HCS228 Microbial Taxonomy 2024-25 PDF

Microbial Taxonomy HCS228 (2024-25) Dr Lewis Bingle Pasteur 169 [email protected]  Systematics Study of the diversity of life, both past and present, & relationships among living things through time. Includes… Taxonomy: science of biological clas...

Microbial Taxonomy HCS228 (2024-25) Dr Lewis Bingle Pasteur 169 [email protected]  Systematics Study of the diversity of life, both past and present, & relationships among living things through time. Includes… Taxonomy: science of biological classification Classification: arrangement of organisms into groups or taxa Nomenclature: branch of systematics concerned with assignment of names Rather than just learning a list of names, we will look at how related bacteria are grouped and how these groups are assigned names Why is this important? 3  Lecture Outline Taxonomic levels & groupings – Species, genus etc. Taxonomic methods – Characteristics used for classification – Phylogenetic methods  Taxonomic Ranks Domain Eukaryota Bacteria Kingdom Animalia Bacteria(?) Phylum Chordata Pseudomonadota (was Proteobacteria) Class Mammalia γ-proteobacteria Order Primates Enterobacteriales Family Hominidae Enterobacteriaceae Genus Homo Escherichia Species H. sapiens E. coli N.B. Genus and species (and sometimes higher ranks) are normally written in italics  Important Bacterial Phyla Common Gram-negative bacterial pathogens mostly phylum Pseudomonadota (synonym Proteobacteria*) Common Gram-positive bacterial pathogens mostly phylum Bacillota (synonym Firmicutes*) Important exceptions: causative agents for TB? Syphilis? *Just when you think you have learned this stuff – they go and change all the names :-( 6  Eukaryotic Kingdoms Eukaryotes are now partitioned into six kingdoms or divisions (3 contain human pathogens – examples in brackets below): Excavata (Giardia, Trichomonas) Rhizaria Chromalveolata Plantae Opisthokonta (Candida, Homo) Amoebozoa (Entamoeba) 7 Virus Types: DNA viruses 8  Virus Types: RNA viruses Norovirus 9  Virus Taxonomy: Baltimore Scheme Classification based on genome type & replication strategy I. dsDNA viruses (e.g. Adenoviruses, Herpesviruses, Poxviruses) II. ssDNA viruses (+)sense DNA (e.g. Parvoviruses) III. dsRNA viruses (e.g. Reoviruses) IV. (+)ssRNA viruses (+)sense RNA (e.g. Norovirus) V. (−)ssRNA viruses (−)sense RNA (e.g. Orthomyxoviruses, Rhabdoviruses) David Baltimore VI. ssRNA-RT viruses (+)sense RNA with DNA (US intermediate (e.g. Retroviruses) Virologist) VII. dsDNA-RT viruses RNA intermediate (e.g. Hepadnaviruses) 10  Virus Taxonomy: ICTV International Committee on Taxonomy of Viruses http://www.ictvonline.org/virusTaxInfo.asp Taxon Suffix HIV Order –virales Not assigned (many viruses are not!) Family –viridae Retroviridae Subfamily –virinae Orthoretrovirinae Genus –virus Lentivirus Species –virus Human immunodeficiency virus 1 or 2* *Species names generally take the form of [Disease] virus 11  Taxonomic Mnemonics “Dear Kind Prince Charles Orders Fishy Green Soup” …or make up your own! 12  Species definition (for sexually-reproducing organisms) Taxonomy was initially based on appearance (morphology) for most macroscopic organisms “Dogs look different to cats, cats look different to lions” The more closely related 2 organisms are, Panthera leo the more similar their appearance is & the Panthera tigris more features they have in common Species: groups of interbreeding (or potentially interbreeding) natural populations that are reproductively isolated from other groups  Microbial Species Definition Q. What about organisms that reproduce via binary fission (e.g. bacteria)?? Bacillus cereus Bacillus anthracis In this case organisms are assigned to species on basis of phenotypic and genotypic features – appearance and genetics Microbial species: collection of e.g. bacteria that share many stable properties but differ significantly from other groups of bacteria  Sub-Species Ranks Strain: population of microbes that descends from a single microbe or a pure culture isolate differing (in minor way) from other bacteria of same species Strains also created in laboratory by mutating wild-type examples of bacterial species (GMOs) Biovar: strain distinguishable from other strains of same species on basis of physiology or biochemistry Pathovar: strain differentiated by distinctive pathogenicity Serovar: strain differentiated by serological means Morphovar: strain differentiated by morphology 15  Characteristics used in taxonomy 1. Morphological characteristics (appearance) 2. Physiological and metabolic characteristics 3. Genetic characteristics 4. Other molecular characteristics  Physiological and metabolic characteristics e.g. biochemical testing (see laboratory classes) Usually relates to enzyme or transport protein activity Proteins are encoded by genes Therefore, analysis of physiology and metabolism provides an indirect genomic comparison  Genetic Characteristics Gene presence / absence Gene (DNA, RNA) sequences – Point mutations (Single Nucleotide Polymorphisms, SNPs) – Insertions / deletions – e.g. 16S rRNA gene (limited information content) Genome sequences (genomics) – Whole genome sequencing (WGS) - maximum possible information content Taxonomy based on genetics can be confused by Horizontal Gene Transfer Vertical Inheritance & Horizontal Genetic Transfer Time Horizontal Genetic Exchange in Bacteria 3 Major Mechanisms 1. Transformation (Free DNA) 2. Transduction (Bacteriophage) 3. Conjugative transfer (Plasmid / Transposon)  Other molecular characteristics Proteins: – Mass spectrometry – Antibody-based methods / amino acid sequence Nucleic acid base composition /mole % G+C – e.g. 2 groups of Gram-positive bacteria MS Spectrum Genomic DNA Melting Curve Mass (m/z)  Woese’s 3 domain system was based on analysis of 16S / 18S rRNA Genes N.B. This is a genetic (evolutionary) distance tree (see later) LUCA Woese et al. (1990) Proc. Natl. Acad. Sci. USA 87: 4576-4579  Bacterial Species Definition In sexually-reproducing organisms, species defined by potential for interbreeding Bacteria and many other microbes are asexual Species originally defined by shared phenotypic traits (e.g. biochemistry) Modern bacterial species definition: shared genome sequences are at least 95% identical (ANI: average nucleotide identity) N.B. HGT may cause massive differences within species 23  Recent developments: 1. Molecular methods (including DNA sequences) have come to dominate microbial systematics (taxonomy) 2. Taxonomy nowadays informed by phylogenetics (study of evolutionary relationships between groups of organisms) 3. Modern phylogenetics uses molecular sequencing data (gene sequences) to study evolutionary relatedness among groups of organisms (i.e. to reconstruct “family trees” or phylogeny based on living family members)  Impacts of Molecular Approach Existence of 1/3 of the tree of life! E.coli / Shigella Burkholderia / Pseudomonas Streptomyces: fungi or bacteria? Oomycetes like Phytophthora being previously classed as fungi 25  Phylogenetics: cladistics Making clusters of similar organisms Clustered (similar) organisms share common ancestor (= clade) Taxonomic groups (e.g. species) are (ideally) clades – see microbial species definition Similarity means possession of shared characteristics Modern cladistics is based on comparison of DNA or protein sequences Sequence(s) compared must be found in all organisms classified Normally genes encoding key functions (e.g. ribosome components) are used – why?  Sequence Comparisons Key idea: the more closely related two organisms are, the less divergent their gene (and encoded protein) sequences will be Differences will consist of various types of mutation Point mutations: swapping one base pair for another (e.g. C→A) – also called single nucleotide polymorphisms (SNPs) Deletions: part of gene sequence is removed in one strain compared to its closest relative Insertions: some extra sequence is inserted in middle of (or at end of) gene sequence compared to closest relative  Sequence Comparisons Comparison via pairwise sequence alignment Simple comparisons, between similar sequences with only point mutations, might be similar end-to end More complex alignments may require gaps inserted What kind of mutations are these? Simple: ATGAGCTTCAGAATTTGGCACTGA ||||||||| || ||||||||||| ATGAGCTTCTGACTTTGGCACTGA Complex: ATG---AGC---AGAATTTGGCACTGA ||| ||| || |||||| |||| ATGTTAAGCTTCTGACTTTGGCGCTGA What kind of mutations are these?  Multiple Sequence Alignment (MSA) If you want to build a “family tree”, you may need to compare many different sequences and sort them in order of relatedness MSA more computationally complex than pairwise alignment Often starts by find most similar pair, aligning them & then adding in next most similar sequence A. TTCTCCTCAA CLOSE DISTANT B. ATGTCCTCAA RELATIVES RELATIVES C. CGCTAGTCAG D. CGCTAGTCAC E. CGAATCGGTT  Genetic Distance Various approaches to calculate relationships e.g. distance methods MSA converted into distance matrix (% similarity) Summarises genetic distances (similarities) between each pair of sequences A 0 A. TTCTCCTCAA B 2 0 B. ATGTCCTCAT C 5 5 0 C. CGCTAGTCAG D 5 5 2 0 D. CGCTAGTCAC E 9 9 8 8 0 E. CGAATCGGTT A B C D E  Phylogenetic Trees Tree diagrams show relative relationships graphically e.g. in diagram at bottom right, A & B or C & D are more closely related than A & C and much more closely related than A & E A 0 A B B 2 0 E 1 1 C C 5 5 0 1 5 2 D 1 D 5 5 2 0 1 1 E 9 9 8 8 0 A B C D E ROOT  Interpreting Phylogenetic Trees Clade / group: organisms sharing common ancestor Dendrogram (distance tree) Existing (sampled) organisms at end of branches Root = ancestor / oldest point of tree Outgroup (E in this case): organism phylogenetically outside the group of interest -serves as reference for rooting / determining evolutionary relationships among other clades Nodes: formation of new species / type Branch length: no. changes until next speciation (genetic distance between organisms) 32  Cladograms Some trees just show groupings (clades) with fixed branch lengths E D C B A 33  Types of Tree Rectangular Radial N.B. In this case only horizontal lengths Indicate genetic distance 34 Phylogenetics Questions What is the outgroup? Where is the root? Which pair of sequences is most closely related? Which pair of sequences is most distantly related (different)? What is the blue dot? 35  Phylogenetics Questions Where is the root on the radial tree? 36  Phylogenetic Trees: Domain Bacteria Phyla include: Proteobacteria; Firmicutes Spirochaetes; Actinobacteria 37 Phylogenetic Trees: SARS-like coronaviruses 38  Homework Identify two important pathogens from each of the following bacterial phyla: Pseudomonadota (Proteobacteria) Bacillota (Firmicutes) Spirochaetes Actinobacteria 39  Microbes dominate the Tree of Life A E B A = Archaea E = Eukaryotes B = Bacteria  Learning Outcomes You should be able to: Describe the major taxonomic groups of microorganisms and their features Describe the way(s) in which microbes are classified  Discussion Question You have isolated a bacterium from a patient sample, which you believe may be a new species. How would you investigate its taxonomy? 42