DNA Hybridization and Applications Lecture Slides PDF

Molecular Biology Principles and Practice Text Section: 6.4 and 7.3 (DNA Microarrays only; Pages 248 - 250) Microarrays: the use of oligonucleotides and cDNA for the analysis of gene expression J. Carl Barrett and Ernest S. Kawasaki. Drug Discovery Today, Vol. 8, No. 3, 2003, pages: 134...

Molecular Biology Principles and Practice Text Section: 6.4 and 7.3 (DNA Microarrays only; Pages 248 - 250) Microarrays: the use of oligonucleotides and cDNA for the analysis of gene expression J. Carl Barrett and Ernest S. Kawasaki. Drug Discovery Today, Vol. 8, No. 3, 2003, pages: 134 – 141. 1  DNA can be “denatured” by heat or high pH. The temperature at which DNA denatures or “melts” is the melting point. Upon removal of the denaturing agent, DNA will re-nature to double stranded form. 2 Fig 6.28  Tm = Temperature at which half the DNA is denatured (SS) Factors affecting Tm - GC / AT content - Salt concentration - DNA concentration - DNA length Fig. 6-29: UV light absorption by DNA - Modifications It is important to calculate Tm - For Northern, Southern analysis Many programs are available for calculating Tm. - In PCR An example can be found at: - For microarray analysis http://www.basic.northwestern.edu/biotools/OligoCalc.html 3 There are various methods for calculating melting point Method 1: For probes 14 to 70 base pair long: Tm = 81.5 + 16.6(log ([Na+]) +.41*(%GC) – 600/length [Na+] is the molar sodium concentration, (%GC) is the GC ratio, and length is the length of the sequence. Reference: Sambrook and Russell, 2001 (Book) Molecular Cloning: A Laboratory Manual There are other methods, for example, that published by Rychlik, Spencer, Rhoads in Nucleic Acids Research, vol 18, no 21, page 6410. For assignments and tests in this course, method 1 will suffice. 4 Calculate the theoretical (calculated) melting point of the following DNA fragment when it is in an aqueous buffer solution containing 0.10 M NaCl. Show your work. CAGGTCGACTCTAGAGGCTCCAAAGGTACCGAGCTCATTCAGTCGTAAGGTGTGAAACAA Tm = 81.5 + 16.6(log (0.1)) +.41*(50) – (600/60) = 81.5 + 16.6 (log 0.1) + 0.41 * (50) – (600/60) = 81.5 - 16.6 + 20.5 – 10 = 75.4  DNA molecules can form hybrids. The degree and strength of hybridization depends on degree of homology. DNA Hybridization has various applications. For example: - DNA/RNA probes can be used to detect transformed bacteria, - Detection of a specific DNA sequence in Northern and Southern blotting - Detection of a specific DNA/RNA in microarray experiments - Detection of a specific DNA/RNA in Fig. 6-31 Cross-species in situ hybridization experiments. DNA hybridization 6  Application of DNA hybridization: Animation: http://www.youtube.com/watch?v=KfHZFyADnNg Southern / Northern blotting (Overview) i. DNA/RNA is resolved on a gel ii. DNA/RNA is transferred to a membrane iii. A probe is prepared and labelled so it can be detected iv. The probe is allowed to bind to and detect the gene of interest on the membrane v. The signal produced by the probe is detected via a suitable detection method 7 Fig. 6-32  Detection of PECAM-1 and GAPDH mRNA levels in various tissues by Northern blotting Fig. 6-32 8  Large-scale study of gene expression at the level of transcription using microarrays. Enlarged image of a 1.8 cm X 1.8 cm DNA microarray used to study the expression of yeast genes. (Fig from old text) Example: Microarray was used to compare the expression of all (~6,500) genes of the yeast (S. cerevisiae) growing in culture before spore formation, to those five hours after they began to form spores. What is the question asked here? ▪ Each glowing spot contains DNA from one of the roughly 6,500 genes of the yeast (S. cerevisiae) genome, with every gene represented in the array. ▪ The microarray was probed with fluorescently labeled nucleic acid cDNA obtained from the cells growing in culture before (green), and 5 hours after they began to form spores (red). ▪ The colors on the array can tell how the expression of each genes is affected by after spore formation begins 9 Microarrays allow large-scale study gene expression at the level of transcription. There are two types of microarrays: 1. cDNA-based microarrays: ▪ cDNAs are obtained for all genes of interest ▪ cDNAs are loaded onto a DNA chip ▪ The chip is hybridized with labeled cDNA probes corresponding to agiven tissue Overview of the microarray technology see an article at the following link: http://genet.univ-tours.fr/gen002200/bibliographie/Bouquins%20INRA/Reviews/Barrett%202003%20DDT.pdf 10 Microarrays allow large-scale study gene expression at the level of transcription. There are two types of microarrays: 2. Oligo-based microarrays 1. Oligos are made based on sequence information for all genes of interest a) Longer oligos – may be synthesized separately and loaded onto the chip b) Shorter oligos – may be synthesized on the chip (much easier and cost effective) Overview of the microarray technology see an article at the following link: http://genet.univ-tours.fr/gen002200/bibliographie/Bouquins%20INRA/Reviews/Barrett%202003%20DDT.pdf 11 Fig. 7-30: Photolithography to create a DNA microarray (see next slide for step details) 12 Photolithography to create a DNA microarray in oligo-based microarrays. Notes: Probe sequences are directly synthesized on a chip A computer is programmed with the desired primer/oligonucleotide sequences. Reactive groups of nucleotides are initially rendered inactive by photoactive blocking groups, which can be removed by a flash of light. 1. The appropriate parts of the chip are activated by light 2. A solution containing one protected nucleotide (e.g., A*) is washed over the chip. The nucleotide is added to specified spots on the chip 3. The surface is washed successively with solutions containing each remaining nucleotide (G*, C*, T*). 4. The 5′-blocking groups on each nucleotide limit the reactions to addition of one nucleotide at a time, and these groups can also be removed by light. 5. Once each spot has one nucleotide, a second nucleotide can be added to extend the nascent oligonucleotide at each spot. 6. This continues until the required sequences are built up on each spot on the surface 13 Steps involved in a microarray experiment. 1. Load probes corresponding to all genes of a given tissue/organism onto a chip 2. Extract mRNA obtained from cells under tow different conditions 3. Label cDNA made from one mRNA pool with nucleotides containing a Red fluorescent tag 4. Label cDNA made from the other mRNA pool with nucleotides containing a Green fluorescent tag 5. Mix the tow cDNA pools and allow hybridization 6. Scan the array for Red, Green or a shade of Red/Green mix signals 7. Analyze the data 14 Steps involved in a microarray experiment. Results: 1. Spots corresponding to genes expressed under one condition produce Red or Green signals 2. Spots corresponding to genes expressed in both tissues but not equally will produce different shades of Red and Green mix. WHY? 3. Spots corresponding to genes expressed EQUALLY under both conditions produce a signal resulting from equal mix of Red and Green (Yellow) 15  One spot on the gene chip (microarray) Black bars represent probe attached to the chip Six other spots on the gene chip (microarray) shown below - Black bars represent probe attached to the chip - Red and green bars represent cDNA labelled red or green - Colors that appear on the chip depend on how much of each cDNA binds a given spot. Black Green Red Yellow Toward Toward (no cDNA) green red 16  Fig. 7-31 A. Example 2: Using microarrays to monitor the expression of all expressed genes of a frog at two different stages of development: - single-cell stage (left) - later stage (right). 17 Example miR-4478 Accelerates Nucleus Pulposus Cells Apoptosis Induced by Oxidative Stress by Targeting MTH1 Zhang, JF; Liu, RD; (...); Jiang, JM Mar 1 2023 | SPINE 48 (5) , pp.E54-E69 Objectives. Low back pain is the leading cause of disability in the elderly population and is strongly associated with intervertebral disk degeneration (IVDD). However, the precise molecular mechanisms regulating IVDD remain elusive. This study aimed to investigate the role of differentially expressed miRNAs in the pathogenesis of IVDD. Materials and Methods. We analyzed miRNA microarray datasets to identify differentially expressed miRNAs in IVDD progression and conducted quantitative real-time polymerase chain reaction and fluorescence in situ hybridization analysis to further confirm the differential expression of miR- 4478 in nucleus pulposus (NP) tissues of patients diagnosed with IVDD. Using public databases of miRNA-mRNA interactions, we predicted the target genes of miR-4478, and subsequent flow cytometry and western blot analyses demonstrated the effect of MTH1 in H2O2-induced nucleus pulposus cells (NPCs) apoptosis. Finally, miR-4478 inhibitor was injected into NP tissues of the IVDD mouse model to explore the effect of miR-4478 in vivo. Results. miR-4478 was upregulated in NP tissues from IVDD patients. Silencing of miR- 4478 inhibits H2O2-induced NPCs apoptosis. MTH1 was identified as a target gene for miR-4478, and miR-4478 regulates H2O2-induced NPCs apoptosis by modulating MTH1. In addition, downregulation of miR-4478 alleviated IVDD in a mouse model. Conclusions. In summary, our study provides evidence that miR-4478 may aggravate IVDD through its target gene MTH1 by accelerating oxidative stress in NPCs and demonstrates that miR-4478 has therapeutic potential in IVDD treatment.