Lecture 10 (Cloning a gene II; a modern approach) (1).pdf

Biol 366: A Modern approach for cloning genes; Cloning of βphellandrene synthase and S-linalool synthase from lavender Learning objectives. In this lecture you will learn about: - Building EST databases - Screening EST databases - Building transcriptomes using NGS - Cloning a gene using these databa...

Biol 366: A Modern approach for cloning genes; Cloning of βphellandrene synthase and S-linalool synthase from lavender Learning objectives. In this lecture you will learn about: - Building EST databases - Screening EST databases - Building transcriptomes using NGS - Cloning a gene using these databases References: Text sections: (7.2; Cloned Genes Can Be Expressed to Amplify Protein Production & Terminal Tags Provide Handles for Affinity Purification) Lane A, Boeckelmann A, Woronuk G, Sarker L, and Mahmoud SS (2010). A Genomics resource for investigating regulation of essential oil production in L. angustifolia. PLANTA 231: 835-845. Demissie ZA, Sarker L, and Mahmoud SS (2011). Cloning and functional characterization of β-phellandrene synthase from Lavandula angustifolia. PLANTA 233: 685-696. Adal AM, Sarker LS, Malli RPN, Liang P and Mahmoud SS (2019). RNA-Seq in the discovery of a sparsely expressed scent-determining monoterpene synthase in lavender (Lavandula). PLANTA, 249:271–290 Review: Cloning a gene from a cDNA library: Approach 1. (The classic approach, discussed in lecture 9): A virtual cDNA library a. Obtain a probe for the target gene b. Build a cDNA library from a target tissue c. Screen the cDNA library using your probe The process of screening a cDNA library . . . . . . . . . . . . . .. . . . a. Grow several million bacterial colonies from the cDNA library on plates b. Transfer plasmid DNA from bacterial colonies to a nitrocellulose membrane. . . . . . . . . . . . . . .. . . . c. Screen the membrane with a probe specific for the gene of interest 2 Review: Cloning a gene (classic approach), continued d. Grow positive colonies. e. Extract plasmid DNA from each colony f. Sequence the cDNA inserted in plasmids g. Find a full length clone h. Express the cDNA in bacteria or yeast, to produce the r-protein i. Confirm activity of the r-protein via enzyme assay Note: This approach is best suited when the target gene or genes similar to it are not known 3 Utility of cDNA libraries in cloning genes: Approach 2; Building an EST database Note: This approach is best suited when sequence information for the target gene or genes similar to it from other species ARE known a. Produce a cDNA library plasmids from each, and sequence the cDNA cloned in the plasmid - The sequence could be partial (300 – 500 bp), BUT some are often full length depending on mRNA size - Could sequence from 5’ end, 3’ end or both A virtual cDNA library b. Grow 1000 - 10000 random colonies from the library, extract A hypothetical cDNA clone c. The result is an “Expressed Sequence Tag (EST)” database / library d. Each database / library member is an “EST” 4 Cloning a gene (cDNA) that encodes a protein of interest? A cDNA library is a physical entity; a collection of cDNA clones. A hypothetical cDNA library Clone 1: ACGTTTTACCCTC………………AAAAAAAAAAAA Clone 2: CCCCTATATACAT………………AAAAAAAAAAAA ... ... Clone 1000: AATATTAACTGA…………………AAAAAAAAAAAA A hypothetical EST database An EST database is a collection of digitized cDNA/mRNA sequences 5 Utility of cDNA libraries in cloning genes: Approach 2, continued e. Assign a function to ESTs based on homology to known sequences in public databases. To do this: - Blast your cDNA(s) against sequences in GenBank - The software will assign a tentative function to your cDNA by comparing DNA sequences or encoded amino acid (protein) sequences Assumption: If DNA or protein sequences for two genes are similar to one another, the two proteins likely have the same or a similar function. THIS DOES NOT ALWAYS WORK! BUT IT VERY OFTEN DOES in particular is homology is high. Note: DNA and protein sequences for cloned genes are deposited into public databases such as GenBank (https://www.ncbi.nlm.nih.gov/genbank/) 6 Utility of cDNA libraries in cloning genes: Approach 2. (EST database) Overview of the approach: i. Produce a cDNA library ii. Sequences many (e.g., 5000) cDNAs from a cDNA library iii. Compare the nucleotide sequences AND/OR the amino acid sequence for all possible proteins encoded by all cDNAs to sequences in GenBank using the Blast software. i. This assigns a tentative / putative function to all cDNAs. iv. Select a cDNA to work with based on function determined in step iii. v. Confirm the function by expression in bacteria to produce r-protein, and assay the r-protein to see if the protein has the function you are looking for. 7 Annotating (assigning functions to) the EST library (all ESTs) i. Assign a function to all ESTs in the database using BLAST How does “BLAST” work? Do in-class activity (next slide) • BLST assign function based on homology among nucleotide and/or protein sequences. • The assumption is that “if protein sequence for two genes are identical/similar to one another, the two proteins likely have a similar function. 8 In class activity Let’s find a function for the sequence below: Sequence of an EST from lavender EST library: ATGTCTACCATTATTGCAATACAAGCGTTGCTTCCTATTC CAACTACTAAAACATATCTTAGCCATGGCTTGGACAAGTA CTCTTCGCGCTGTCCTTCCTCCTCCACTCCTCGCCCTAG ACTGCGTTGCTCGTTGCAGGTGAGTGATCCGATCCAAA CGGGCCGACGATCCGGAGGCTACCCGCCCGCCCTATG GGATTTCGACACTATTCAATCACTCAACACCGAGTATAAG GGAG 9 In class activity: Let’s find a function for the sequence below: – Go to: https://www.ncbi.nlm.nih.gov/ – Choose BLAST – Choose blastx – Enter DNA sequence in the provided box – Choose a database – Hit BLAST button – Wait for results When doing a BLAST, the assumption is that “similar” genes have “similar functions” This is not always true. However, it often works. 10 Utility of cDNA libraries in cloning genes: sequencing random clones Confirming gene function i. Isolate a clone /gene/cDNA of interest a. Cut the gene out of the vector from the cDNA library b. Amplify the cDNA by PCR ii. Clone the cDNA in an expression vector iii. Express the recombinant protein encoded by the cDNA in bacteria iv. Purify the protein (e.g., by affinity chromatography) v. Confirm function by assay (like LimS) 11 Utility of cDNA libraries in cloning genes (Case study) Objective of the study: Cloning ALL genes related to essential oil synthesis in lavenders. Article title: A Genomics resource for investigating regulation of essential oil production in L. angustifolia. Authors: Lane A, Boeckelmann A, Woronuk G, Sarker L, and Mahmoud SS (2010). Journal: PLANTA. 231: 835-845. 12 Genes controlling essential oil synthesis in lavenders (Lane et al., 2010) Essential oil is made up of monoterpenes Terpene synthase genes produce monoterpenes My group is interested in cloning these genes 13 To help clone EO related genes: i. Built a “Expressed Sequence Tag” database a. Isolated oil glands (glandular trichomes) b. Extracted RNA from oil gland cells c. Reverse transcribed the RNA to cDNA d. Sequenced > 10,000 random clones e. Produced an EST database Fig 1. (Lane et al 2010) 14 To help clone EO related genes: f. Assigned function to all ESTs (BLAST) g. Selected target genes. (For example, a gene similar to sage CinS) h. Expressed genes in bacteria (got r-protein) i. Assayed the r-protein Fig 1. Lane et al 2010. 15 Key features of lavender EST database • The lavender EST database contained representatives of all gene families found in plants • The database also contained genes for essential oil synthesis Part of Table 2 in Lane et al., 2010. 16 Case study 2: Cloning of β-phellandrene synthase Candidate selection. • Our EST database had a gene similar to the sage cineole synthase (CinS). GPP • We cloned the gene and assayed it. • The gene encoded b-phellandrene synthase CinS cineole PhlS b-phellandrene Demissie ZA, Sarker L, and Mahmoud SS (2011). Cloning and functional characterization of β-phellandrene synthase from Lavandula angustifolia. PLANTA 233: 685-696. 17 Cloning and functional characterization of βphellandrene synthase from Lavandula angustifolia Zerihun A Demissie 1, Lukman S Sarker, Soheil S Mahmoud DOI: 10.1007/s00425-010-1332-5 Abstract En route to building genomics resources for Lavandula, we have obtained over 14,000 ESTs for leaves and flowers of L. angustifolia, a major essential oil crop, and identified a number of previously uncharacterized terpene synthase (TPS) genes. Here we report the cloning, expression in E. coli, and functional characterization of βphellandrene synthase, LaβPHLS. The ORF--excluding the transit peptide--for this gene encoded a 62.3 kDa protein that contained all conserved motifs present in plant TPSs. Expression in bacteria resulted in the production of a soluble protein that was purified by Ni-NTA agarose affinity chromatography. While the recombinant LaβPHLS did not utilize FPP as a substrate, it converted GPP (the preferred substrate) 18 and NPP into β-phellandrene as the major product, The lavender β-phellandrene synthase is being used to produce biofuels in cyanobacteria Article title: A phycocyanin-phellandrene synthase fusion enhances recombinant protein expression and βphellandrene (monoterpene) hydrocarbons production in Synechocystis (cyanobacteria) Authors: Cinzia Formighieri and Anastasios Melis Can see the article at: https://doi.org/10.1016/j.ymben.2015.09.010 Using “transcriptome sequencing” or RNA-Seq in cloning gene. Similar to EST database. However: - cDNA library is made only to dscDNA synthesis - cDNA fragments are not inserted in vectors - cDNA fragments are not transformed into bacterial cells - The entire transcriptome is fully sequenced using NGS - Sequencing reads are assembled into “contigious sequences” or “contigs” - This is known as de novo assembly Most contigs represent mRNA (partial and full) 20 Cloning a functional gene: Approach 3. Using “transcriptome sequencing” or RNA-Seq.): - The entire transcriptome is sequenced using 2nd generation sequencing - ESTs are produced by aligning short sequencing reads to make contigs - All ESTs are annotated using BLAST - Target genes of interest are PCR-amplified from cDNA and studies further Main advantages: - Less labor intensive and cost effective - More comprehensive if deep sequencing is done Main disadvantages: - No physical cDNA clone - False positives 21 Case study 3: Cloning of lavender S-linalool synthase Article title: RNA-Seq in the discovery of a sparsely expressed scent-determining monoterpene synthase in lavender (Lavandula). Authors: Adal AM, Sarker LS, Malli RPN, Liang P and Mahmoud SS (2019). Journal: Planta, 249:271–290 R-linalool is a major EO constituent S-linalool is minor, but contributes desired scent Case study: Cloning of lavender S-linalool synthase Summary of the Lavandula transcriptome assembly (Modified from Table 2 in Adal., et l., 2019) Total number of the raw reads 29,008,569 Total number of clean reads 28,830,705 Total number of unigenes (unique transcripts) Mean length of unigenes (bp) 101,618 692.64 Min length of unigenes (bp) 201 Max length of unigenes (bp) 12,223 Case study: Cloning of lavender S-linalool synthase Article title: RNA-Seq in the discovery of a sparsely expressed scent-determining monoterpene synthase in lavender (Lavandula). Authors: Adal AM, Sarker LS, Malli RPN, Liang P and Mahmoud SS (2019). Journal: PLANTA, 249:271–290 23 Production of recombinant proteins in E. coli using an expression vector 24 A typical E. coli expression vector. FIG 7-13 Important elements in the vector: • Polylinker (MCS) • A promoter (P) (directs transcription) • A transcription-termination sequence: - Terminates transcription The operator (O): permits regulation of the promoter. The ribosome-binding site allows translation initiation The selectable marker allows selection of transformed bacteria 25 Example: Expression of recombinant RecA protein in bacteria. • The RecA gene was cloned into an expression vector (inducible promoter) FIG 7-16 • The vector was transformed into bacterial cells 26 Expression of recombinant RecA protein in bacteria. • Some cells were induced (Induced), and some were not (Induced) • Cells were lysed and total protein extracts analyzed by SDS PAGE FIG 7-17 • Transformed cells were grown • Uninduced cells did not produce RecA protein • Induced cells produced large amounts of the RecA protein. 27 There are several commercial E. coli expression vectors available, e.g., PET vectors. Regardless of expression system used, recombinant proteins may be purified by affinity chromatography: • The protein of interest must be fused to a “Tag” • The tag can be used to purify the r-protein • Sometimes, the tag has to be removed • Examples of tags: GST, His(6-8), etc. 29 The GST-GSH system • Glutathione (GSH) is a tripeptide, made up of a glutamate residue (Glu) to which a Cys–Gly dipeptide is attached • Glutathione-S-transferase (GST) is a small enzyme that binds glutathione tightly (GSH is a substrate for GST) • GSH can act as a “hook” to remove/purify GST, or GST fused to another proteins (a fusion protein) from a protein mixture FIG 7-21a 30 Use of tagged proteins (GST tag) in protein purification. GST is fused to the protein of interest in an expression vector The tagged “fusion protein” is expressed and is present in the extract of lysed cells. FIG 7-21b 31 Use of tagged proteins (GST tag) in protein purification. 1. The bacterial extract containing GST-Protein fusion is put through a column with a matrix to which glutathione is attached (green) – The GST-tagged protein binds to the glutathione and remains on the column, while other proteins go through. 2. A solution of free glutathione is added to the column to elute the tagged protein 1) Protein mixture is added to the column Free Glutathione is added to elute the bound proteins Text Fig 7-21 32 Some commonly used tags Notes: • For affinity chromatography to work the r-protein MUST be soluble • Some proteins are inherently insoluble • Some become insoluble when fused to a tag • Some protein fusions may be solubilized using various detergents and then purified 33