options that you think are correct,and then submit. A B C D Modified G as a 5cap of mRNA E None of the above NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences The central dogma should universally apply to all biological beings on Earth. However,this is not absolute.It is important to know where these exceptional cases exist,and to keep in mind that there may be more exceptions which our current advances in science has not yet surfaced. These exceptions are in the form of: RNA virus -which carries its genome in the form of RNA instead of DNA. Selenocysteine and Pyrrolysine -the two uncommon amino acids that do not follow the genetic code system. We shall examine them briefly over the next few pages. NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences 增率馨 NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences Does this mean that the proteins are directly translated from the virus'genomic RNA? In other words,is it starting from the half-way point in the central dogma? NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences Because viral RNA → DNA"transcript"is reversed in the direction of information flow from the usual transcription in Central Dogma,we refer to this process as reverse transcription. The DNA transcript is referred to as complementary DNA(cDNA)to distinguish it from DNA that originated from other sources/processes. NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences The Central Dogma is universal across all living things. Since the genetic code itself is exactly the same among all organisms,if someone obtains a DNA sequence from new or unknown sources they can deduce the possible sequence of the protein encoded. However,the uncommon amino acids Selenocysteine and Pyrrolysine are not simply incorporated through the universal codon-anti-codon matching of amino-acyl-tRNA based on the genetic code. Both of them are incorporated in the place of certain stop codons,but require a specific set of conditions and biochemical reactions to complete the incorporation. NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences The discovery of unusual amino acids specified by such an extension of the genetic code tells us that we cannot always assume the prediction we had made based on the genetic code.It is important to understand any such exceptions. For example,we need to consider in which organism this sequence occurs and under what conditions. We may assume the sequence shown in the figure to have a stop codon at the position UAA. But in reality,the stop codon may be processed to incorporate Selenocysteine,in some rare cases. Remembering the exceptional organisms will caution us from over-assuming. NANYANG TECHNOLOGICAL UNIVERSITY What does reverse transcription refer to? There may be more than one correct option.Please select all options that you think are correct,and then submit. E None of the above Consider a micro-organism X,which is known to carry selenocysteine as one of the amino acid residues in its proteins. Which of the following statement(s)in relation to X is/are true? There may be more than one correct option.Please select all options that you think are correct,and then submit. It uses an information flow system completely different from the Central Dogma. It has a genetic code system that includes,in addition to the common 20 amino acids, a codon that represents selenocysteine. In order to decipher the amino acid sequence encoded by a gene in X,we need to refer to the unique genetic code of X. It will be impossible to decipher the amino acid sequence encoded by a gene in X with complete confidence,although we may be correct most of the time. X uses the same genetic code as depicted in the Central Dogma,but introduces a modified usage of stop codon under specific conditions to introduceselenocysteine into a protein. NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences In this section on The Central Dogma in the module Genetic Basis of Life, you need to take home the following messages: TRANSCRIPTION 1.The central dogma describes the passage of information from genes (in the form of DNA)to a transient copy of the gene (in the form of mRNA) that directs the sequential assembly of a chain of amino acids(to form a polypeptide/protein). TRANSLATION 2.Transcription is the process by which information from DNA is transformed into the form of mRNA.It is carried out by RNA polymerase. RESUT Polypeptide NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences In this section on The Central Dogma in the module Genetic Basis of Life, you need to take home the following messages: 3.Translation is the process by which information from mRNA is transformed into amino acid sequences of a polypeptide.It is carried out by ribosome and requires tRNA charged with amino acids. 4.The genetic code specifying 3-base codons for an amino acid can be applied universally to life on earth.However,some minor exception exists. 学章馨NAXYANG TECANOLOCICA VNIVERSITY Self-Assessment Genetic Basis of Life:The Central Dogma Total number of questions:8 BEGIN TEST School of Biological Sciences Self-Assessment Match the biological components to the appropriate analogy of functions. Drag the options into their correct functions,and then submit. Product,the Mobile Single construction of Copier Full Machine that copies of piece of which has been of library of generates instructions instruction described in the instructions instructions instructions the product RNA Polymerase Genome Ribosome mRNA Transcrip Gene Protein SUBMIT The flow of information from DNA to RNA is executed through a process called . There may be more than one correct option.Please select all options that you think are correct,and then submit. B C translation transcription D E post-transcriptional processing Which of the following describe(s)the unambiguous nature of the genetic code? There may be more than one correct option.Please select all options that you think are correct,and then submit. A The codon AGG may represent either glycine or arginine. B The codon UCC represents serine only and no other amino acid. C Histidine may be encoded by the codons CAU or CAC. D The codons AGC,AGU,UCU,UCC,UCA and UCG all represent the amino acidserine. School of Biological Sciences Self-Assessment In prokaryotes,the immediate product of transcription is while in eukaryotes,the corresponding product is . There may be more than one correct option.Please select all options that you think are correct,and then submit. A A B DNA;mRNA mRNA;pre-mRNA C tRNA;mRNA D pre-mRNA;tRNA E pre-mRNA;mRNA School of Biological Sciences Self-Assessment The component(s) participating in the process of transcription is/ are A DNA B mRNA C D tRNA rRNA E RNA Polymerase SUBMIT What needs togo through post-translational modification to become functional? There may be more than one correct option . Please select all options that you think are correct , and then submit. A Protein B Pre-mRNA C mRNA Pro-protein D E rRNA NANYANG Self-Assessment Which of the following process(es) occur(s) in eukaryotes but A Translation B DNA replication C Transcription Splicing D E Poly-A tail synthesis of mRNA NANYANG TECHNOLOGICAL UNIVERSITY School of Biological Sciences The central dogma describes a unifying mechanism for the information flow from DNA to protein in all living things. Which of the following is/are considered the"exception(s)" that deviate(s)from the central dogma? There may be more than one correct option.Please select all options that you think are correct,and then submit. A Ribozymes -RNA(instead of proteins)that catalyses reactions. B Incorporation of selenocysteine into a protein. C Certain proteins are made up of more than one polypeptide. School of Biological Sciences Self-Assessment Youve completed the Self-Assessment. s.cor%