ANIM 2503 Animal Breeding and Molecular Genetics Review for Quiz 1 - PDF

ANIM 2503 ANIMAL BREEDING AND MOLECULAR GENETICS REVIEW LECTURE FOR QUIZ 1 PREPARATION DR LEE MCMICHAEL UNIVERSITY OF QUEENSLAND, GATTON CAMPUS SCHOOL OF VETERINARY SCIENCE [email protected] On Blackboard in your Assessment Folder • Browser recommendation • Technical issues during Inspera as...

ANIM 2503 ANIMAL BREEDING AND MOLECULAR GENETICS REVIEW LECTURE FOR QUIZ 1 PREPARATION DR LEE MCMICHAEL UNIVERSITY OF QUEENSLAND, GATTON CAMPUS SCHOOL OF VETERINARY SCIENCE [email protected] On Blackboard in your Assessment Folder • Browser recommendation • Technical issues during Inspera assessments: DO NOT close your browser. Collect evidence of the issue. Contact AskUS on +61 7 3346 4312 (or at https://web.library.uq.edu.au/contact-us) immediately • Assessmment quiz link will become visible in assessment folder at 7:30 am AEST on quiz day, quiz opens 8 am and closes 9 am • Student with approved assessment adjustments have been contacted and can go to Assessment folder to find the link to login for your adjusted quiz time now. Contact me if you should have adjustment and this is not visible to you. [Presentation Title] | [Date] CRICOS code 00025B 2 Mendelian Genetics CRICOS code 00025B 3 Recap of terminology Gene = length of DNA coding for functional protein Locus = position of gene on chromosome Allele = version of a gene that differ in their base sequences Phenotype = observable characteristics of an individual based on the expression of the gene and its specific protein product CRICOS code 00025B 4 Mendel’s Universal Laws of Heredity Explain a phenotype: • A gene is the fundamental unit of inheritance • There are alternative forms of genes called alleles • For each characteristic, an organism inherits 2 alleles, one from each parent • Alleles can be dominant or recessive - gametes carry only one allele for each inherited characteristic where gametes have equal probability of having either allele CRICOS code 00025B 5 Understanding dominant and recessive alleles The dominant allele is usually denoted by a capital letter In the following example, the shorthaired allele (L) is dominant to the longhaired recessive allele (l) In simple inheritance, dominant alleles mask effects of recessive alleles More complex systems exist (co-dominance, for example) CRICOS code 00025B 6 Use “Punnett Squares” to predict the genotypes and phenotypes of offspring from matings .. remember one allele donated per gamete x B B b Bb Bb b Bb Bb CRICOS code 00025B F1 generation 7 CRICOS code 00025B 8 Modes of Inheritance Autosomal dominant: Allele for the gene variant is dominant and located on a non-sex chromosome, thus the offspring only needs one copy to express the trait Autosomal recessive: Allele for the gene variant is recessive and located on a non-sex chromosome, thus the offspring needs two copies of that allele for the trait X-linked dominant: Allele for the gene variant is dominant and located on the X chromosome, thus the offspring needs only one copy to express the trait X-linked recessive: Allele for the gene variant is recessive and located on the X chromosome, thus female offspring need two copies to express the trait and males only one copy CRICOS code 00025B 9 Question Autosomal dominant Autosomal X-linked recessive dominant X-linked recessive Are males and females equally affected? If no, 1. Do all affected males have affected daughters? 2. Do all affected females have affected sons? YES YES NO NO YES NO YES NO NO YES NO YES Do all affected individuals have an affected parent? Remember to work out on the pedigree if your mode of inheritance is correct … this is one use of your working notepaper Can the trait skip a generation? CRICOS code 00025B 10 CRICOS code 00025B 11 How does the epistatic effect of the dilute gene occur? • The diluted colour phenotype is caused by a single base deletion in the melanophilin (MLPH) gene which encodes a carrier protein. • Mutations in melanophilin cause the "dilute" coat color phenotype in dogs and cats (and humans), altering the coat colour from black to grey, red to cream and chocolate to lilac, and can be found in both purebred and random-bred cats. - Dilute colour mutation is an autosomal recessive condition - dd will result in the recessive trait and will dilute the colour expressed by the colour gene - D- will give normal colour (actual colour according to colour gene) CRICOS code 00025B 12 Dosage compensation and tortoiseshell cats CRICOS code 00025B 13 Mutations and Abnormalities CRICOS code 00025B 14 The Genetic Translation Code Set of three nucleotides code for a single amino acid, called a codon Start and stop codons signal beginning and the end of the amino acid sequence DNA genetic code is made up of the nucleotides adenine, thymine, cytosine and guanine (ATCG) In mRNA, the thiamine (T) is replaced with uracil (U) CRICOS code 00025B 15 Mutations are changes to DNA or RNA • Single base substitution. In coding regions these could be silent (synonymous), missense (non-synonymous), nonsense (stop). • Indel: an insertion or deletion of one or a few nucleotides. Can lead to “frameshifts” within coding regions. Can lead to new function or lethal loss of function ie: the Start codon signals where to start reading, if a nucleotide is added or deleted then the sets of three nucleotides (the codons) are read differently. • A splice site mutation is a mutation that alters nucleotides at splice control sequences, changing the patterns of RNA splicing and changing the resulting length and structure of the mRNA. Leads to subsequent changes in the length and structure of the protein CRICOS code 00025B 16 Muscular Dystrophy in Golden Retrievers A splice site mutation in intron 6 causes: • a complete deletion of exon 7 from mRNA and • a frameshift in following exons • a mutated protein … absence of dystrophin from muscle CRICOS code 00025B 17 Defective chromosomal recombination/segregation Abnormalities can arise when chromosomes rearrange or fail to segregate properly. These alterations can be of a structural or numerical nature: Numerical anomalies result in aneuploidy, or addition or loss of individual chromosomes from the normal set of 46 in the case of humans. Structural abnormalities are rearrangements of genetic material within or between chromosomes. These can be balanced or unbalanced. CRICOS code 00025B http://2.bp.blogspot.com/_9LmEKw8Ts54/SQZD5gcLs6I/AAAAAAAAAMU/0TMIUC7zBGw/s400/nondisjunction.jpg CRICOS code 00025B 19 Sex chromosome aneuploidy Female offspring: XX, X0, XXX https://www2.palomar.edu/users/warmstrong/biex4hnt.htm CRICOS code 00025B 20 Loss or gain of a single chromosome • Normal = euploidy = having the normal number of chromosomes • Abnormal = aneuploidy = having fewer or more than the normal diploid • Most common forms of aneuploidy are monosomy (loss of one of a pair of chromosomes) and trisomy (three chromosomes instead of a pair) • Effects of Aneuploidy of autosomes: Serious developmental problems, typically lethal = embryo/foetal loss i.e not passed on. Tisomies of small chromosomes can lead to live animals • Effects of polyploidy in mammals: In mammals, polyploidy is lethal, usually at embryonic/foetal stage, causes severe developmental abnormalities CRICOS code 00025B 21 Abnormal chromosome structure • Changes to the structure of one or more chromosomes is caused by mistakes in meiotic recombination and DNA break repairs Balanced changes: do not change overall DNA content of a cell although the gene neighbourhood is affected and might alter gene expression Unbalanced changes: overall loss or gain of total amount of DNA CRICOS code 00025B 22 Reduced fertility due to translocations Complex arrangements of chromosomes during meiosis where homologous regions of chromosomes align in order to be distributed correctly to gametes * Translocations can be inherited through balanced gametes When translocations occur at meiosis, this can lead to creation of balanced but unbalanced zygotes * Translocations can lead to reduced fertility CRICOS code 00025B 23 Reciprocal Translocation – cause of low fertility • Individual has reciprocal translocation during meiosis • Balanced individual = has full complement of all chromosomal pieces • All gametes are functional, but some gametes are unbalanced • Upon fertilization with normal gamete, some zygotes are unbalanced and die • Seen as a reduction in fecundity • Changes are however inherited through two gametes with balanced translocation CRICOS code 00025B 24 Robertsonian translocation … same concept CRICOS code 00025B 25 Abnormal chromosome structure Genome rearrangement (inversion and translocation). Occurs during meiosis. Can lead to new functions or to lethal loss of function. CRICOS code 00025B 26 Mutation and Repair CRICOS code 00025B 27 Mutation heritability depends on mutation location Somatic mutations: • Occur in non-reproductive cells passed onto daughter cells • Creates a clone of mutant cells - More widespread if occurring in embryo • Many have no phenotypic effect Germ-line mutations: • Occur in cells that produce gametes passed to future generations • All cells in the offspring’s body carry the mutation CRICOS code 00025B 28 Genetic Tests CRICOS code 00025B 29 Sample Collection .. avoid contamination and store/ship appropriately Extract DNA (stable) Amplification of segment of genetic material PCR Extract RNA (unstable) Real Time PCR Reverse transcriptase PCR Agarose gel electrophoresis RFLP, DNA sequencing SNP and microsatellite genotyping CRICOS code 00025B 30 1. Denaturation: Heating the DNA to ~95 degrees C separates the two strands 2. Annealing: The temperature is dropped to 50-60 degrees C for ~30 seconds and two short oligos (=primers) bind to the target region of the DNA. The oligos are ~20-25 bp long and match only one place in the genome. These define the ‘target’ region 3. Extension: The temperature is increased to ~72 degrees C for 1-2 minutes and the enzyme Taq DNA polymerase adds dNTPs (A, C, T and G nucleotides) to the oligo to make a new strand that is complementary to the strand to which it is bound Steps 1-3 are repeated over ~30 times: Each time the primers bind to the original DNA strand and also to each of the newly created strands CRICOS code 00025B 31 Agarose Gel Electrophoresis A fluorescent dye that binds DNA eg ethidium bromide or SYBR Safe is added to the gel. It binds to the double stranded DNA and fluoresces when placed under UV light. CRICOS code 00025B 32 Real time quantitative PCR (qPCR) As the number of PCR cycles increases, there is an increase in fluorescence. The reaction is variable at the start and end, there is an exponential phase in the centre and plateau at the end. CT value is the threshold cycle or the cycle number at which a curve crosses a threshold level and enters the exponential phase. Use for presence/absence (Syber or probes) or quantitative (relative using control gene to normalise or absolute using a standard curve). CRICOS code 00025B 33 DNA Sequencing Useful for single or multiple nucleotide substitutions and is “Gold standard” – details nucleotide change and any additional changes. • Sanger sequencing: PCR-like reaction with dNTPs and ddNTPs (non-extendable). Different fluorescent colour on each ddNTP. • Next generation sequencing: Massively parallel sequencing, produces millions of fragments of sequenced DNA that must be aligned to a reference genome for interpretation. • Nanopore sequencing: When a DNA molecule passes through the nanopore, a current is produced that is decoded using base calling algorithms to determine the DNA sequence. Sanger sequencing not useful for Indels (insertion or deletion) because sequence both alleles at same time so heterozygotes have two off-set sequences (unreadable) … must use Next generation or Nanopore sequencing technologies to investigate. CRICOS code 00025B 34 Restriction Enzymes and RFLP analysis • Restriction endonucleases are enzymes that cut DNA at the “recognition sequence” • For genetic testing, use a restriction enzyme that cuts either the mutated DNA or the ‘wild type’ DNA • PCR products are incubated with the restriction endonuclease, run on electrophoresis to detect length variants (cut versus not cut PCR products) • Useful for single base changes or indels (insertion or deletion) • Remember, number of fragments = number of cuts plus one CRICOS code 00025B 35 Direct versus Indirect Markers Genetic marker eg microsatellite Mutation in gene B b* • Direct tests detect mutations in the gene of interest • Indirect tests rely on linkage between genes on the same chromosome • The genetic marker tested is not the cause of the disease but is linked to causative mutation • The marker is used to ‘predict’ which allele is present at the gene • Expect linkage between two polymorphisms to reduce with distance and correlates with recombination rate CRICOS code 00025B Genetic Markers for Indirect tests • SNPs Single Nucleotide Polymorphism - - A variant at one nucleotide, present in a population at >1% Allele specific primers Two forward primers that each match only one allele PCR separately to see which allele(s) present. Primer anneals one nucleotide prior to mutation and extended by one base Detection by capillary electorphoresis with dye-labelled ddNTP, SNP chips • Microsatellites - Repetitive region with short repeat units, also called STR – short tandem repeats • Example: a (CT)25 microsatellite locus ACTTGCAGGTACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCAT GGGTCTTATGACTGCAATG • Interspersed through the genome in introns and intergenic regions, rarely in coding regions • 10,000s in the genome • Repeats are short, usually 2-6 bp long. CRICOS code 00025B Caution with Genetic Tests • Genetic heterogeneity: Different mutations can lead to the same or similar phenotype • Phenocopies: Phenotype due to a cause that is not genetic, but has the same appearance as the genetic disease • Is this a multifactorial or polygenic disease/trait? • Most diseases are the consequence of the combined effect of mutations in multiple genes +/- environmental effects CRICOS code 00025B Multifactorial Traits CRICOS code 00025B 39 Effect of many contributing genes The more genes that combine to produce a trait, the more possible phenotypes there are With many loci, the number of possible phenotype is best described as a distribution CRICOS code 00025B 40 Characteristics of Multi-factorial Diseases • Low heritability .. most affected progeny have unaffected parents • Relationship by blood slightly increases the risk for an affected offspring • Risk of affected relatives falls off very quickly with the degree of relationship • Risk increases with the number of affected offspring in a family .. indicates parents more likely to be closer to the threshold • A more severely affected parent is more likely to produce an affected offspring CRICOS code 00025B Threshold Model of Multifactorial Disease • With an increasing number of disease-susceptibility alleles (cause or associated with disease) or disease modifier alleles (expression influences phenotype of independent mutation) that increase risk, an individual’s liability increases. • Individuals with a liability over the threshold will show the disease, while those below the threshold will not. • Each individual with the disease can have a different combination of alleles CRICOS code 00025B 42 Gene types in multifactorial disease Disease susceptibility genes: Have gene sequence variants associated with an increased risk of disease but may not cause the disease on their own Modifier genes: Are genes whose expression or function can influence the phenotype resulting from mutation of another independent gene These can show two types of changes: • Mutations: Heritable detrimental sequence changes in a gene that are commonly associated with disease • Polymorphisms: Sequence variation (point mutation) among individuals that are common in a population (>1%) and that are usually not associated with disease CRICOS code 00025B 43 Testing for Multifactorial Diseases/Traits If all the contributing genes, their interactions and environmental effects are known … then genetic testing could be undertaken as we do for Mendelian traits. But, we usually don’t know all, or even all the major, contributing genes, causative or associated gene variants Therefore we measure risk of associated variants … Can use Odds Ratios • OR>1 indicates that the condition or event is more likely in the first group than the general population • OR<1 indicates that the condition or event is less likely in the first group than the general population • The closer the OR is to 1, the smaller the difference in effect between the two groups CRICOS code 00025B Quantitative Trait Loci (QTLs) • These principles from multi-factorial disease are the same when we think about production traits .. most traits show a continuum of quantitative variation … termed quantitative traits • Use the term QTL when identified chromosome region but not actual ‘causative’ mutation • A QTL can be represented by the actual mutation if it is known (direct test) or SNP/microsatellite marker (indirect test) • These genetic tests each measure just a single QTL. Each QTL marker tests only for a proportion of the genetic contribution to that trait. It represents only one mutation (gene) out of many that contribute to the trait. CRICOS code 00025B Cancer Genetics CRICOS code 00025B 46 Cancer is a multi-gene disorder Cancer arises from the accumulation of mutations in multiple genes. A single mutation in a single gene is not sufficient to cause cancer. Cancer is a multi-step process .. accumulation of mutations: • Initiation: a genetic event would give a somatic cell limitless replicative potential, or a growth/survival advantage in comparison to normal cells • Promotion: a further genetic event would add to that cell’s ability to outcompete other cells, leading to expansion and recognizing a tumor mass • Progression: another genetic event would allow for invasion, tissue destruction and metastasis = malignancy and clinical disease A genetic event is a series of mutations. It takes 5 or 6 mutations for a tumor to arise CRICOS code 00025B Cancer arises from a combination of mutations in oncogenes AND tumour suppressor genes ACCUMULATED over time. However, some mutations are more commonly associated with many types of cancer. Common examples of mutations found in the tumor suppressor genes occur in the genes: BRCA1, BRCA2, and p53 or TP53 Common examples of mutations found in oncongenes: HER2 and RAS family of genes CRICOS code 00025B 48 Steps of colon cancer progression can be correlated with specific mutations Tumourigenic progression genetically altered cell spread Normal 5q loss APC Hyperplasia: enlargement of tissue or organ Dysplasia: abnormal cell types 12p mutation DNA hypomethylation KRAS Invasive 18q loss ?DCC 17p loss TP53 Metastatic Other alterations CRICOS code 00025B A genetic event occurs at each step which enables the cell to adopt a growth promoting advantage Different tumours will generally contain a different set of genetic lesions One example of mutations Two types of Tumour Suppressor Genes Caretaker genes function to • Maintain genomic integrity • Inactivation of caretaker genes leads to an accumulation of DNA mutations and genomic instability (for example DNA repair genes or genes involved in chromosome segregation) • Small amounts of damage the caretaker genes will repair • If too much damage, cells will move to cell death moderated by Gate Keeper genes Gate keeper genes function to • Act to prevent growth of potential cancer cells and prevent accumulation of mutations • Induce cell death or stop cell replication of potentially tumorigenic cells (cells that have accumulated mutations) for example cell cycle checkpoint genes CRICOS code 00025B Loss of a gatekeeper or caretaker gene does not cause the cancer, but rather it allows the accumulation of the mutations in other genes which ultimately causes the disease It allows • Mutations that have arisen to not be repaired OR • It allows cells to continue to replicate even though they have mutations CRICOS code 00025B 51 Effects of mutations Activate oncogenes by: • Activating nucleotide mutations • Gene amplification resulting in greater expression of genes • Chromosomal translocations Inactivation of tumor suppressor genes by: • Inactivating nucleotide mutations (point mutations, indels) • Small chromosomal deletions, loss of entire chromosomes resulting in loss of gene • Unbalanced translocations resulting in loss of tumor suppressor gene • Epigenetic mechanism such as promotor methylation which switch gene off CRICOS code 00025B 52 Mechanisms that can result in oncogene activation … switching on or increasing expression (More efficient protein) (chromosomal aberration leading to duplication) (due to chromosomal translocations) CRICOS code 00025B Knudson’s two hit hypothesis: a mutation of both alleles of a TSG (Tumour Suppressor Gene) is needed to trigger tumour formation ALL cells inherited the first mutation. Only need one mutation for tumor development, thus higher rate of cancer. Familial cancer Germ-line mutation Somatic mutation Rarer event occurring in only some cells Sporadic cancer Somatic mutation 1 Somatic mutation 2 CRICOS code 00025B What distinguishes a cancer cell from a normal cell? Defective response to DNA damage Defective telomeres Uncontrolled cell proliferation Immortalization Cancer Defective apoptosis Induction of angiogenesis All share features of uncontrolled cell growth and proliferation Increased cell motility Reduced cell adhesion Mitochondrial Disease CRICOS code 00025B 56 Mitochondiral DNA • Replicates separately from nuclear DNA • Codes for metabolic proteins (ATP synthesis, fatty acid metabolism, citric acid cycle) Mitochondria primary role to produce energy … thus mitochondria are termed the POWERHOUSE of the cell • Many essential genes for mitochondrial replication and function have been transferred to the nucleus • Nuclear genes are “protected” from mutagenic environment of mitochondria CRICOS code 00025B Protein synthesis Initiation of mtDNA replication Protein synthesis 12S & 16S rRNAs cytochrome b Codes for proteins involved in energy production D-loop/ Control Region tRNAs Energy Human mtDNA Map Overlap of ATPase 6 and 8 CRICOS code 00025B (Taanman, 1999, Biochimica et Biophysica Acta, 1410:103) Maternal Inheritance of mitochondrial DNA In most animals, there is uniparental (maternal) inheritance of mitochondria and hence mtDNA Both sons and daughters inherit the mtDNA of their mother Mitochondrial inheritance is thus “non-Mendelian” (ie not derived from both parents) CRICOS code 00025B Nuclear-encoded mitochondrial genes • Many essential genes for mitochondrial replication and function have been transferred to the nucleus • Nuclear genes are “protected” from mutagenic environment of mitochondria • Nuclear-encoded mitochondrial proteins synthesized in cytoplasm and imported into mitochondria facilitated by a signal peptide (SP) High mutation rate in mtDNA due to: • Reactive oxygen species (ROS or free radicals) produced during oxidative phosphorylation that cause mutations which may lead to mutant proteins, which in turn may lead to more damaging radicals • Low efficiency proof reading capacity of the gamma DNA polymerase CRICOS code 00025B Mitochondrial disease • Disease pathogenesis relates to oxidative phosphorylation … the process that produces energy • Mitochondrial diseases show delayed onset and progressive decline .. cellular energy capacity declines and eventually the cell or tissue fails to function normally as mutations accumulate:  Inherited mutations: Mitochondrial genes or Nuclear-encoded mitochondrial genes  Acquired mutations: Age-related changes to mitochondria or effects of drugs, infections or environmental impacts • Mitochondrial disease can lead to developmental delay, sight and hearing loss, stoke-like symptoms, cardiovascular disease, muscle, kidney and liver failure; cancer due to somatic mtDNA mutations (oxidative damage) have been identified in various tumours; associated with ageing; male infertility. CRICOS code 00025B Randomness of mitochondrial disease • Random and quantitative nature of mitochondria means that the expression of mutations and disease progression are highly variable • 103–104 copies of the mtDNA per cell • A mutation can be present in all copies (homoplasy) or in a fraction of the copies (heteroplasmy) • Severity of mitochondrial disease depends on ratio of normal:affected mitochondria Homoplasmy The proportion of ‘wild type’ to mutated mtDNA can change in a cell as mtDNA replicates independently of the cell cycle CRICOS code 00025B Heteroplasmy Preparation for your Assessment Quiz Review any concepts in this lecture that you are unsure of Ask questions Perform your practice Inspera Quizzes: • Practice Quiz Week 1 • Practice Quiz Weeks 2 and 3 • Practice Quiz Week 4 Multiple choice questions in old end of semester exam papers are useful [Presentation Title] | [Date] CRICOS code 00025B 63 Example EOS exam question for Module 1 … not for your Quiz! Just FYI This 6 month old Labrador retriever comes into your clinic. The owners are concerned about the dogs difficulty swallowing and breathing. Upon a physical examination you note that the dog is in poor body condition and has generalized muscle atrophy. One thought you have is that the dog may be affected by muscular dystrophy. The owner wants to continue to breed golden retrievers. QUESTIONS: Please outline in two paragraphs or 10-15 dot points the following: • How you would explain the potential genetic syndrome and its causes to the client? • How would you confirm the diagnosis by genetic testing? • What advice you would offer the client with respect to breeding, based on the family tree that the client has provided? [Presentation Title] | [Date] CRICOS code 00025B 64 Suspected Genetic Disease: • Muscular dystrophy with signs of difficulty swallowing, breathing, muscle atrophy caused by an absence of dystrophin in skeletal muscle • X-linked recessive disorder caused by a splice site mutation in the dystrophin gene • The mutation at the splice site mutation results in the deletion of the coding region of exon 7 of the gene and subsequent frame shift. • These mutations result in an altered non-functional protein. • The absence of this protein leads to muscle necrosis, fibrosis and ultimately cardiac/respiratory failure. Genetic Diagnostic Tests: • A number of genetic tests could be performed inclusive of a reverse transcriptase PCR, a probe based qPCR with splice site specific probe, RFLP analysis or sequencing of the gene • If genomic analysis of the DNA were to be performed (probe based qPCR, RFLP analysis or gene sequencing), blood samples would suffice and can be stored refrigerated. • If a muscle biopsy was taken to examine other signs of muscle damage you could also examine the mRNA by RT-qPCR, but as RNA is really labile, the sample would need to be collected into a preservative agent of frozen rapidly after collection. Breeding advice to owner: • Based on the provided family tree, the male grandparent of the dog in question was affected. • The mother of the dog in question would be a carrier of the mutation on one of her X chromosomes. Female 3 would also be a carrier. • Female 8 may or may not be a carrier so I would recommend genetic testing before breeding with her. • Breeding from any of the unaffected males is ok as they only carry one unaffected X chromosome. [Presentation Title] | [Date] CRICOS code 00025B 65