The Human Body PJ1311 Central Dogma of Life (Transcription and Translation) PDF

The Human Body PJ1311 Central Dogma Of Life (Transcription and Translation ) Dr Lamia Kandil Lecturer of Pharmacy Practice ,PhD,FHEA MB138 [email protected] Kandil Lectures We will be covering 3 lectures on Genomics 1. Introduction to...

The Human Body PJ1311 Central Dogma Of Life (Transcription and Translation ) Dr Lamia Kandil Lecturer of Pharmacy Practice ,PhD,FHEA MB138 [email protected] Kandil Lectures We will be covering 3 lectures on Genomics 1. Introduction to Genomics 2. The central dogma of life (Transcription ,Translation) 3. Cell cycle and control mechanism  Learning outcome By the end of the lecture on gene expression, students will be able to: 1.Understand the Central Dogma of Molecular Biology: 2.Differentiate Between Key Processes: Transcription and Transaltion 3.Identify the Role of mRNA, tRNA, and rRNA: 4. Post transcription and Post Translational Modifications: 5.Gene regulation in Prokaryotes and Eukaryotes and its importance 6.Four different activities applying the knowledge after each LO The “Central Dogma” Flow of genetic information in a cell ◆ How do we move information from DNA to proteins? ription slation ansc tr tran DNA RNA protein trait DNA gets all the glory, replication but proteins do all the work!  Gene Expression Gene expression is a series of steps by which information encoded in genes creates functional products, such as RNA or proteins. It is a fundamental process that plays a crucial role in all living organisms’ development, functioning, and regulation. Watch this https://www.youtube.com/watch?v=gG7uCskUOrA Transcription from DNA language to RNA language  Transcription in Eukaryotes Transcription RNA Processing Psssst… DNA can’t leave nucleus! Translation Protein The process of building mRNA Initiation ◆ Assembly of initiation complex Elongation Termination  Transcription in Eukaryotes Initiation complex ◆ transcription factors bind to promoter region upstream of gene suite of proteins which bind to DNA ◆ turn on or off transcription TATA box binding site ◆ recognition site for transcription factors ◆ transcription factors trigger the binding of RNA polymerase to DNA  Elongation  Adding N-bases bases: During elongation, RNA polymerase 2 "walks" along one strand of DNA, known as the template strand, in the 3' to 5' direction. The sequence of the RNA polymer is complementary to that of the template DNA and is synthesized in a 5’→ 3′ orientation. -For each nucleotide in the template, RNA polymerase adds a matching (complementary) RNA nucleotide to the 3' end of the RNA strand.  Termination RNA polymerase will keep transcribing until it gets signals to stop. The process of ending transcription is called termination, and it happens once the polymerase transcribes a sequence of DNA known as a terminator. Polyadenylation: For most protein-coding genes, transcription termination in eukaryotes is associated with polyadenylation. A sequence called the polyadenylation signal, typically AAUAAA, is recognized by proteins that lead to the addition of a poly-A tail (a sequence of adenine nucleotides) to the 3' end of the pre-mRNA. This modification signals the termination of transcription.  Post-transcriptional processing Primary transcript (pre-mRNA) ◆ eukaryotic mRNA needs work after transcription mRNA processing (making mature mRNA) ◆ mRNA splicing = edit out introns ◆ protect mRNA from enzymes in tail ly-A cytoplasm 3' p o A add 5 cap AA A A ’s ' cap mRNA 50-250 A add polyA tail 5 P 5' P GP intron = noncoding (inbetween) sequence ~10,000 bases eukaryotic DNA exon = coding (expressed) sequence pre-mRNA primary mRNA transcript ~1,000 bases mature mRNA spliced mRNA transcript  Post-transcriptional modifications In this process, the primary RNA obtained after transcription is modified to produce a mature messenger RNA or mRNA https://www.bing.com/videos/riverview/relatedvideo?&q=post+tra nslational+regulation&&mid=D3D1EE947EFF052C06D5D3D1EE9 47EFF052C06D5&&FORM=VRDGAR https://www.bing.com/videos/riverview/relatedvideo?q=post%20tr anslational%20regulation&mid=EF134E40D32F4C4C36A6EF134E 40D32F4C4C36A6&ajaxhist=0 The processes involved are: N N H3C O O H H2N H H 2 N—H H—N 3 1 N N N N Splicing H—N O Capping H2 N Tailing H N N H NH3 O H H NH3 H 3 N 5 6 H—N Protein folding N H N N RNA O H2 N N Translation N O and transport modifications The processes involved are (cont…: N H2N H which is the cleavage of introns (non- coding sequences) and ligation of exons N 1 (coding sequences) with the help of N Splicing H N several components that recognize specific sequences in the RNA. H3C O H 2 N—H H—N which involves addition of a cap molecule to the 5’ end O Capping The processes involved are: N O H H—N 3 N which is the addition of poly A tail to the 3’ end. Tailing H2 N N H NH3 Most of the mature mRNAs produced after modifications are transported from the H 3 N nucleus to the cytoplasm where the next N O step in gene expression takes place. RNA This is achieved by moving the mRNAs transport through tiny pores in the nucleus to reach the cytosol.which Splicing must be accurate No room for mistakes! ◆ splicing must be exactly accurate ◆ a single base added or lost throws off the reading frame AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG| CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP| Activity 1 Activity: Comparing Transcription in Prokaryotes and Eukaryotes (5 minutes) Objective: Students will identify the differences between transcription in prokaryotes and eukaryotes Prokaryote vs. Eukaryote genes Prokaryotes Eukaryotes ◆ DNA in cytoplasm ◆ DNA in nucleus ◆ circular ◆ linear chromosome chromosomes ◆ naked DNA ◆ DNA wound on histone proteins ◆ no introns ◆ introns vs. exons come out! introns intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence  Translation from nucleic acid language to amino acid language Translation Codons ◆ blocks of 3 nucleotides decoded into the sequence of amino acids From gene to protein https://www.youtube.com/watch?v=TfYf_rPW UdY aa aa aa aa transcription translation DNA mRNA pro tei aa aa n aa mRNA leaves aa nucleus through nuclear pores ribosome proteins synthesized by ribosomes using instructions on mRNA nucleus cytoplasm  How does mRNA code for proteins? DNA TACGCACATTTACGTACGCGG 4 ATCG mRNA AUGCGUGUAAAUGCAUGCGCC 4 AUCG ? protein Met Arg Val Asn Ala Cys 20 Ala How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? mRNA codes for proteins in triplets DNA TACGCACATTTACGTACGCGG codon mRN AUGCGUGUAAAUGCAUGCGCC A ? Protei Arg Val Asn Ala Cys A n  The code Code ◆ is redundant ◆ several codons for each amino acid 3rd base “wobble” ◆ Why is the wobble good? S t a rStop codons t ◆ UGA, UAA, UAG c  How are the codons matched to amino acids? 3 5 DNA TACGCACATTTACGTACGCGG 5 3 mRNA AUGCGUGUAAAUGCAUGCGCC codon 3 5 tRNA UAC amino GCA acid Met CAU anti-codon Arg Val From gene to protein aa aa aa aa transcription translation DNA mRNA pro tei aa aa n aa aa ribosome aa nucleus cytoplasm Transfer RNA structure “Clover leaf” structure ◆ anticodon on “clover leaf” end ◆ amino acid attached on 3 end Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon ◆ organelle or enzyme? Structure ◆ ribosomal RNA (rRNA) & proteins ◆ 2 subunits E P A large small  Ribosomes A site (aminoacyl-tRNA site) ◆ holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site) ◆ holds tRNA carrying growing polypeptide chain E site (exit site) ◆ empty tRNA leaves ribosome from exit site  Building a polypeptide Initiation ◆ brings together mRNA, ribosome subunits, initiator tRNA Elongation ◆ adding amino acids based on codon sequence Termination ◆ end codon 3 2 1 Leu release Val Ser factor Met Met Met Met Leu Leu Leu tRNA Ala Trp C G A 5' U AC 5' U A C GA C 5' U A C GA C A 5' U AC G A C A U A U G CU G AU 3' 3' A CC mRNA A U G C U G A A U 3' A U G C U GA A U 3' AU G C U G A U GG U A E 3' A P  https://www.youtube.com/watch?v=8Hsz_Vmcy-Y  Activity: 2 Transcription vs. Translation (5 minutes) Objective: By the end of this activity, students will be able to identify the key differences between transcription and translation in protein synthesis. Posttranslational modifications (PTMs) Posttranslational modifications (PTMs) refer to amino acid side chain modification in some proteins after their biosynthesis. There are more than 400 different types of PTMs affecting many aspects of protein functions. These modifications affect a wide range of protein behaviors and characteristics, including enzyme function and assembly, protein lifespan, protein–protein interactions , cell–cell and cell–matrix interactions, molecular trafficking, receptor activation, protein solubility , protein folding and protein localization Therefore, these modifications are involved in various biological processes such as signal transduction, gene expression regulation, gene activation, DNA repair and cell cycle control PTMs occur in various cellular organelles including the nucleus, cytoplasm, endoplasmic reticulum and Golgi apparatus Reference https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8040245/ Activity 3 Activity: Exploring Post-Translational Modifications (5 minutes) Objective: Students will identify and understand the major types of post-translational modifications (PTMs) and their roles in protein function. https://www.bing.com/videos/riverview/relatedvideo?q= post+translational+modification&mid=1052B39D81296 2C5E7D31052B39D812962C5E7D3&FORM=VIRE  Regulation of Gene Expression Gene regulation is the process used to control the timing, location and amount in which genes are expressed. The process can be complicated and is carried out by a variety of mechanisms, including through regulatory proteins and chemical modification of DNA. Gene regulation is key to the ability of an organism to respond to environmental changes. https://rwu.pressbooks.pub/bio103/chapter/regulation-of-gene-expression/ The genetic content of each somatic cell in an organism is the same, but not all genes are expressed in every cell. The control of which genes are expressed dictates whether a cell is (a) an eye cell or (b) a liver cell. It is the differential gene expression patterns that arise in different cells that give rise  Gene Regulation in Prokaryotes Proteins that are needed for a specific function, or that are involved in the same biochemical pathway, are often encoded together in blocks called operons In prokaryotic cells, there are three types of regulatory molecules that can affect the expression of operons. Activators are proteins that increase the transcription of a gene. Repressors are proteins that suppress transcription of a gene. Finally, inducers are molecules that bind to repressors and inactivate them. Eg tryptophan Operon  Eukaryotic Gene Regulation In eukaryotes, control of gene expression is more complex and can happen at many different levels. Eukaryotic genes are not organized into operons, so each gene must be regulated independently. In addition, eukaryotic cells have many more genes than prokaryotic cells. Regulation of gene expression can happen at any of the stages as DNA is transcribed into mRNA and mRNA is translated into protein. Regulation is divided into five levels: Epigenetic, transcriptional, post-transcriptional, translational, and post-translational  Importance of regulation of Gene Expression 1-By altering gene 2-Transcription expression, control can organisms can result in tissue adapt to specific gene environmental expression. challenges. 3-Gene regulation 4-Dysregulation of is influenced by gene regulation hormones, heavy can lead to metals and disease. chemicals.  RNA polymerase DNA Activit y4 Can you tell amino the story? exon intron acids tRNA pre-mRNA 5' cap mature mRNA aminoacyl tRNA polyA tail synthetase large ribosomal subunit 3' polypeptide 5' tRNA small ribosomal E P A subunit ribosome Summary 1. Understand the Central Dogma of Molecular Biology: 1. Explain the flow of genetic information from DNA to RNA (transcription) and from RNA to proteins (translation). 2. Recognize how this flow is essential for cellular function and organismal traits. 2. Differentiate Between Key Processes: 1. Describe the roles of transcription and translation in gene expression. 2. Distinguish between the processes in prokaryotes and eukaryotes, including where transcription and translation occur, and how mRNA processing differs. 3. Identify the Role of mRNA, tRNA, and rRNA: 1. Understand the roles of mRNA as a messenger carrying genetic information, tRNA in decoding mRNA, and rRNA as part of the ribosome responsible for protein synthesis. 4. Post-Translational Modifications: 5. Gene Regulation in Prokaryotes and Eukaryotes Explain how genes are turned on and off by transcription factors, enhancers, repressors, and epigenetic modifications. Thank you 2007-2008