CBSE Biology Class 12 Sample Paper 01 PDF

Summary

This is a sample paper for CBSE Biology class 12 for the 2025 exam. The paper includes multiple choice questions, short answer questions, and case study questions. Topics covered are likely to include reproductive health, biotechnology, and ecology.

Full Transcript

Marking Scheme links are given at end of this PDF. CBSE EXAM 2025 20 Sets Class : 12th Sub : Biology How to see answers or marking scheme ? Go to end of this PDF. Disclaimer: These papers are based on the SQP released by CBSE an...

Marking Scheme links are given at end of this PDF. CBSE EXAM 2025 20 Sets Class : 12th Sub : Biology How to see answers or marking scheme ? Go to end of this PDF. Disclaimer: These papers are based on the SQP released by CBSE and published by a private organization just for the practice of the students. CBSE has not released these papers and CBSE is not related to these papers in any manner. Publisher of these papers clearly state that these paeprs are only for practice of students and questions may not be come in main exam. Page 1 Sample Paper 01 CBSE Biology Class 12 Sample Paper 01 Class XII 2024-25 Biology (044) Time: 3 Hours Max. Marks: 70 General Instructions: 1. All questions are compulsory. 2. The question paper has five sections and 33 questions. All questions are compulsory. 3. Section—A has 16 questions of 1 mark each; Section—B has 5 questions of 2 marks each; Section—C has 7 questions of 3 marks each: Section—D has 2 case-based questions of 4 marks each; and Section—E has 3 questions of 5 marks each. 4. There is no overall choice. However, internal choices have been provided in some questions. A student has to attempt only one of the alternatives in such questions. 5. Wherever necessary, neat and properly labeled diagrams should be drawn. SECTION - A Q. No. 1 to 12 are multiple choice questions. Only one of the choices is correct. Select and write the correct choice as well as the answer to these questions. 1. Big holes in Swiss cheese are made by a (a) a machine (b) a bacterium that produces methane gas (c) a bacterium producing a large amount of carbon dioxide (d) a fungus that releases a lot of gases during its metabolic activities. 2. Which of the following approaches does not give the defined action of contraceptive? (a) Hormonal contraceptives Prevent/retard entry of sperms, prevent ovulation and fertilisation (b) Vasectomy Prevents spermatogenesis (c) Barrier methods Prevent fertilisation (d) Intra uterine devices Increase phagocytosis of sperms, suppress sperm motility and fertilising capacity of sperms 3. According to Darwin’s theory of natural selection, fitness refers to an organism’s ability to successfully reproduce and pass on its genes to the next generation. What does fitness primarily signify in this context? (a) The number of species in a community (b) The useful variation in population (c) The strength of an individual (d) The reproductive fitness of an organism. Continue on next page..... https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 2 Sample Paper 01 CBSE Biology Class 12 4. Study the following figures and identify the enzymes involved in steps I and II respectively. (a) EcoR I and DNA ligase (b) Hind II and DNA ligase (c) EcoR I and Hind II (d) Restriction endonuclease and exonuclease 5. Dr. Mehra is performing a gene cloning experiment using the pBR322 plasmid. She wants to insert a foreign gene into the tetracycline resistance gene (tetR) to create recombinant bacteria. To do this, she needs to select a restriction endonuclease that recognizes the site within the tetR gene to cut and insert the foreign gene.Which of the following restriction enzymes should Dr. Mehra use to successfully perform the insertion in the tetracycline resistance gene of pBR322? (a) Hind III (b) BamH I (c) EcoR I (d) Pst I 6. What is the correct sequence of sperm formation? (a) Spermatogonia, spermatozoa, spermatocytes, spermatids (b) Spermatogonia, spermatocytes, spermatids, spermatozoa (c) Spermatids, spermatocytes, spermatogonia, spermatozoa (d) Spermatogonia, spermatocytes, spermatozoa, spermatids 7. The biomass available for consumption to heterotrophs and the rate of formation of new organic matter by consumers are referred to as (a) gross primary productivity and net primary productivity respectively (b) net primary productivity and gross primary productivity respectively (c) gross primary productivity and secondary productivity respectively (d) net primary productivity and secondary productivity respectively. Continue on next page..... https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 3 Sample Paper 01 CBSE Biology Class 12 8. Refer to the given table of contrasting traits in pea plants studied by Mendel. Which of the given traits are incorrectly placed? (a) (i), (ii) and (iii) only (b) (ii), (iii) and (iv) only (c) (i) and (iv) only (d) (iii) only 9. Ernst Chain and Howard Florey’s contribution was (a) establishing the potential of penicillin as an effective antibiotic (b) discovery of streptokinase (c) production of genetically engineered insulin (d) discovery of DNA sequence 10. Along with nicotine, cigarette smokers also have the intake tars, phenols, hydrocarbons, arsenic and many other chemicals. Which of the following is not an effect of smoking tobacco? (a) Narrowing or hardening of blood vessels in the heart and brain (b) A higher frequency of respiratory infections (e.g., colds, pneumonia) (c) A higher risk of cancer, including cancer of the lungs, mouth, larynx, bladder and kidneys (d) None of these 11. What does the shape of the given age pyramids reflects about the growth status of the related population? (a) Expanding Stable (b) Stable Declining (c) Expanding Declining (d) Declining Stable https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 4 Sample Paper 01 CBSE Biology Class 12 12. Which of the following phenomena was experimentally proved by Meselson and Stahl? (a) Transformation (b) Transduction (c) Semi-conservative DNA replication (d) Central dogma Question No. 13 to 16 consist of two statements – Assertion (A) and Reason (R). Answer these questions selecting the appropriate option 13. Assertion : Offsite collections can be used to restock depleted populations, reintroduce species in the wild and restore degraded habitats. Reason : In situ conservation refers to the conservation of endangered species in their natural habitats. (a) Both A and R are true and R is the correct explanation of A. (b) Both A and R are true and R is not the correct explanation of A. (c) A is true but R is false. (d) A is false but R is true. 14. Assertion : The introduction of Nile perch in lake Victoria caused cichlids to become extinct. Reason : Nile perch is an indigenous species of East Africa. (a) Both A and R are true and R is the correct explanation of A. (b) Both A and R are true and R is not the correct explanation of A. (c) A is true but R is false. (d) A is false but R is true. 15. In the given diagram two plants of the same species depict different types of pollination indicated by the labellings P1, P2 and P3. Study this diagram and comment upon the appropriateness of the Assertion and Reason. Assertion : P1 is a type of self pollination. Reason : In P1, complete flower is pollinated by its own pollen. (a) Both A and R are true and R is the correct explanation of A. (b) Both A and R are true and R is not the correct explanation of A. (c) A is true but R is false. (d) A is false but R is true. 16. Assertion : Biodiversity hotspots are the regions which possess low levels of species richness, high degree of endemism and no loss to habitats. Reason : Total number of biodiversity hotspots in the world is 34 with three of these hotspots found in India. (a) Both A and R are true and R is the correct explanation of A. (b) Both A and R are true and R is not the correct explanation of A. (c) A is true but R is false. (d) A is false but R is true. Continue on next page..... https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 5 Sample Paper 01 CBSE Biology Class 12 SECTION - B 17. Write the relationship between productivity, gross primary productivity, net primary productivity and secondary productivity.  O State the difference between the first trophic levels of detritus food chain and grazing food chain. 18. Tallness of pea plant is a dominant trait, while dwarfness is the alternate recessive trait. When a pure-line tall is crossed with pure-line dwarf, what fraction of tall plant in F2 shall be heterozygous? Give reasons.  O What do you mean by Incomplete dominance? Explain with suitable example. 19. State the functions of the following in the cloning vector pBR322 : (i) ori (ii) rop 20. Refer to the given figure and answer the following questions. (i) Which of the labelled structures is a pre-birth structure and is not formed thereafter? (ii) Which of the labelled structures responds to LH surge by rupturing? 21. A young boy when brought a pet dog home started to complaint of watery eyes and running nose. The symptoms disappeared when the boy was kept away from the pet. (i) Name the type of antibody and the chemicals responsible for such a response in the boy. (ii) Mention the name of any one drug that could be given to the boy for immediate relief from such a response.  O Write down the difference between innate and acquired immunity Continue on next page..... https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 6 Sample Paper 01 CBSE Biology Class 12 SECTION - C 22. Name and describe any three causes of biodiversity losses. 23. (i) Can a plant flowering in Mumbai be pollinated by pollen grains of the same species growing in New Delhi? Provide explanations to your answer. (ii) Draw the diagram of a pistil where pollination has successfully occurred. Label the parts involved in transferring the male gametes to their desired destination. 24. (i) What do ‘Y’ and ‘B’ stand for in ‘YAC’ and ‘BAC’ used for DNA sequencing in Human Genome Project (HGP)? Mention their role in the project. (ii) Write the percentage of human genome that codes for proteins and the percentage of discovered genes whose functions are unknown. (iii) Expand `SNPs’ identified by scientists in HGP. 25. Explain the steps in the formation of an ovum from an oogonium in humans. 26. (i) Explain adaptive radiation with the help of a suitable example. (ii) Cite an example where more than one adaptive radiation have occurred in an isolated geographical area. Name the type of a evolution your example depict and state why it is so named. 27. (i) Explain the basis on which the gel electrophoresis technique works. (ii) Write any two ways by which products obtained through this technique can be utilised. 28. Why are lymph nodes and bone marrows called lymphoid organs? Explain the functions of each one. SECTION - D Question No. 29 and 30 are case based questions. Each question has subparts with internal choice in one subpart. 29. Acquired immunity is pathogen specific and characterised by memory. Whenever our body encounters a pathogen for the first time, it produces a response. Subsequent encounter with the same pathogen elicts a highly intensified secondary response. (i) Name the two lymphocytes which are responsible for acquired immunity. (ii) Identify the structure shown in the figure. https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 7 Sample Paper 01 CBSE Biology Class 12 (iii) It is generally observed that the children who had suffered from chicken-pox in their childhood may not contract the same disease in their adulthood. Explain giving reasons the basis of such an immunity in an individual. Name this kind of immunity.  O Differentiate between the two lymphocytes responsible for acquired immunity. 30. The process of copying genetic information from template strand of DNA into RNA is called transcription. It is mediated by RNA polymerase. Transcription takes place in the nucleus of eukaryotic cells. In transcription, only a segment of DNA and only one of the strands is copied into RNA. Transcription mainly consists of three steps. One of the steps of transcription is given below. (i) Identify the given step and name the labels B and C. (ii) What will happen if C is not available in the above process? (iii) What changes will take place in A after the completion of above process in eukaryotes?  O Briefly explain the previous step or given figure taking place in prokaryotes. SECTION - E 31. (i) Forelimbs of given animals have the same basic structural plan. Such organs have similar developmental pattern and they develop in related organisms, but these do differ morphologically. What type of evolution and structure is exhibited by the organisms given in the figure. (ii) (a) Differentiate between analogy and homology giving one example each of plant and animal. (b) How analogy and homology considered as an evidence in support of evolution? https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 8 Sample Paper 01 CBSE Biology Class 12  O Refer to the given information regarding human evolution given below and answer the following questions. The fossil evidence clearly indicates that origin of man occured in Central Asia. About 15 mya, primates called Dryopithecus and Ramapithecus were existing. Among the stories of evolution, the story of evolution of modern man appears to parallel evolution of human brain and their charactristics development. (i) Where did Australopithecus evolve? (ii) Write the scientific name of Java man. (iii) Name the first human like hominid. Mention his food habit and brain capacity. (iv) Write the characteristics of Ramapithecus and Neanderthal man. 32. Describe the roles of pituitary and ovarian hormones during the menstrual cycle in a human female.  O (i) Trace the development of megaspore mother cell up to the formation of a mature embryo sac in a flowering plant. (ii) Draw a labelled diagram of the structure of mature dicot embryo. 33. (i) What is EcoRI? How does EcoRI differ from an exonuclease? (ii) EcoRI is used to cut a segment of foreign DNA and that of a vector DNA to form a recombinant DNA. Show with the help of schematic diagrams. (a) The set of palindromic nucleotide sequence of base pairs the EcoRI will recognise in both the DNA segments. Mark the site at which EcoRI will act and cut both the segments. (b) Sticky ends formed on both the segments where the two DNA segments will join later to form a recombinant DNA.  O (i) (a) Identify A and B illustrations in the following: (b) Write the term given to A and C and why? (ii) (a) Expand PCR. Mention its importance in biotechnology. (b) Describe the roles of heat, primers and the bacterium Thermus aquaticus in the process of PCR.  ****** https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 1 Sample Paper 02 CBSE Biology Class 12 Sample Paper 02 Class XII 2024-25 Biology (044) Time: 3 Hours Max. Marks: 70 General Instructions: 1. All questions are compulsory. 2. The question paper has five sections and 33 questions. All questions are compulsory. 3. Section—A has 16 questions of 1 mark each; Section—B has 5 questions of 2 marks each; Section—C has 7 questions of 3 marks each: Section—D has 2 case-based questions of 4 marks each; and Section—E has 3 questions of 5 marks each. 4. There is no overall choice. However, internal choices have been provided in some questions. A student has to attempt only one of the alternatives in such questions. 5. Wherever necessary, neat and properly labeled diagrams should be drawn. SECTION - A Q. No. 1 to 12 are multiple choice questions. Only one of the choices is correct. Select and write the correct choice as well as the answer to these questions. 1. Identify A, B, C and D in the flow chart given below that represents the process of recombinant (a) A-Restriction endonuclease, B-Restriction exonuclease, C-DNA ligase, D-Transformation (b) A-Restriction endonuclease, B-Restriction endonuclease, C-DNA ligase, D-Transformation (c) A-Restriction endonuclease, B-Restriction endonuclease, C-Hydrolase, D-Transformation (d) A-Restriction endonuclease, B.-Restriction endonuclease, C-Hydrolase, D-Transduction 2. The permissible use of the technique amniocentesis is for (a) detecting sex of the unborn fetus (b) artificial insemination (c) transfer of embryo into the uterus of a surrogate mother (d) detecting any genetic abnormality https://qrbook.page.link/appInstall NODIA App to See the Solutions. Click Here To Install Page 2 Sample Paper 02 CBSE Biology Class 12 3. The age pyramid with broad base indicates (a) high percentage of old individuals (b) low percentage of young individuals (c) a stable population (d) high percentage of young individuals 4. Two closely related different species cannot live for long duration in the same niche or habitat. This law is called (a) Allen’s law (b) Gloger rule (c) Competitive exclusion principle (d) Weismann’s theory 5. The primary producers of the deep-sea hydrothermal vent ecosystem are (a) green algae (b) chemosynthetic bacteria (c) blue-green algae (d) coral reefs 6. Match column I with column II and select the correct option from the given codes. Column I Column II A. Dihybrid test cross (i) 9:3:3:1 B. Law of segregation (ii) Dihybrid cross C. Law of independent assortment (iii) 1:1:1:1 D. ABO blood group in man (iv) Purity of gametes (v) Multiple allelism (a) A-(iii), B-(iv), C-(ii), D-(v) (b) A-(i), B-(iv), C-(ii), D-(v) (c) A-(iii), B-(ii), C-(iv), D-(v) (d) A-(ii), B-(v), C-(iii), D-(i) 7. Statin, a blood-cholesterol lowering agent, is commercially obtained from (a) Trichoderma polysporum (b) Acetobacter aceti (c) Clostridium butyricum (d) Monascus purpureus 8. A sewage treatment process in which a part of decomposer bacteria present in the wastes is recycled into the starting of the process is called (a) primary treatment (b) activated sludge treatment (c) tertiary treatment (d) none of these. 9. Find the correct palindromic sequence for the given DNA segment. 5l ATTGCAAT 3l (a) 5l GAACGTTA 3l (b) 3l TAACGTTA 5l (c) 5l AAACGTTT 3l (d) 3l ATTGCAAT 5l 10. The term ‘immunity’ refers to (a) mutualism between host and parasite (b) ability of the host to fight the disease causing organisms (c) ability of the parasite to survive within a host (d) a fatal disease 11. Productivity at the second trophic level is always (a) greater than the productivity at the first trophic level (b) less than the productivity at the first trophic level (c) equal to the productivity at the first trophic level (d) extremely variable compared to the productivity at the first trophic level. https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 3 Sample Paper 02 CBSE Biology Class 12 12. Refer to the given table of contrasting traits in pea plants studied by Mendel. Which of the given traits is correctly placed? (a) (i), (ii) and (iii) only (b) (ii), (iii) and (iv) only (c) (ii) and (iii) only (d) (i), (ii), (iii) and (iv) 13. Assertion : Production ecology deals with the productivity. Reason : Desert has lowest productivity. (a) Both A and R are true and R is the correct explanation of A. (b) Both A and R are true and R is not the correct explanation of A. (c) A is true but R is false. (d) A is false but R is true. 14. Assertion : The endometrium undergoes cyclical changes during menstrual cycle. Reason : The myometrium exhibits strong contractions during delivery of the baby. (a) Both A and R are true and R is the correct explanation of A. (b) Both A and R are true and R is not the correct explanation of A. (c) A is true but R is false. (d) A is false but R is true. 15. Given below is the karyotype of a patient. It depicts the arrangement of different sets of chromosome arranged in numerical order. It is basically used to look for abnormalities in chromosome number or structure. Study the given karyotype and comment upon the appropriateness of the Assertion and the Reason. https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 4 Sample Paper 02 CBSE Biology Class 12 Assertion : The given karyotype shows that patient is suffering from Down’s syndrome. Reason : In patient, the chromosome abnormality is caused due to the absence of one of the sex chromosomes, i.e., 45 + X. (a) Both A and R are true and R is the correct explanation of A. (b) Both A and R are true and R is not the correct explanation of A. (c) A is true but R is false. (d) A is false but R is true. 16. Assertion : The development of embryo sac from a single functional megaspore is termed as monosporic development. Reason : In monosporic (Polygonum) type of embryo sac development, usually the megaspore which is situated towards micropylar end remains functional. (a) Both A and R are true and R is the correct explanation of A. (b) Both A and R are true and R is not the correct explanation of A. (c) A is true but R is false. (d) A is false but R is true. SECTION - B 17. Describe the process of megasporogenesis in angiosperms until 8 nucleate stage.  O Differentiate between Perisperm and Pericarp 18. Two different types of population growth curves are used to measure population density. Study the two growth curves and answer the corresponding question. https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 5 Sample Paper 02 CBSE Biology Class 12 A forest having unlimited food resource hardly has any carnivores. Identify the curve that will explain the population growth of herbivores in that forest. Also give the equation representing the graph. 19. Read the graph given above and correlate the uterine events that take place according to the hormonal levels on (i) 6-15 days (ii) 16-25 days (iii) 26-28 days (if the ovum is not fertilised) (iv) Specify the sources of the hormones mentioned in the graph.  O Draw a sectional view of human ovary. Label the following parts : (i) Primary follicle (ii) Ovum (iii) Graafian follicle (iv) Corpus luteum 20. How does EcoRI specifically act on DNA molecule? Explain. 21. What do oral pills contain and how do they act as effective contraceptives?  O When is sterilisation technique advised to married couples? How is it carried out in a human male and a female, respectively? Section C 22. “Australian marsupials exhibit adaptive radiation but they along with placental mammals show convergent evolution”. Justify the statement. 23. (i) What makes some viruses cause cancer in humans? (ii) How do benign tumors turn malignant? How does the latter harm the human body? 24. (i) What are the transcriptional products of RNA polymerase III? (ii) Differentiate between capping and tailing. (iii) Expand hnRNA. Continue on next page..... https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 6 Sample Paper 02 CBSE Biology Class 12 25. (i) Explain parasitism with the help of one example. (ii) State Gause’s competitive exclusion principle. 26. State the role of thymus as a lymphoid organ. Name the cells that are released from it and mention their function. 27. Work out a cross upto F2 generation between two pure breed pea plants, one bearing purple flowers and the other white flowers. 28. (i) Mention the cause of ADA deficiency in humans. (ii) How is gene therapy carried out to treat the patients suffering from this disease? (iii) State the possibility of a permanent cure of this disease. SECTION - D Question No. 29 and 30 are case based questions. Each question has subparts with internal choice in one subpart. 29. BOD is a measure of organic matter present in the water. The data below shows the concentration of BOD in different samples obtained from the primary effluent, secondary effluent, untreated sewage and river water. (i) With reference to the above graph, identify the source of different samples A, B, C and D. (ii) What would happen if D is disposed off in B directly? (iii) Which among the given samples will contain large number of pathogenic microbes?  O What would be the reason for the higher value of BOD in sample D? Continue on next page..... https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 7 Sample Paper 02 CBSE Biology Class 12 30. From a number of studies on the metabolism of bacterium Escherichia coli, two French scientists Jacob and Monod in 1961 found that the genetic material possesses regulated gene units called operons. Study the given below operon system operating in E.coli and answer the questions that follow: (i) On the basis of the given operon system, what conclusion can you draw about case I and case II? (ii) What would happen in the presence of X in case II? (iii) What type of regulation can be seen in the given operon system by the repressor?  O Which structural gene codes for permease in both the cases and what is its function? SECTION - E 31. A large number of married couples over the world are childless. It is shocking to know that in India the female partner is often blamed for the couple being childless. (i) Why in your opinion the female partner is often blamed for such situations in India? Is it correct? Justify. (ii) State any two reasons responsible for the cause of infertility. (iii) “Intra-Cytoplasmic Sperm Injection” and ‘Gamete Intra Fallopian Transfer’ are two assisted reproductive technologies. How is one different from other?  O (i) Arrange the following hormones in sequence of their secretion in a pregnant woman. hCG; LH; FSH; Relaxin (ii) Mention their source and the function they perform. Continue on next page..... https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 8 Sample Paper 02 CBSE Biology Class 12 32. Some restriction enzymes break a phosphodiester bond on both the DNA strands, such that only one end of each molecule is cut and these ends have regions of single stranded DNA. BamHI is one such restriction enzyme which binds at the recognition sequence, 5l -GGATCC- 3l and cleaves these sequences just after the 5l - guanine on each strand. (i) What is the objective of this action? (ii) Explain how the gene of interest is introduced into a vector. (iii) You are given the DNA shown below. 5l ATTTTGAGGATCCGTAATGTCCT 3l 3l TAAAACTCCTAGGCATTACAGGA 5l If this DNA was cut with BamHI, how many DNA fragments would you expect? Write the sequence of these double-stranded DNA fragments with their respective polarity. (iv) A gene M was introduced into E.coli cloning vector pBR322 at BamHI site. What will be its impact on the recombinant plasmids? Give a possible way by which you could differentiate non-recombinant from recombinant plasmids.  O (i) Write the palindromic nucleotide for the following DNA segment : 5l -GAATTC- 3l (ii) Name the restriction endonuclease that recognises this sequence. (iii) How are ‘sticky-ends’ produced? Mention their role. 33. (i) Dihybrid cross between two garden pea plants one homozygous tall with round seeds and the other dwarf with wrinkled seeds was carried. (a) Write the genotype and phenotype of the F1 progeny obtained from this cross. (b) Give the different types of gametes of the F1 progeny. (c) Write the phenotypes and its ratios of the F2 generation obtained in this cross along with the explanation provided by Mendel. (ii) How were the observations of F2 progeny of dihybrid crosses in Drosophila by Morgan different from that of Mendel carried in pea plants? Explain giving reasons.  O How do “pleiotropy”, “incomplete dominance”, “co-dominance” and “polygenic inheritance” deviate from the observation made by Mendel? Explain with the help of one example for each.  ****** https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 1 Sample Paper 03 CBSE Biology Class 12 Sample Paper 03 Class XII 2024-25 Biology (044) Time: 3 Hours Max. Marks: 70 General Instructions: 1. All questions are compulsory. 2. The question paper has five sections and 33 questions. All questions are compulsory. 3. Section—A has 16 questions of 1 mark each; Section—B has 5 questions of 2 marks each; Section—C has 7 questions of 3 marks each: Section—D has 2 case-based questions of 4 marks each; and Section—E has 3 questions of 5 marks each. 4. There is no overall choice. However, internal choices have been provided in some questions. A student has to attempt only one of the alternatives in such questions. 5. Wherever necessary, neat and properly labeled diagrams should be drawn. SECTION - A Q. No. 1 to 12 are multiple choice questions. Only one of the choices is correct. Select and write the correct choice as well as the answer to these questions. 1. When a natural predator (living organism) is applied on the other pathogen organisms to control them, this process is called (a) biological control (b) genetic engineering (c) artificial control (d) confusion technique 2. Percentage of photosynthetically active radiation (PAR) in the incident solar radiation is (a) 1 - 5% (b) 2 - 10% (c) less than 50% (d) approx. 100% 3. Mendel formulated the law of purity of gametes on the basis of (a) monohybrid cross (b) dihybrid cross (c) test cross (d) back cross 4. Study the given figure carefully and select the incorrect statements regarding this. (i) It represents a typical agarose gel electrophoresis in which lane 1 contains undigested DNA. (ii) Smallest DNA bands are formed at A and largest DNA bands are formed at B. https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 2 Sample Paper 03 CBSE Biology Class 12 (iii) The separated DNA fragments can be visualised after staining in the visible light. (iv) The separated DNA bands are cut out from the agarose gel and extracted from the gel piece. This step is known as elution. (a) (i) and (ii) (b) (ii) and (iii) (c) (ii) and (iv) (d) (i) and (iv) 5. In fruit flies, long wing is dominant to vestigial wing. When heterozygous long-winged flies were crossed with vestigial-winged flies, 192 offsprings were produced. If an exact Mendelian ratio had been obtained, then the number of each phenotype would have been Long-winged Vestigial-winged (a) 64 128 (b) 96 96 (c) 128 64 (d) 192 0 6. During the life cycle of Plasmodium, sexual reproduction takes place in which of the following hosts? (a) Human (b) Female Anopheles mosquito (c) Male Anopheles mosquito (d) Both (a) and (b) 7. A population has more young individuals compared to the older individuals. What would be the status of the population after some years? (a) It will decline. (b) It will stabilise. (c) It will increase. (d) It will first decline and then stabilise. 8. Which one of the following is a population ? (a) A spider and some trapped flies in its web. (b) Earthworm that lives in a grassland along with other arthropods. (c) All the plants in a forest. (d) All the oak trees in a forest. 9. Embryo with more than 16 blastomeres formed due to in vitro fertilisation is transferred into (a) uterus (b) fallopian tube (c) fimbriae (d) cervix. 10. A foreign DNA and plasmid cut by the same restriction endonuclease can be joined to form a recombinant plasmid using (a) EcoR I (b) Taq polymerase (c) DNA polymerase III (d) ligase 11. If the energy produced at the level of the producers is 1000 J, the energy available for the secondary consumers is (a) 1000 J (b) 100 J (c) 10 J (d) 1 J Continue on next page..... https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 3 Sample Paper 03 CBSE Biology Class 12 12. Identify the blank spaces A, B, C and D in the given table and select the correct option. Type of microbe Scientific name Product Medical application Fungus A Cyclosporin A B C Monascus Purpureus Statin D (a) A-Trichoderma polysporum, B-As an immunosuppressive agent, C-Yeast (Fungus), D-Lowering of blood cholesterol (b) A-Trichoderma polysporum, B-Lowering of blood cholesterol, C-Yeast (Fungus), D-As an immunosuppressive agent (c) A-Penicillium notatum, B-Lowering of blood cholesterol, C-Bacteria, D-As an immunosuppressive agent (d) A-Streptococcus, B-As an immunosuppressive agent, C-Bacterium, D-Lowering of blood cholesterol 13. Assertion : There are 32 biodiversity hotspots in the world. Reason : High level of species richness is a criteria for selection of a biodiversity hotspot. (a) Both A and R are true and R is the correct explanation of A. (b) Both A and R are true and R is not the correct explanation of A. (c) A is true but R is false. (d) A is false but R is true. 14. Given below is the representation of the DNA fingerprinting depicting the amplified repeats separated by size using gel electrophoresis. Study the given picture and comment upon the appropriateness of the Assertion and Reason. Assertion : It shows that individual B commits the crime. Reason : The banding pattern of DNA from crime scene (C) matches with individual B rather than A. (a) Both A and R are true and R is the correct explanation of A. (b) Both A and R are true and R is not the correct explanation of A. (c) A is true but R is false. (d) A is false but R is true. 15. Assertion : Only the pre-pollination growth of male gametophyte occurs inside the microsporangium whereas the remaining growth occurs over the female reproductive organs. Reason : Whole of the growth of female gametophyte occurs inside the megasporangium. (a) Both A and R are true and R is the correct explanation of A. (b) Both A and R are true and R is not the correct explanation of A. (c) A is true but R is false. (d) A is false but R is true. https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 4 Sample Paper 03 CBSE Biology Class 12 16. Assertion : The regions outside the seminiferous tubules are called interstitial spaces, which contain Leydig’s cells. Reason : Leydig’s cells synthesise and secrete testicular hormones called androgens. (a) Both A and R are true and R is the correct explanation of A. (b) Both A and R are true and R is not the correct explanation of A. (c) A is true but R is false. (d) A is false but R is true. SECTION - B 17. (i) What is biopiracy? (ii) State the initiative taken by the Indian parliament against it.  O What is micro propagation? What are the advantages of producing plants through this technique. 18. Explain why it is scientifically incorrect to blame the mother for bearing female child. 19. Why is fertilisation in an angiosperm referred to as double fertilisation? Mention the ploidy of the cells involved. 20. (i) Name the scientist who suggested that the genetic code should be made of a combination of three nucleotides. (ii) Explain the basis on which he arrived at this conclusion. 21. (i) Mention the significant role of the thymus as a lymphoid organ. (ii) What kind of cells are released from thymus and how they help in immunity? SECTION - C 22. Explain the work carried out by Cohen and Boyer that contributed immensely in biotechnology. 23. Study the age pyramids ‘A, ‘B’ and ‘C’ of the human population given below and answer the questions that follow : (i) Identify pyramids ‘B’ and ‘C’. (ii) Write the basis on which the above pyramids are plotted.  O Draw and explain expanding age pyramid of human population. Why is it so called? Continue on next page..... https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 5 Sample Paper 03 CBSE Biology Class 12 24. With reference to the following schematic diagram of (i) Spermatogenesis and (ii) Oogenesis, answer the following questions. (i) (ii) (i) About 300 million spermatozoa may be present in a human male ejaculation at one time. Calculate how many primary spermatocytes will be involved to produce this number of spermatozoa. (ii) How many spermatids will be formed? (iii) How many chromatids are found during oogenesis in primary oocyte and first polar body in a human female? 25. Differentiate between homology and analogy. Give one example of each. 26. (i) Identify the structure shown below. (ii) Mention the difference in the synthesis based on the polarity of the two template strands. https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 6 Sample Paper 03 CBSE Biology Class 12 27. Large quantities of sewage is generated everyday in cities and towns, which is treated in Sewage Treatment Plants (STPs) to make it less polluted. Given below is the flow chart of one of the stages of STP. Observe the given flow chart and answer the questions accordingly. (i) Why primary effluent is passed into large aeration tanks? (ii) Write the technical term used for the sediment formed? Mention its significance. (iii) Explain the final step that results in the formation of biogas in the large tank before the treated effluent is released into water bodies. 28. How is detritus decomposed step-by-step by different agents and made available as nutrients to the plants? Explain.  O (i) Describe the events during humification and mineralisation during decomposition in the soil. (ii) Enlist the conditions affecting the rate of decomposition. SECTION - D Question No. 29 and 30 are case based questions. Each question has subparts with internal choice in one subpart. 29. The data below shows the concentration of nicotine smoked by a smoker taking 10 puffs/ minute. (i) With reference to the above graph explain the concentration of nicotine in blood at 10 minutes. (ii) How will this affect the concentration of carbon monoxide and haembound oxygen at 10 minutes? (iii) How does cigarette smoking result in high blood pressure and increase in heart rate?  O How does cigarette smoking result in lung cancer and emphysema? Continue on next page..... https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 7 Sample Paper 03 CBSE Biology Class 12 30. A geneticist crosses round yellow seeded pea plant to wrinkled green seeded pea plant and observed the inheritance of both traits as per the following pattern. He collected total 1600 seeds in F2 generation. (i) What would be the total number of seeds that are homogenous for yellow colour and heterogenous for round seed shape? (ii) What phenotypic ratio would be obtained if the plants of F1 generation would be crossed with homogenous wrinkled green seeded plant? (iii) How many seeds would be homogenous for wrinkled yellow and wrinkled green?  O Explain the “law of independent assortment” according to the given dihybrid cross. SECTION - E 31. Refer to the given diagram that shows the human male reproductive system (one side only). https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 8 Sample Paper 03 CBSE Biology Class 12 (i) Identify ‘X’ and write its location in the body. (ii) Name the accessory gland ‘Y’ and its secretion. (iii) Name and state the function of ‘Z’.  O Draw a sectional view of human ovary and label the following parts: (a) Primary follicle (b) Secondary oocyte (c) Graafian follicle (d) Corpus luteum (ii) Name the hormones influencing follicular development of corpus luteum. 32. Answer the following questions regarding origin of life. (i) Who proposed Modern theory of origin of life? (ii) Which compound was formed in S. Miller’s dassic experiment of origin of life? (iii) Which compound was absent in primitive atmosphere? (iv) Name two views of the modern theory of origin of life.  O (i) How do the observations made during moth collection in pre- and post-industrialised era in England support evolution by natural selection? (ii) Explain the phenomenon that is well represented by Darwin’s finches other than natural selection. 33. Describe the role of heat, primers and the bacterium Therm us aquaticus in the process of PCR.  O Why is a recombinant protein so called? How can it be harvested on a large scale? Write two precautions to maintain a higher yield.  ****** https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 1 Sample Paper 04 CBSE Biology Class 12 Sample Paper 04 Class XII 2024-25 Biology (044) Time: 3 Hours Max. Marks: 70 General Instructions: 1. All questions are compulsory. 2. The question paper has five sections and 33 questions. All questions are compulsory. 3. Section—A has 16 questions of 1 mark each; Section—B has 5 questions of 2 marks each; Section—C has 7 questions of 3 marks each: Section—D has 2 case-based questions of 4 marks each; and Section—E has 3 questions of 5 marks each. 4. There is no overall choice. However, internal choices have been provided in some questions. A student has to attempt only one of the alternatives in such questions. 5. Wherever necessary, neat and properly labeled diagrams should be drawn. SECTION - A Q. No. 1 to 12 are multiple choice questions. Only one of the choices is correct. Select and write the correct choice as well as the answer to these questions. 1. Which type of pyramid is always upright? (a) Number (b) Biomass (c) Weight (d) Energy 2. Rate of decomposition depends upon (a) chemical composition of detritus (b) temperature (c) soil moisture and soil pH (d) all of these 3. The given flow chart depicts the steps to transfer a desirable gene of interest into a plant. Isolation of desirable gene using restriction endonucleases and gel electrophoresis https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 2 Sample Paper 04 CBSE Biology Class 12 Identify the missing steps (A, B and C) with regard to following statements and select the correct option. (i) Joining of desirable gene to a suitable cloning vector using ligases to create a recombinant DNA molecule. (ii) Selection of transformed cells. (iii) Transferring the recombinant DNA molecules to the target cells. A B C (a) (i) (ii) (iii) (b) (i) (iii) (ii) (c) (ii) (iii) (i) (d) (iii) (i) (ii) 4. If a recombinant DNA bearing gene for resistance to antibiotic ampicillin is transferred to E.coli cells, the host cells become transformed into ampicillin resistant cells. If such bacteria are transferred on agar plates containing ampicillin, only transformants will gmw and the untransformed recipient cells will die. The ampicillin resistant gene in this case is called as (a) selectable marker (b) recombinant protein (c) cloning site (d) chemical scalpels 5. Which of the following factors has a negative effect on the population growth rate? (a) Emigration (b) Immigration (c) Natality (d) Both (b) and (c) 6. Single step large mutation leading to speciation is called (a) founder effect (b) saltation (c) branching descent (d) natural selection 7. Which of the following diseases are treated by antibiotics? (i) Plague (ii) Diphtheria (iii) Leprosy (iv) Whooping cough (a) (i), (ii) and (iii) (b) (i), (iii) and (iv) (c) (ii), (iii) and (iv) (d) (i), (ii), (iii) and (iv) 8. In which organ does the sexual stage (gametocytes) of Plasmodium form? (a) Salivary glands of mosquito (b) Human RBC (c) Intestine of mosquito (d) Human liver 9. Tubectomy is a method of sterilisation in which (a) small part of the fallopian tube is removed or tied up (b) ovaries are removed surgically (c) small part of vas deferens is removed or tied up (d) uterus is removed surgically 10. Match column I with column II and select the correct option from the codes given below. Column I Column II A. Mutation (i) Change in allele frequency in a population due to chance alone B. Gene flow (ii) Differences in survival and reproduction among variant individuals C. Natural selection (iii) Immigration, emigration change allele frequencies D. Genetic drift (iv) Random and directionless (a) A-(i), B-(ii), C-(iii), D-(iv) (b) A-(iv), B-(ii), C-(iii), D-(i) (c) A-(iii), B-(i), C-(iv), D-(ii) (d) A-(iv), B-(iii), C-(ii), D-(i) https://qrbook.page.link/appInstall NODIA App to See the Solutions. Click Here To Install Page 3 Sample Paper 04 CBSE Biology Class 12 11. ‘Verhulst - Pearl’ is associated with the equation dN = b K − N l dN = b K − N l (a) dt rN K (b) dt tN N dN = b K − N l dN = b K − N l (c) dt rN N (d) dt tN K 12. Match column I with column II and select the correct option from the codes given below. Column I Column II A. Statins (i) Methanobacterium B. Biogas (ii) Saccharomyces cerevisiae C. Ethanol production (iii) Monascus purpureus D. Converts milk to curd (iv) Lactobacillus (a) A-(iii), B-(i), C-(iv), D-(ii) (b) A-(i), B-(iii), C-(iv), D-(ii) (c) A-(iii), B-(ii), C-(iv),D-(i) (d) A-(iii), B-(i), C-(ii), D-(iv) 13. Assertion : Tropical regions have got a long evolutionary time for species diversification as compared to temperate regions. Reason : Temperate regions have undergone frequent glaciations in the past whereas tropical regions have remained relatively undisturbed for millions of years. (a) Both A and R are true and R is the correct explanation of A. (b) Both A and R are true and R is not the correct explanation of A. (c) A is true but R is false. (d) A is false but R is true. 14. Assertion : Myometrium is an important component of uterus. Reason : Myometrium produces strong contractions during parturition. (a) Both A and R are true and R is the correct explanation of A. (b) Both A and R are true and R is not the correct explanation of A. (c) A is true but R is false. (d) A is false but R is true. 15. Assertion : Water constitutes a major mode of pollination in most of the aquatic angiospermous plants. Reason : Vallisneria and Zostera are examples of water pollinated plants. (a) Both A and R are true and R is the correct explanation of A. (b) Both A and R are true and R is not the correct explanation of A. (c) A is true but R is false. (d) A is false but R is true. 16. Given below is the monohybrid cross. It depicts the cross between the red flower and white flower colour in the Antirrhinum sp. Study this monohybrid cross and comment upon the appropriateness of the Assertion and Reason. https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 4 Sample Paper 04 CBSE Biology Class 12 Assertion : It shows the incomplete dominance. Reason : The F2 generation of Antirrhinum shows different phenotypic and genotypic ratio. (a) Both A and R are true and R is the correct explanation of A. (b) Both A and R are true and R is not the correct explanation of A. (c) A is true but R is false. (d) A is false but R is true. SECTION - B 17. Draw a diagram of the structure of a human ovum surrounded by corona radiata. Label the following parts : (i) Ovum (ii) Plasma membrane (iii) Zona pellucida  O What is the function of corpus luteum ? 18. Principle of vaccination is based on the property of “memory” of the immune system. Taking one suitable example, justify the statement. 19. Study the graph given below and answer the questions that follows: The curve ‘b’ is described by the following equation: dN = K−N dt rN & K 0 What does ‘K’ stand for in this equation? Mention its significance.  O Which curve represent the human population growth at present? Do you think such a curve is sustainable? Give reason in support of your answer. 20. Why is making cells competent essential for biotechnology experiments? List any two ways by which this can be achieved. Continue on next page..... https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 5 Sample Paper 04 CBSE Biology Class 12 21. Given figure shows karyotype of a child who is suffering from a sex chromosomal abnormality which occurs during failure of segregation of chromatids during cell division cycle. This results in the gain or loss of a chromosome (s), called aneuploidy. (i) Identify the disease from the given karyotype. (ii) Mention the diagnostic features of this disease. SECTION - C 22. Mention any six differences between active immunity and passive immunity. 23. The following figure shows a fetus within the uterus. On the basis of the given figure, answer the questions that follow: (i) Mention the role of B in the development of the embryo. (ii) Name the fluid surrounding the developing embryo. (iii) Identify A. https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 6 Sample Paper 04 CBSE Biology Class 12 24. (i) Explain the cause responsible in a human to have sex chromosomes as XXY instead of ‘XX’ or ‘XY’. (ii) List any two ways such individuals are different from the normal being. 25. (i) How is placenta formed in the human female? (ii) Name any two hormones which are secreted by it and are also present in a non-pregnant woman. 26. State a functional difference between the following. (i) AUG and UAA (ii) Specific and Degenerate 27. (i) How has the development of bioreactor helped in biotechnology? (ii) Name the most commonly used bioreactor and describe its working. 28. Taking one example each of habitat loss and fragmentation, explain how are the two responsible for biodiversity loss.  O Several factors possess threats to indigenous species of a particular area. Introduction of alien species is one such threat. Justify it with few examples. SECTION - D Question No. 29 and 30 are case based questions. Each question has subparts with internal choice in one subpart. 29. Study the two cases carefully regarding the pattern of inheritance of disease. Case Mother Father Children Case I With disease Normal Sons always with diseases Case II With disease Normal Sons and daughters could show disease (i) Give two examples of case I diseases. (ii) On which chromosome case I diseases are present on? (iii) If inheritance pattern of disease is as case II and both parents are carrier of disease then what are the chances of pregnancy resulting in an affected child?  O The possibility of a human female suffering from a hemophilia disease is rare. Why is it so? 30. Refer to the given figure of antibody and answer the following questions. https://qrbook.page.link/appInstall NODIA App to See the Solutions. Click Here To Install Page 7 Sample Paper 04 CBSE Biology Class 12 (i) Identify a, b and c in the given diagram. (ii) Write the chemical nature of an antibody. (iii) Mention the type of immune response provided by an antibody.  O Name the cells that produce antibodies in humans. SECTION - E 31. According to Chargaff, almost all DNA-no matter what organism or tissue type it comes from maintains certain properties, even as its composition varies. In particular, the amount of adenine (A) is usually similar to the amount of thymine (T) and the amount of guanine (G) usually approximates the amount of cytosine (C). (i) A sample of DNA having 5375 nucleotides was analysed, out of which the propagation of different bases were : Adenine = 33%, Guanine 18%, Cytosine = 33%, Thymine = 17%. What can be concluded from this data? (ii) If one strand of DNA has the following percentage. A = 26%, T = 23%, C = 24%, G = 27% What percentage will be found in the complementary strand? (iii) If a sample of DNA has a cytosine content of 26%, what proportion of thymine do you expect?  O Pea seeds with BB alleles have round seeds and large starch grains, while seeds with bb alleles have wrinkled seeds with small starch grains. Work out the cross between these two parents. Explain the phenotypic ratio of the progeny with respect to seed shape and the starch grain size of the progeny produced. 32. Can you think and answer how a reporter enzyme can be used to monitor transformation of host cells by foreign DNA in addition to a selectable marker?  O Explain the application of rDNA technology to produce insulin with diagram. Explain the difference between humulin and insulin produced by rRNA technology. 33. Refer to the following diagram and answer the following questions: https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 8 Sample Paper 04 CBSE Biology Class 12 (i) Identify D and E. (ii) How is the sperm able to penetrate inside the ovum? (iii) Where exactly in the Fallopian tube does this occur? (iv) Explain the events thereafter upto morula stage.  O Given below is an enlarged view of one microsporangium of a mature anther. (i) Name ‘a’ , ‘b’ and ‘c’ wall layers. (ii) Mention the characteristics and function of the cell wall forming wall layer ‘c’. (iii) An anther with malfunctioning layer ‘c’ often fails to produce viable male gametophytes. Give reason.  ****** https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 1 Sample Paper 05 CBSE Biology Class 12 Sample Paper 05 Class XII 2024-25 Biology (044) Time: 3 Hours Max. Marks: 70 General Instructions: 1. All questions are compulsory. 2. The question paper has five sections and 33 questions. All questions are compulsory. 3. Section—A has 16 questions of 1 mark each; Section—B has 5 questions of 2 marks each; Section—C has 7 questions of 3 marks each: Section—D has 2 case-based questions of 4 marks each; and Section—E has 3 questions of 5 marks each. 4. There is no overall choice. However, internal choices have been provided in some questions. A student has to attempt only one of the alternatives in such questions. 5. Wherever necessary, neat and properly labeled diagrams should be drawn. SECTION - A Q. No. 1 to 12 are multiple choice questions. Only one of the choices is correct. Select and write the correct choice as well as the answer to these questions. 1. Identify the incorrect pair from the following with respect to angiosperms. (a) Primary endosperm nucleus-3n (b) Antipodals-2n (c) Cells of nucellus of ovule-2n (d) Vegetative cell of male gametophyte-n 2. The structure in chromatin seen as ‘beads-on string’ when viewed under electron microscope are called (a) nucleotides (b) nucleosides (c) histone octamer (d) nucleosomes 3. In a given population of 2000 individuals, 80 births and 125 deaths were reported over a given period of time. Which of the following graphs will correspond to it? https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 2 Sample Paper 05 CBSE Biology Class 12 4. For which of the following cases, population density can be easily determined by not utilising biological- entities directly? (a) Fish density (b) Density of bacteria in bacterial culture (c) Siberian cranes at Bharatpur wetlands (d) Tiger census 5. Given figure represents a pyramid of biomass in an aquatic ecosystem. Identify A and B and select the correct answer. (i) A is the crop which supports and B is the crop which is supported. (ii) A is the crop which is supported and B is the crop which supports. (iii) A is phytoplanktons and B is zooplanktons. (iv) A is zooplanktons and B is phytoplanktons. (a) (i) and (iv) (b) (ii) and (iii) (c) (i) and (iii) (d) (ii) and (iv) 6. Identify the palindromic sequence in the following. GAATTC GGATCC (a) CTTUUG (b) CCTAGG CCTGG CGATA (c) GGACC (d) GCTAA 7. Biochemical oxygen demand (BOD) in a river water (a) has no relationship with concentration of oxygen in the water (b) gives a measure of Salmonella in the water (c) increases when sewage added to river water (d) remains unchanged when algal bloom occurs 8. Replacement of the lighter-coloured variety of peppered moth (Biston betularia) to its darker variety (Biston carbonaria) in England is the example of (a) natural selection (b) regeneration (c) genetic isolation (d) temporal isolation 9. During insertional inactivation, the presence of a chromogenic substrate gives blue coloured colonies if the plasmid in the bacteria does not have an insert. The blue colour is produced by the enzyme (a) α -glucosidase (b) restriction endonuclease (c) β -galactosidase (d) Taq polymerase 10. A plant native to South America, which produces cocaine is (a) Erythroxylum coca (b) Atropa belladonna (c) Datura stramonium (d) Papaver somniferum 11. The inoculum is added to the fresh milk in order to convert milk into curd, the term ‘inoculum’ here refers to (a) a starter rich in vitamin B12 (b) a starter rich in proteins (c) a starter containing millions of LAB (d) an aerobic digester https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 3 Sample Paper 05 CBSE Biology Class 12 12. Match column I with column II. Column I Column II A. Fimbriae (i) Oviduct B. Fallopian tube (ii) Capture ova released into coelom C. Infundibulum (iii) Site of fertilization D. Ampulla (iv) Part of oviduct closer to ovary (a) A-(iv), B-(i), C-(ii), D-(iii) (b) A-(ii), B-(i), C-(iv), D-(iii) (c) A-(i), B-(ii), C-(iii), D-(iv) (d) A-(i), B-(iii), C-(iv), D-(ii) 13. Assertion : The plant biomass which serves as the food of herbivores and decomposers is said to result from the net primary productivity. Reason : Gross primary productivity is the rate of total production of organic material (biomass) during photosynthesis. (a) Both A and R are true and R is the correct explanation of A. (b) Both A and R are true and R is not the correct explanation of A. (c) A is true but R is false. (d) A is false but R is true. 14. Assertion : In a monohybrid cross, F1 generations indicate dominant characters. Reason : Dominance occurs only in heterozygous state. (a) Both A and R are true and R is the correct explanation of A. (b) Both A and R are true and R is not the correct explanation of A. (c) A is true but R is false. (d) A is false but R is true. 15. Assertion : Many endemic species are seen to flourish in sacred forests. Reason : Sacred forests are undisturbed forest patches and biodiversity rich areas. (a) Both A and R are true and R is the correct explanation of A. (b) Both A and R are true and R is not the correct explanation of A. (c) A is true but R is false. (d) A is false but R is true. 16. Assertion : The primary productivity of different ecosystems can be easily compared. Reason : The magnitude of primary productivity depends on the photosynthetic capacity of producers and the prevailing environmental conditions. (a) Both A and R are true and R is the correct explanation of A. (b) Both A and R are true and R is not the correct explanation of A. (c) A is true but R is false. (d) A is false but R is true. SECTION - B 17. Name the genus of baculovirus that acts as a biological control agent in spite of being a pathogen. Justify by giving three reasons that make it an excellent candidate for the job.  O In which way have microbes played a major role in controlling diseases caused by harmful bacteria? https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 4 Sample Paper 05 CBSE Biology Class 12 18. What could be the possible treatments for a patient exhibiting ADA deficiency? 19. Refer to the given below figure. (i) Redraw the structure as a replicating fork and label the parts. (ii) Write the source of energy for this replication. 20. Where is sporopollenin present in plants? State its significance with reference to its chemical nature. 21. The above graph show species-area relationship. Write the equation of the curve ‘a’ and explain it.  O How does over-exploitation of beneficial species affect biodiversity? Explain with the help of one example. SECTION - C 22. Prior to a sports event, blood and urine samples of sports persons are collected for drug tests. (i) Why is there a need to conduct such tests? (ii) Name the drugs the authorities usually look for. (iii) Write the generic names of two plants from which these drugs are obtained. Continue on next page..... https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 5 Sample Paper 05 CBSE Biology Class 12 23. Although a prokaryotic cell has no defined nucleus, yet DNA is not scattered throughout the cell. Explain. 24. A cross was carried out between two pea plants showing the contrasting traits of height of the plants. The result of the cross showed 50% parental characters. (i) Work out the cross with the help of a Punnett square. (ii) Name the type of the cross carried out. 25. Why is predation required in a community of different organisms?  O (i) Explain “birth rate” in a population by taking a suitable example. (ii) Write the other two characterstics which only a population shows but an individual cannot. 26. When does a geneticist need to carry a test cross? How is it carried? 27. Study the transverse section of human ovary given below and answer the questions that follow. (i) Name the hormone that helps in growth of A " B " C (ii) Name the hormone secreted by A and B. (iii) State the role of hormone produced by D. 28. ‘Plasmid is a boon to biotechnology’. Justify this statement quoting the production of human insulin as an example. Continue on next page..... https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 6 Sample Paper 05 CBSE Biology Class 12 SECTION - D Question No. 29 and 30 are case based questions. Each question has subparts with internal choice in one subpart. 29. Study the given figure and answer the following questions. (i) Identify A, B, C and D from the given figure. (ii) What kind of inheritance is shown in the given the figure? (iii) State the significance of this inheritance in the above mentioned cross.  O What would happen in the given cross if the parents phenotype be reversed i.e., white eyed female and red eyed male respectively? 30. Refer to the given below flow chart that shows the sewage treatment. (i) With reference to the above flow chart explain the role of step A in the given process. (ii) Identify A, B, C and D in the given process. https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 7 Sample Paper 05 CBSE Biology Class 12 (iii) Explain the process at step D.  O What is the significance of low B in the given process and how does it forms C? SECTION - E 31. An experiment ‘X’ provided evidence in support of ‘Y’. In this experiment, four gases were circulated ‘A’, ‘B’, ‘C, and ‘D’ in an air tight apparatus and electrical discharge from electrodes was passed at 800°C. The mixture of gases were passed through a condenser. After a week, the chemical composition of the liquid inside the apparatus was analysed. The results provided evidence through which ‘Y’ was more or less accepted. (i) Identify gases A, B, C, D. (ii) Which theory of origin of life is supported by the above experiment? (iii) Draw a diagrammatic representation of experiment X. (iv) What does A, B, C and D together produced in the experiment X?  O Explain three different ways in which natural selection can affect the frequency of a heritable trait in a population. 32. Give reasons why: (i) DNA cannot pass into a host cell through the cell membrane. (ii) Proteases are added during isolation of DNA for genetic engineering. (iii) Single recognition site is preferred in a vector. (iv) Maintainance of sterile conditions in biotechnological processes. (v) Genes encoding resistance to antibiotics considered as useful selectable markers for E.coli cloning vector.  O Causative agents of HIV-AIDS and COVID-19 belong to the same group of viruses. To diagnose and amplify the genetic material for further study of COVID-19 virus, ‘RT-PCR’ test is carried out. (i) What does ‘RT-PCR’ stand for? (ii) Explain the various steps of PCR technique. 33. Study the graph given below related with menstrual cycle in females: (i) Identify ovarian hormones X and Y mentioned in the graph and specify their source. (ii) Correlate and describe the uterine events that take place according to the ovarian hormone levels X and Y mentioned in the graph on - (a) 6 - 15 days (b) 16 - 25 days https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 8 Sample Paper 05 CBSE Biology Class 12 (c) 26 - 28 days (when ovum is not fertilised)  O Refer the given below figure and answer the questions that follows: (i) What phenomenon is represented in the above given figure ? (ii) What is the path of entry of pollen tube ? (iii) Label the parts marked as A to E. (iv) What will happen after entering of pollen into one of the synergids?  ****** https://qrbook.page.link/appInstall NODIA App to See the Solutions. Click Here To Install Page 1 Sample Paper 06 CBSE Biology Class 12 Sample Paper 06 Class XII 2024-25 Biology (044) Time: 3 Hours Max. Marks: 70 General Instructions: 1. All questions are compulsory. 2. The question paper has five sections and 33 questions. All questions are compulsory. 3. Section—A has 16 questions of 1 mark each; Section—B has 5 questions of 2 marks each; Section—C has 7 questions of 3 marks each: Section—D has 2 case-based questions of 4 marks each; and Section—E has 3 questions of 5 marks each. 4. There is no overall choice. However, internal choices have been provided in some questions. A student has to attempt only one of the alternatives in such questions. 5. Wherever necessary, neat and properly labeled diagrams should be drawn. SECTION - A Q. No. 1 to 12 are multiple choice questions. Only one of the choices is correct. Select and write the correct choice as well as the answer to these questions. 1. Which one of the following pair is a purine pair? (a) Adenine, Guanine (b) Cytosine, Thymine (c) Uracil, Guanine (d) Adenine, Thymine 2. Methanogenic bacteria are present in (a) anaerobic sludge (b) rumen (a part of stomach) of cattle (c) Both (a) and (b) (d) None of these 3. The polymerase enzyme used in PCR is (a) DNA polymerase I (b) restriction endonuclease (c) reverse transcriptase (d) Taq polymerase https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 2 Sample Paper 06 CBSE Biology Class 12 4. The figure below is the diagrammatic representation of the E.Coli vector pBR 322. Which one of the given options correctly identifies its certain component (s)? (a) ori - original restriction enzyme (b) ampR, tetR - antibiotic resistance genes (c) Hind III, EcoRI - selectable markers (d) rop-reduced osmotic pressure 5. Which of the following statement confirm the law of dominance (a) Alleles do not show any blending and both characters recovered as such in F2 generation (b) It is the conclusion of a dihybrid cross (c) 3:1 ratio in F2 generation (d) Alleles of a pair segregate from each other such that gamete receives only one of the two factors 6. Atmosphere of earth just before the origin of life consisted of: (a) CH4, NH3, H2 and water vapours. (b) CO2, NH3, and CH2 (c) water vapours, CH4, NH3 and oxygen. (d) CH4, O3, O2 and water vapours. 7. The trigger for activation of toxin of Bacillus thuringiensis is (a) alkaline pH of gut (b) high temperature (c) acidic pH of stomach (d) mechanical action in the insect gut 8. The term ‘precipitation’ includes (a) rain (b) snow (c) Both (a) and (b) (d) None of them Continue on next page..... https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 3 Sample Paper 06 CBSE Biology Class 12 9. The law of segregation of characters postulated by Mendel can be related to (a) The presence of two genes for each character in a somatic cell. (b) presence of both genes on the same chromosome. (c) a gamete receiving only one of the two homologous chromosomes during gamete formation. (d) None of the above 10. Who proposed that the first form of life come from pre-existing non- living molecules? (a) Darwin and Lamarck (b) de Vries and Sturtevant (c) Oparin and Haldane (d) Louis Pasteur and Miller 11. C-peptide of human insulin is (a) removed during maturation of pro-insulin to insulin (b) responsible for the formation of disulphide bridge (c) a part of mature insulin molecule (d) responsible for its biological activity 12. Asexual reproduction is common among (a) single celled organisms only. (b) single celled animals, plants and animals with simple organizations. (c) animals with simple organization. (d) plants only. 13. Assertion: Phagocyte cells digest microbes and debris Reason: Natural killer cells destroy virus-infected cells and tumor cells. (a) Both A and R are true and R is the correct explanation of A. (b) Both A and R are true and R is not the correct explanation of A. (c) A is true but R is false. (d) A is False but R is true. Continue on next page..... https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 4 Sample Paper 06 CBSE Biology Class 12 14. Assertion: Hybrid is formed by cross between two organisms that are different in one or more traits. Reason: Mendel crossed two plants differing in one trust to obtain F1 plants in mono-hybrid cross. (a) Both A and R are true and R is the correct explanation of A. (b) Both A and R are true and R is not the correct explanation of A. (c) A is true but R is false. (d) A is False but R is true. 15. Assertion: An antibody is a protein molecule made by the lymphocytes. Reason: An antibody binds to a specific antigen and neutralizes its odd effects. (a) Both A and R are true and R is the correct explanation of A. (b) Both A and R are true and R is not the correct explanation of A. (c) A is true but R is false. (d) A is False but R is true. 16. Assertion: Replication and transcription occur in the nucleus but translation takes place in the cytoplasm. Reason: mRNA is transferred from the nucleus into cytoplasm where ribosomes and amino acids are available for protein synthesis. (a) Both A and R are true and R is the correct explanation of A. (b) Both A and R are true and R is not the correct explanation of A. (c) A is true but R is false. (d) A is False but R is true. SECTION-B 17. Refer the figure of a part of seminiferous tubule showing different stages of sperm formation and answer the questions. https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 5 Sample Paper 06 CBSE Biology Class 12 (i) Describe the process of spermatogenesis up to the formation of spermatozoa. (ii) Trace the path of spermatozoa from the testes up to the ejaculatory duct only.  O Where are the Leydig cell present? What is their role in reproduction? 18. State the role of ‘biolistic gun’ in biotechnology experiments. Microparticles of which elements are used in this technique?  O Agrobacterium tumifaciens is a natural vector. How? 19. Cucurbits and papaya plants bear staminate and pistillate flowers. Mention the categories they are put under separately on the basis of the type of flowers they bear. 20. A region of a coding DNA strand has the following nucleotide sequence: -ATGC- What shall be the nucleotide sequence in the following? (i) Sister DNA segment it replicates. (ii) m-RNA polynucleotide it transcribes. 21. Define the term ‘health’. Mention any two ways of maintaining it.  O Microbes play a dual role when used for sewage treatment as they not only help to retrieve usable water but also generate fuel. Write in points how this happens? SECTION-C 22. Scientists have succeeded in recovering healthy sugarcane plants from a diseased one. (i) Name the part of the plant used as explant by scientists. (ii) Describe the procedure the scientists followed by recover the healthy parts. (iii) Name the technology used for crop improvement. 23. A large number of married couples in the world are childless. It is shocking to know that in India the female partner is often blamed for the couple being childless. (i) State any two reasons responsible for the cause of infertility in case of male and female. (ii) Suggest a technique that can help the couple to have a child where the problem is with male. 24. Name the organic materials exine and intine of an angiosperm pollen grains are made up of. Explain the role of exine. Continue on next page..... https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 6 Sample Paper 06 CBSE Biology Class 12 25. Name the ancestors of man based on the features given below: (i) Human like, meat-eater with 900 cc brain, lived in Java. (ii) More human with brain size 1400 cc, lived in central Asia, used hides and buried their dead. (iii) Human like, vegetarian, with brain capacity between 650 cc and 800 cc. 26. Explain stirring type bioreactors. 27. Study the diagram given below and answer the following questions. (i) Why have DNA fragments in band D moved far away in comparison to those in band C? (ii) Identify the anode end in the diagram. (iii) How are these DNA fragments visualised. 28. (i) State the cause and symptoms of Down’s syndrome. Name and explain the event responsible for causing this syndrome. (ii) Haemophilia and Thalassemia are both examples of Mendelian disorder, but show difference in their inheritance pattern. Explain how. SECTION-D 29. Read the following and answer any four questions from 29(i) to 29(iv) given below: Ex-Situ Conservation: In this approach, threatened animals and plants are taken out from their natural habitat and placed in special setting where they can be protected and given special care. Zoological parks, botanical gardens and wildlife safari parks serve this purpose. There are many animals that have become extinct in the wild but continue to be maintained in zoological parks. In recent years ex situ conservation has advanced beyond keeping threatened species in enclosures. Now gametes of threatened species can be preserved in viable and fertile condition for long periods using cryopreservation techniques, eggs can be fertilised in vitro, and plants can be propagated using tissue culture methods. Seeds of different genetic strains of commercially important plants can be kept for long periods in seed banks. Biodiversity knows no political boundaries and its conservation is therefore a collective responsibility of all nations. The historic Convention on Biological Diversity (‘The Earth Summit’) held in Rio de Janeiro in https://qrbook.page.link/app Install NODIA App to See the Solutions. Click Here To Install Page 7 Sample Paper 06 CBSE Biology Class 12 1992, called upon all nations to take appropriate measures for conservation of biodiversity and sustainable utilisation of its benefits. In a follow-up, the World Summit on Sustainable Development held in 2002 in Johannesburg, South Africa, 190 countries pledged their commitment to achieve by 2010, a significant reduction in the current rate of biodiversity loss at global, regional and local levels. (i) What was the outcome of the 1992 Earth Summit in Rio de Janeiro? (ii) For endangered species, Ex-situ conservation is a method that is? (iii) Which one of the following is related to ex-situ conservation of threatened animals and plants?  O (iv) World summit on sustainable development of 2002 was held in? 30. Read the following and answer any four questions from 30(i) to 30(iv) given below: Microbes in commercial production of Chemicals, enzymes and Bioactive molecule: Microbes are also used for commercial and industria