BIOL 3120 Cell Biology Lab 8 PDF

BIOL 3120 Cell Biology Lab Lab 8 Nucleic Acids Separation by Agarose Gel Electrophoresis Rubaia Tasmin Master’s Student 10/28/2024 1 Today’s Lab...

BIOL 3120 Cell Biology Lab Lab 8 Nucleic Acids Separation by Agarose Gel Electrophoresis Rubaia Tasmin Master’s Student 10/28/2024 1 Today’s Lab Overview 1. Agarose Gel Electrophoresis 1.1 Principle 1.2 DNA migration 1.3 Factors affecting migration of DNA 2. Procedures 2.1 Preparation of Agarose Gel 2.2 Sample Preparation and Loading 2.3 Visualization 2 1. Agarose Gel Electrophoresis  The gel is casted horizontally  Separates large molecules based on size  Commonly used for DNA separations  DNA moves from the negative (black) electrode to the positive (red) electrode https://www.cleaverscientific.com/applications/agarose-gel-electrophoresis-of-dna/  Lower resolving power than SDS- PAGE 3  1.1 Principle - Separates DNA fragments by size in a solid support medium such as an agarose gel - the higher the concentration of agarose, the smaller the pore size. Samples (DNA) are pipetted into the wells This is followed by the application of an electric current at the negative end DNA migrates towards the positive end 4  1.2 Direction of DNA migration DNA is negatively charged When placed in electrical field, DNA will migrate towards the positive pole (anode) An agarose gel is used to slow the movement of DNA and separate by size https://image.slidesharecdn.com/electrophoresis-140608115247-phpapp01/95/electrophoresis-19-638.jpg?cb=1402228384 5 1.3 Factors affecting DNA migration a. Agarose concentration (0.5% - 2%) - The mobility of DNA molecules is inversely proportional to gel concentration. b. Size of DNA molecule - smaller molecules pass through the pores of the gel more easily than larger ones. c. DNA conformation - DNA molecules having a more compact shape (e.g. plasmid DNA) moves faster through the gel compared with linear DNA fragments of the same size. d. Applied voltage (50 V – 130 V) - Within a range, the higher the applied voltage, the faster the sample 6  2. Procedure of Agarose Gel Electrophoresis 2.1 For 1% agarose gel = 1g of agarose in 100ml of TAE buffer - Staining with SYBR gold 2.2 Sample is mixed with loading dye (consist bromophenol blue and sucrose which provide density to the sample) 2.3 Visualized under UV light source https://biomedguide.com/biotechnology-and-research-techniques/dna-gel-electrophoresis/ 7 https://biomedguide.com/biotechnology-and-research-techniques/dna-gel-electrophoresis/ 8 3. RT-PCR product (Actin cDNA) versus PCR product (Actin gDNA) on gel: M 1 2 3 4 5 6 1000 bp 500 bp Lanes 1, 3-6 show At-ACTIN gDNA (with intron); size: 805bp Lane 2 shows At-ACTIN cDNA (no intron); size: 694bp 9 Lab report format: File name for your lab report submission- BIOL3120_Section_Lastname_Firstname_LabN​ 1. Introduction: Principal of the lab, main concept, purpose of the experiment. 2. Materials: All the chemicals used along with concentration, and instruments used. 3. Methods: Brief method/ protocol. 4. Post-lab questions. (next slide) # Send me the Word document by email 10 Post lab questions: 1. Why is the size of the RT-PCR product different from that of the genomic PCR product? 2. In PCR, what does annealing temperature depend on? what determines the extension time that should be used during PCR 3. Design the forward and reverse primers if you want to amplify the sequence below(sequence from 5’ to 3’) AAGCATTAGCAATTTAGAATTAATTTGACCCGAATTTGCATTTACGAGTGTTTCCCTTTTTAAAAACCACAGACGCGGG TACTAACTTAACACACATAGAAAACAACACTCTCTCGAACATTCCTTCTTCATTTCGTAGTTCAGGTACCCCTCTCAAT CTCTCACATCACTTCATTGTTTATTATCTCAATTTCTCATTTTCATTTTCATTTTCATTTTCATTTTCCGTGTGTCTAT GCAGCAAATCAATTACAATCAACAATGGCAGAATCTGAAGATATTCAACCTTTGGTCTGTGATAACGGAACCGGAATGG TCAAGGTATCAATCATTATCAATCAATCGATCTC 11