Genetics Notes PDF

**[GENETICS]** I. **[Transmission of genes and genetic recombination]** During sexual reproduction, the off springs ( babies) resemble their parents but are not identical to them. Thus upon performing experimental crosses ( mating) , this pattern of transmission of traits tells ab...

**[GENETICS]** I. **[Transmission of genes and genetic recombination]** During sexual reproduction, the off springs ( babies) resemble their parents but are not identical to them. Thus upon performing experimental crosses ( mating) , this pattern of transmission of traits tells about the behavior of chromosomes during meiosis and fertilization which allow us to understand the segregation of alleles and genetic re-combinations leading to new combinations in generations. **[Chromosome structure]** photo1698430907 **[Hereditary traits and genes ]** In a diploid person , two copies of a chromosome are present, one from the mother and the second from the father , so for every gene we have one paternal and one maternal allele. If the two alleles are identical then we have a homozygous individual and this common version of the gene is the one expressed in phenotype. If the two alleles are different, the individual is called heterozygous, and so the one allele that is expressed in the phenotype is called dominant and the one that remains masked is called recessive. However if both alleles contribute to the phenotype together, the alleles are called co-dominant. In other cases , the dominant gene is not expressed completely in the phenotype, and in this case it is called incomplete dominance. **[Transmission of alleles and genetic recombination]** -During meiosis , the alleles are randomly distributed among gametes in a form that each gamete gets one allele only. This gives diverse gametes.This diversity increases also by the recombination during meiosis. -Fertilization also increases the chance of genetic variation due to random union of various parental gametes. [A- Intrachromosomic recombination] Genetic recombination occurs during prophase of the first meiotic division where homologous chromosomes pair and get closer , then their chromatids entangle ( chiasma formation) and exchange fragments of DNA ( genes or alleles). This process is called **crossing-over**. The the individual has already homozygous alleles, crossing over doesn\'t cause any recombination. However, if heterozygous, we now have a new assortment unlike the original one which increases the genetic variation.  [B- Interchromosomic recombination] Each pare of homologous chromosomes segregats independently to opposite poles of the cells during **anaphase I.** So , every daughter cell recieves one from the pair. This process is called **independent assortment** or **Interchromosomic recombination.** And since it occurs randomly, every gamete has its own unique assortment. **[Fertilization and genetic recombination]** A sperm containing a given combination of chromosomes has the same chance to fertilize a secondary oocyte as another sperm that has a completely different chromosomal assortment. Thus, fertilization enhances the genetic variation by this random fusion. This variation doesn\'t create new alleles; only new assortment of alleles the leads to polymorphism. **[Transmission of hereditary traits]** The transmission of different traits is studied by experimental crosses between individuals differing by one trait ( monohybrid) or two traits ( dihybrid with independent or linked genes). The results explain the pattern of transmission and informs whether a certain allele is dominant, recessive, co-dominant, or lethal. \- A test-cross allows us to know if a person with certain dominant phenotype is homozygous or heterozygous for a given trait, if the genes are linked ( complete or partial) or independent. It can also determine the position of the linked genes ( cis or trans) The genetic map of a chromosome is then established based on the results of genetic recombination ( frequency) since the percentage of recombinant gametes for two genes allows to estimate the distance between the on a chromosome. That\'s because 1% recombination means that the 2 genes are around 1 centimorgan apart. It also allows the determination of genes position on chromosomes. photo1689792361 (3) -A self-cross allows to determine whether alleles are dominant, recessive, co-dominant or lethal. **[Punnit square]**  It helps us detemine the expected percentages of phenotypes and genotypes of the offsprings of a given couple's genotype. II. **[Genetic variation and polymorphism]** **[Mutations and the environment]** Many environmental factors can cause mutations. These mutations may be corrected by the cell DNA repair system , but some can escape this repair. Some mutations can go unnoticed if they don\'t affect the phenotype; these are **silent** mutations. Other mutations do affect the phenotype whether in a harmful or a beneficial way. Mutations are not transmitted to offsprings unless they affect the DNA of the sperm or the ovum. **[Types of mutations]** 1- Substitution mutation: is a mutation as a result of replacement of nucleotide pair in a DNA duplex with a different pair. They mostly cause a change in amino acid sequence which is called a **Missense mutation.** A substitution that creates a new stop codon is called a **non-sense mutation.** A mutation that change the nucleotide sequence without changing the amino acid sequence, or a mutation that change the protein sequence without changing the protein function , or a mutation outside a coding region are called **silent mutations**. They don\'t produce a detectable change in phenotype. 2- deletion or insertion mutations: these mutations change the reading frame of the translation and leads to a different amino acid sequence after the site of mutation. They are called **frame-shift mutations**. photo1689792501 (1) **[Polymorphism in coding and non-coding sequences]** Each cell contains around 30,000 on the 23 pairs of chromosomes. They constitute around 5% of the DNA material. The remaining are non-coding sequences, many of which are short repetitive sequences. Each individual has two forms of a gene (alleles) located on homologous chromosomes in a precise location called the **locus**. The presence of multiple alleles for a hene is called **genetic polymorphism.** An allele is said to be polymorphic if present at a frequency \>1% in a population. **DNA VS RNA** In both, each triplet ( each referred to by a letter ) make an amino acid , and we have 4 used letters in each.  A\) ADENINE C\) CYTOSINE G\) GUANINE T\) THYMINE U\) URACIL With our increasing knowledge of the DNA make-up in cells, we know that genetic polymorphism doesn\'t only depend on the different alleles in a population, but also on the difference between restriction maps between individuals. These differences are a result of variations in sequences throughout the genome rather than just the genes. This is called a restriction fragment length polymorphism (RFLP) which can be used as a genetic marker in the same way like any phenotypic marker. **[Every individual has a unique genetic identity]** Two RFLPs are never alike, except if for identical twins. That\'s why each individual has his/her own genetic identity. The fact that every offspring\'s genetic material is contributed by both parents helps in parenthood assessment. Thus RFLP and DNA fingerprint of an offspring should share common DNA bands with the DNA fingerprints of his/her mother and father. III. **[Genetic diversity of populations]** **[Genetic variability in a population]** A population consists of the members of a species occupying a given area at the same time. Members of a population are more likely to be with members of their own population rather than members of other populations of the same species. This usually means that the population\'s total alleles is more likely to remain within the same population. This totality of alleles is referred to as the **population\'s gene pool.** Because a diploid individual (2n) can only have two copies/ alleles of a gene, this individual have a very small fraction of the total alleles in a pool. The difference of phenotypes that is noticed among members of a given population, whether skin color, hair color or texture \... is there because each individual has a different combination of alleles from the gene pool than the others. HLA, blood group, enzymes\... can also vary. When we have a stable gene pool over time , this means that a population is at genetic equilibrium. On the contrary, and change of allele frequency over time is called **evolution** ; and for that to happen , the population must have genetic polymorphism, because if the members were identical , no change will happen with time unless new alleles ( new members) were introduced to the population. **[Varying allele frequency in a population]** One or several factors can affect allele frequencies in a population such as non-random mating, mutation, gene flow or migration\... [A- Change in allele frequency due to migration] Migration of members of a population to another one of the same species causes the movement of alleles and genes flow between the two populations thus affecting the allele frequency and modulating the gene pool. Migration also causes the decrease of differences between the two populations if sufficient gene flow occurs. This is noticed between populations living in close areas. It is also to be noted that migration to isolated sites can also lead to the foundation of new populations. These populations may have new characteristics different from their mother populations due to environmental conditions of the new area/site. [B- Change in allele frequency due to natural selection] In a certain population, under certain conditions, some members will survive and some will not. Thus, the frequency of alleles changes in favor of those that help in survival. However, the non-favored alleles are not lost from the pool, but are retained in small proportions and this allows their re-increase if circumstances were better again. So, the **weeding out** of traits less adapted to the environment doesn\'t lead to the development of the perfect organism, but to the survival of the one best suited with the conditions and circumstances. **[Human populations]** Humans have phenotypic differences in so many traits ( skin color, hair color, facial features\...) And these were used to distinguish different human populations and even to discriminate between groups of individuals within a population or between populations. However some approaches are not objective and are frequently biased. But some traits can be used objectively to study populations like biological markers ( HLA, blood group, and enzyme typing). Such studies have shown that all human populations have common alleles and that no group of population has a \"unique\" set of alleles. Thus \"race\" is arbitrary and not based on scientific findings. So it\'s still a question if the difference is based on nature ( hereditary) or nurture ( environment). photo1690143367 IV. **[Human genetics]** Human genetics has widely progressed during the last decade and nowadays, the causes of most hereditary diseases are known. A couple wishing to have kids, can now evaluate the risks of abnormalities in their offsprings and even detect them in embryonic stage. **[Pedigree analysis ]** A pedigree determines the phenotype of ancestors and members of a family over several generations, and can thus determine if a certain gene is autosomal, sex linked , dominant or recessive. Knowing the frequency of a certain disease in a population, its mode of inheritance and the genotypes of the parents can help to evaluate the risk of appearance of a specific disease in the descendants. However a pedigree can only give assumptions, not certainties.  **[Autosomal abnormalities]** -When the allele carried by an autosome is dominant, it will be expressed in both homo and heterozygotes and in both boys and girls. A homozygous parent will definitely have an affected offspring, however a heterozygous parent has a 50% chance of having an affected child if the other parent is normal. photo1690143367 (2) \- When the allele is recessive, it will only be expressed in homozygous individuals both boys and girls. The homozygous parent surely transmits the disease to the offsprings, but it doesn\'t show on the offsprings if they receive the Normal allele from the other parent. If both parents are heterozygous, we will only have a 25% risk for the child to be affected by the disease.  **[Sex chromosome abnormalities]** Sex chromosomes X and Y have a homologous segment and a non-homologous segment. Genes on the homologous segment act like autosomal genes , and those on the non-homologous segment behave differently in both boys and girls In girls, the transmission of sex-linked alleles occur in the same manner as autosomal since a girl is (XX). So, the alleles exist is two copies on the X chromosomes, and their expression obey the law of dominant and recessive. In boys however (XY) , the sex-linked alleles exist in one copy. Alleles found on Y are only transmitted to boys. Alleles located on the non-homologous part of X are express in the boy offspring whether dominant or recessive. photo1690143367 (3) **[Prenatal diagnosis]** It allows us to determine accurately for a certain number of diseases is the fetus is normal. It can be done by aminocentesis, chronic villi sampling or fetal blood sampling. \- chromosomal analysis of the karyotype shoes structural and numerical chromosomal abnormalities, but cannot determine if a gene is mutated or not. Such abnormalities happen accidentally and affect both autosomes and sex chromosomes like Down syndrome ( trisomy 21) , turner syndrome (XO) , Klinefelter syndrome (XXX) and cri-du-chat ( deletion of part of the short arm of chromosome 5). Testing for chromosomal abnormalities is adviced for women above 35 yrs.  \- Biochemical analysis allows detection of abnormalities in protein synthesis. \- DNA analysis allows the detection of abnormalities in the nucleotide sequence of the gene. Today, it is impossible to treat congenital, hereditary or accidental abnormalities in a fetus. A couple can only choose therapeutic abortion. Gene therapy for some diseases , like dwarfism ( growth hormone therapy) is at experimental state. Abortion and gene therapy cause many bioethical problems. ***LET'S PRACTICE*** 1. **If a male is heterozygous for Huntingtons disease , marries a female who is heterozygous for this trait , what percent of their offsprings are likely to be heterozygous for this trait** A. 25% B-50% C-75% D-100% 2. **A mutation that can lead to premature chain termination** A. Frame shift mutation B. Silent mutation C. Mis-sense mutation D. Non-sense mutation 3. **In a dihybrid cross with linked genes, crossing-over occurs during meiosis, allowing the formation of gametes which are** A. Only parental B. identical C. Parental and recombinant D. Only recombinant 4. **If one of the parents died from lung cancer, this does not put the person at a greater risk than others whose parents did not develop cancer. Explain how cancer is a disease caused by mutations and yet not heritable** A. Mutations caused by environmental agents such as tobacco smoke cannot be inherited B. Mutations that cause cancer are special and cannot be passed on regardless of what type of cell they occur in C. Most cancers arise from mutations in germ cell line D. Most cancers arise from mutations in somatic cells 5. **Which of the following crosses would always result in offsprings that always display the dominant phenotype** A. TT×tt B. Tt× Tt C. TT× TT D. Both TT×tt and TT×TT 6. **according to the following pedigree , the original parents of this family had** photo1692528067 A. 3 daughters and 2 sons B. 2 daughters and 3 sons C. 2 daughters and 1 son D. 1 daughter and 2 sons 7. **Sexual reproduction favors** A. Genetic stability B. Highly successful species C. Beneficial recombination D. Genetic diversity 8. **Autosomal resessive diseases are transmitted from parents to offsprings. A diseased person can descend from the following matches except** A. Two homozygous parents B. One heterozygous and one homozygous C-two heterozygous D- one normal and another either heterozygous or homozygous 9. **What are homologous chromosomes** A. Two chromosomes with different sets of genes in the same sequence and same alleles B. Two chromosomes with same genes in different sequence but same alleles C. Two chromosomes with different genes , same sequence and different alleles D. Two chromosomes with same genes , same sequence and sometimes different alleles 10. **If you are provided with the following sequence of mRNA** **AGGGUAAUGACUGCCGAACAAGUCUAGACCGCU** **The number of amino acids in the formed protein will be** A. 6 B-8 C-9 D-11 **11- During final stage of cell division, the mitotic apparatus disappears, the chromosomes become attenuated,centrioles duplicate and split, nuclear membrane becomes reconstitued and nucleolus reappears. This phase of cell division known:** A. prophase B. metaphase C. telophase D. Anaphase **12-if the percentage of recombinant offsprings of 2 peas was 11 %. how far are those genes from each other on the chromosome:** A. 11cm B. 5.5 cmrg C. 11 cmrg D. 5.5 cm 13. **Which mutation cause the substitution of an amino acid:** A. Frame shift mutation B. Silent mutation C. Mis-sense mutation D. Non-sense mutation 14. **if you are given the following sequence of mRNA\ ACGAUGACCACUAUCACCGCCGACGAACAAUAGGCCAUC\ the number of amino acids in the formed protein will be:** A. 12 B. 9 C. 8 D. 10 15. **Sex cell production occurs by :** A. meiosis B. oncogenesis C. binary fission D. mitosis ANSWERS: B-D-C-A-D-C-D-D-D-A-C-C-C-B-A