Genetics Reviewer Ch. 1-3

INTRODUCTION TO GENETICS Allele: the form of a gene Allele: the different forms of a gene What is Genetics? *Represented by a l...

INTRODUCTION TO GENETICS Allele: the form of a gene Allele: the different forms of a gene What is Genetics? *Represented by a letter. The Study of similarities and differences ex: Widow’s Peak = W between relatives. * Organisms have two alleles for each trait, one inherited from the mother and one Why do we resemble our parents? from the father. Our parents provided most of the information ex: WW (in the sex cells) that governs our appearance, our activity, and our behavior. They provided most of the GENES. Genetics is also seen as the study of Genes or genetic variation. The scientific study of heredity. Etymology of Genetics The word genetics stems from the ancient Greek Forms of Alleles γενετικός genetikos meaning "genitive"/"generative", which in turn derives from γένεσις genesis meaning Dominant Allele: trait will be expressed with "origin.” only one copy present o Represented with capital letters. ex: W (Widow’s peak) Recessive Allele: trait will only be expressed when no dominant alleles are present o Represented with lower case letters. ex: w (No widow’s peak) Early ideas about inheritance Evidence from 8,000 – 1,000 B.C. shows horses, camels, and oxen had been domesticated and that various Vocabulary to Know breeds of dogs had derived from wolves, through Trait: a specific characteristic varying among artificial selection. individuals ex: eye color Gene: a portion of DNA determining a trait; found on the chromosomes ex: the gene for eye color Early ideas about inheritance Vocabulary (continued) Cultivation of many plants, including wheat, corn and rice as well as the date palm began as Hybrid: the offspring of two parents with early as 5,000 B.C. different traits Gametes: reproductive cells (aka: sex cells; sperm & egg) Early ideas about inheritance 4. Principle of independent assortment: Genes for different traits segregate independently from one The Assyrians were sophisticated and experienced another. breeders of domesticated plants and animals and had artificially pollinated date palms (shown at right) by 800 B.C. The Greek Influence on ideas of inheritance Hippocrates – “Humors”, which could be altered during Allele Combinations an individual lifetime and therefore diseased or normal, were drawn from various parts of the body to the Homozygous: both alleles are the same semen and passed on to the offspring. This o ex: WW or ww “pangenesis” theory even formed the basis of Darwin’s Heterozygous: alleles are different early ideas of inheritance. o ex: Ww (capital letter is always 1st!) Aristotle – semen produced a “vital heat” that cooked and shaped the menstrual blood giving it the capacity to produce offspring with the same “form” as the parent. Later ideas of inheritance (1600- 1850) Pre-formationism – sex cells contain a complete miniature adult (the homunculus) → Epigenesis – presumably put forth by Harvey, held that body structures were not present in the sex cells, but were formed anew. Genotype: the actual allele combination; what the genes say o ex: WW, Ww, ww Phenotype: the trait observed o ex: Widow’s Peak Other ideas of inheritance Pangenesis – the inheritance of acquired characteristics – put forward again by Jean Baptiste Lamarck. o [the notion was discredited by August Weissman, who cut tails off mice for 22 generations and continued to get mice with long tails] Blending Inheritance – the belief that characteristics of parents blended like paint, e.g., mix blue and yellow and get green paint. Punnett Squares Gregor Mendel Used to predict the genotypes of offspring when the genotypes of both parents is known Seven years after Darwin published his theory, Mendel, an Austrian monk, published (in 1866) his findings on inheritance in peas. Mendel discovered the rules governing “vertical” gene transmission. Mendel’s Conclusions 1. Inheritance is determined by factors passed from one generation to the next. 2. Principle of dominance: Some alleles are dominant and others are recessive. 3. Segregation: A gamete carries only one copy of each gene.  New Offspring = New gene combinations Built into the mechanism for gene transmission is a means for creating variability. Reshuffling of genes in the sex cells of the parents creates new combinations of genes in the offspring. Totally new genes can be created by Mutation. Highlights of some discoveries following Mendel’s work 1900 - Mendel’s work was rediscovered. Other Patterns of Inheritance 1902 - Sutton proposed that genes were located on chromosomes. Incomplete Dominance 1944 - The genetic material was found to be DNA. 1953 - Watson and Crick propose a model for the The heterozygous phenotype (Ww) is structure of DNA that also suggests a means for its somewhere between both homozygous faithful replication. phenotypes (WW & ww). 1966 - How DNA worked to control the activities of the Ex: pink flowers cell had all been worked out [ DNA → RNA → protein] 1973 – Recombinant DNA molecules formed. 1977 – Sequencing of DNA achieved. 1983 – PCR technique developed. 1990 – First successful gene therapy. 1995 – The Human Genome Project (HGP) gets Codominance underway. 2003 – HGP essentially completed. Both alleles contribute to the phenotype; neither allele is dominant. Vertical Gene Transmission Ex: roan cattle While most of our genes come from our parents (vertical transmission) – some may not have!!! Some of it is coming in horizontally. It seems that some of our genetic material is coming from viruses and other parasites that invade us. Multiple Alleles Horizontal Gene Transmission (HGT) More than two allele possibilities. The Human Genome Project (HGP) has found that there is a lot of the DNA of our genes that is identical to Ex: blood that of viruses. These parasites have the ability to introduce some of their genetic material into their host’s (meaning us) genetic material. These viruses have apparently been doing this for millions of years. These viral elements make up 45% of our DNA and Polygenic Traits fully 8% of that comes from retroviruses. HIV is a retrovirus. Traits controlled by more than one gene. What are Genes? Ex: skin color The nitrogen bases, here represented with the letters: A, T, G, and C, signify a code that is translated into one of the 20 amino acids that make up every protein found in every organism on earth. Each nitrogen base always pairs with another base such that A always pairs with T and G with C. There are 3,200,000,000 base pairs in each human cell, a string Individuals differ from one another in the specific that would stretch 1 meter (ca. 3 feet) in length. sequence of bases in their DNA. 1…TAGGCTGGCATTATATGCGAATTG… …ATCCGACCGTAATATACGCTTAAC… 2…TAGGCTGGCGTTATATGCGAATTG… …ATCCGACCGCAATATACGCTTAAC… The HUMAN GENOME PROJECT We have just completed sequencing the entire human genome and there are exactly 3.164 billion base pairs in the human genome. How much DNA (or genes) do cells have? The best estimate is that there are only 25,000 genes, half of which we don’t yet know the function. The rest consists of highly repetitive sequences (e.g., TTTGGCTTTGGCTTTGGC) repeated over and over thousands of times. The HUMAN GENOME PROJECT Almost 99.9% of the base pairs are exactly the same in all people! (This still leaves about 3 million base pairs that differ among any two individuals) Focus on the similarities… How much DNA (or genes) do HUMAN cells need? The genome is full of non-coding or “Junk” or repetitive First of all, if we assume 25,000 genes in the human, DNA – but even this can be useful for DNA and use a figure of 3,000 bp per gene then we need only Fingerprinting. 75 million bp for all our genes. We have about 3.2 billion base pairs in our DNA!! DNA Fingerprinting This means we can account for all our genes with only Can help to convict the guilty and exonerate the 2% of the DNA in our cells. innocent. In a famous case in England, a rapist was caught The rest is referred to as “Junk” or repetitive DNA. 3 yrs after the crime when DNA from the sperm was matched with his DNA. We know exactly how the cell does this What can we do with all that we have learned about genes? DNA in the nucleus of the cell makes a nearly identical copy of itself and transports this copy to the site of The first organism to have its genetic material protein synthesis in the cell. Using the genetic code, the completely sequenced was a bacterial virus (ΦX174). It message originally present in the DNA and transcribed has 5,386 base pairs. Using this information, researchers into the RNA copy is translated into a protein. This 2 years ago synthesized a completely artificial virus from process takes only seconds to accomplish since it is lab chemicals that was 100% identical to the natural aided by enzymes. ΦX174 virus; and it was able to behave like the natural virus – infecting a bacterial cell. We have created life in a test tube… or at least…..duplicated it! What else can we do with what we have learned about Cells translate the message in the genetic code to create genes? proteins. We can isolate individual genes from any The 4 bases in the DNA are a recipe for adding amino organism or individual. acids one by one to make a protein, and 61 of the 64 We can make millions of copies of that gene in a possible ways of arranging these 4 bases in 3- letter matter of hours. words prescribes an amino acid. The remaining 3 order We can combine that gene with others in what a STOP to the process….the protein is done. is called a Recombinant DNA molecule and insert that into most any organism we choose. We differ from our parents because the proteins coded This is called Genetic Engineering. from DNA are different!  Fertilization from two parents Gene Therapy The technology may eventually be used to treat a whole range of inherited disorders… Gregor Johann Mendel …for example, why not introduce the gene for insulin production into insulin-dependent diabetics rather than having them rely on frequent insulin injections? Austrian Monk, born in what is now Czech Republic in 1822 Son of peasant farmer, studied Theology and was The gene for ADA has been isolated, combined with a ordained priest Order St. Augustine. harmless virus (Recombinant DNA) and introduced into children with this condition. The photo on the right Went to the university of Vienna, where he studied shows one successful application of this technology. botany and learned the Scientific Method Worked with pure lines of peas for eight years Prior to Mendel, heredity was regarded as a "blending“ process and the offspring were essentially a "dilution" of the different parental characteristics. “Father of Genetics” Mendel worked with experimenting pea plants to What if athletes began to use “gene doping”, where learn about the patterns of inheritance. genes for Human Growth Hormone (HGH) or Insulin-like Growth factor (IGF-1) would be introduced into their He found mathematical patterns of inheritance. muscles? His work was not appreciated until 1900, 16 years It would be more effective and essentially non- after his death. detectable. Olympic officials are definitely worried about this happening – fearing it has the potential to ruin athletic competition as we know it. Chapter 2: MENDELIAN GENETICS Introduction to Genetics GENETICS – branch of biology that deals with heredity Why PEA (Pisum sativum) Plants? and variation of organisms. Peas were available in many varieties, Chromosomes carry the hereditary information inexpensive, has short life cycle, simple procedures (genes) and easy to grow. o Arrangement of nucleotides in DNA The use of plants also allowed strict control over o DNA → RNA → Proteins the mating. Chromosomes (and genes) occur in pairs Homologous He chose to study only characters that varied in Chromosomes an “either-or” rather than a “more-or-less” manner. New combinations of genes occur in sexual Mendel’s peas reproduction  Mendel looked at seven traits or characteristics of pea plants In 1866 he published Experiments in Plant Hybridization, (Versuche über Pflanzen-Hybriden) in which he established his three Principles of Inheritance He tried to repeat his work in another plant, but didn’t work because the plant reproduced asexually! If… Work was largely ignored for 34 years, until 1900, when 3 independent botanists rediscovered Mendel’s work. How would you know if a certain trait is DOMINANT or CHAPTER 3: Beyond Mendel’s Laws: Non-Mendelian RECESSIVE? Inheritance