Exam 4 Generation of Induced Pluripotent Stem Cells from Asian Bats PDF

INTERNATIONAL JOURNAL OF VETERINARY SCIENCE AND MEDICINE 2024, VOL. 12, NO. 1, 81–90 https://doi.org/10.1080/23144599.2024.2384835 Generation of induced pluripotent stem cells from the Asian bats a b,c d Younsu...

INTERNATIONAL JOURNAL OF VETERINARY SCIENCE AND MEDICINE 2024, VOL. 12, NO. 1, 81–90 https://doi.org/10.1080/23144599.2024.2384835 Generation of induced pluripotent stem cells from the Asian bats a b,c d Younsu Lee , Okjae Koo and Islam M. Saadeldin a Division of R&D, RedGene Inc, Seoul, Republic of Korea; bCollege of Veterinary Medicine, Kyungpook National University, Daegu, Republic of Korea; cnSAGE Inc., Incheon, Republic of Korea; dComparative Medicine Department, King Faisal Specialist Hospital and Research Centre, Riyadh, Saudi Arabia ABSTRACT ARTICLE HISTORY Preservation of native Korean bats is crucial for maintaining ecological balance, as they play Received 1 May 2024 a vital role in insect control, pollination, and seed dispersal within their ecosystems. The present Revised 20 July 2024 study details the establishment of bat induced pluripotent stem cells (BatiPSCs) from two Asian Accepted 21 July 2024 and Korean bats (Hypsugo alaschanicus and Pipistrellus abramus) using the Sendai KEYWORDS Reprogramming Kit. Colonies of BatiPSCs, exhibiting distinctive features, were manually Native bats; induced selected and expanded following successful transfection. Characterization of BatiPSCs revealed pluripotent stem cells; the expression of pluripotency markers, such as Octamer-binding transcription factor 4 (Oct4), reprogramming; chimera SRY (sex-determining region Y)-box 2 and Nanog, with notably increased Oct4 levels and reduced Myc proto-oncogene expression compared with those noted in other induced plur­ ipotent stem cell sources. BatiPSCs displayed positive staining for alkaline phosphatase and demonstrated the ability to form embryoid bodies, while also inducing teratomas in non- immune nude mice. Additionally, green fluorescent protein (GFP)-expressing BatiPSCs were generated and used for chimeric mouse production, with slight GFP signals detected in the neck region of the resulting mouse foetuses. These findings demonstrate the successful generation and characterization of BatiPSCs, emphasizing their potential applications in chi­ meric animal models, and the protection of endangered bat species. 1. Introduction The collective action of these factors leads to the Induced pluripotent stem cells (iPSCs) play activation of endogenous pluripotency genes, such as a promising role in the conservation of wildlife species Nanog and Rex1, and the silencing of lineage-specific particularly bats by providing a versatile tool for genes, ultimately reprogramming the somatic cells genetic research, disease modelling, and potential into iPSCs. restoration efforts [1–3]. The conservation of these Following the initial reprogramming phase, the bats also supports broader ecosystem functions and generated iPSCs undergo a series of culture and resilience, ensuring the sustainability of natural habi­ expansion steps to establish stable and self-renewing tats and the services they provide to humans and other cell lines. These cells exhibit key characteristics of wildlife. embryonic stem cells, including the ability to self- These iPSCs pose the unique ability to differentiate renew indefinitely and differentiate into cells of all into any cell type in the living body, making them an three germ layers (endoderm, mesoderm and ecto­ invaluable resource for disease modelling, drug dis­ derm). iPSCs can be maintained in culture for long covery and personalized cell-based therapies [5–7]. periods, providing an abundant and accessible source iPSCs are generated through a process called cellu­ of pluripotent cells for various applications [5,8]. lar reprogramming, where somatic cells are repro­ The retroviruses or lentiviruses are commonly used grammed back into a pluripotent state. The as vectors to deliver these factors into the target cells. reprogramming process involves the introduction of However, in recent years, advancements have been specific transcription factors known as Yamanaka fac­ made in reprogramming techniques to enhance effi­ tors. These factors are the following: Octamer-binding ciency and reduce potential risks associated with the transcription factor (Oct) 4, SRY (sex-determining use of viral vectors. Non-integrating methods, such as region Y)-box 2 (Sox2), Kruppel-like factor 4 (Klf4) episomal vectors, mRNA transfection and protein and Myc proto-oncogene (c-Myc), which are present delivery systems, have been developed to avoid per­ in somatic cells and their function is to reset their gene manent genetic modifications and improve the safety expression patterns and induce pluripotency [6,7]. profile of iPSC generation [9,10]. CONTACT Okjae Koo [email protected] nSAGE Inc., Yeonsu-gu, Incheon 21999, Republic of Korea; Islam M. Saadeldin [email protected] Comparative Medicine Department, King Faisal Specialist Hospital and Research Centre, Riyadh, Saudi Arabia Supplemental data for this article can be accessed online at https://doi.org/10.1080/23144599.2024.2384835 © 2024 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The terms on which this article has been published allow the posting of the Accepted Manuscript in a repository by the author(s) or with their consent. 82 Y. LEE ET AL. The global impact of the coronavirus disease-19 internal organs were removed and the remaining tis­ (COVID‐19) outbreak, which began in late 2019, has sues were washed with phosphate-buffered saline extended over a span of more than 2 years, resulting in (PBS). Subsequently, the tissues were minced into significant repercussions on both global quality of life small pieces using scissors and digested with a 0.25% and economical status. The focus has intensified on trypsin/1 mM EDTA solution in a 37°C water bath for unravelling the origins and transmission of the severe 15 min. Following trypsinization, equal volumes of acute respiratory syndrome coronavirus 2 (SARS‐ mouse embryonic fibroblast (MEF) medium (DMEM CoV‐2). Currently, the discourse centres on the fol­ with 10% FBS) were added and pipetted to dissociate lowing two conflicting theories: The possibility of the cells. The supernatant containing dissociated laboratory spillover events and human interaction cells was collected and filtered through a polyvinyli­ with zoonotic diseases originating from the bats. dene fluoride filter with a pore size of 0.45 μm To achieve the 3 R (replacement, reduction, and (Millipore, Sigma). The cells were subsequently refinement) principle, iPSc can be an alternative to collected by centrifugation at 1,000 × g for animal models for studying disease progression, eval­ 3 min and resuspended in MEF medium. The cells uating therapeutics and vaccines and guiding public were passaged two or three times to establish a mor­ health interventions [12–14]. phologically homogeneous culture. Subsequently, the An earlier report indicated the generation of bat cells were either frozen for preservation or expanded iPSCs and a recent report demonstrated their for further experimental studies. ability to form chimeric embryos and their use in coronavirus disease-19 (COVID-19) research. The 2.3. Generation of bat iPSCs current work provides a comprehensive overview of the generation of BatiPSCs, highlighting their PBFF cells were reprogrammed using the integration- immense potential in preserving the native Korean free CytoTune®-iPS 2.0 Sendai Reprogramming Kit bats and for further clinical practice. (Thermo Fisher Scientific, Inc.). This kit includes Sendai viral particles carrying the Yamanaka factors (human Oct3/4, Sox2, Klf4, c-Myc). To initiate the 2. Materials and methods reprogramming process, 3 × 105 BEFs were seeded The present study was carried out with a permission onto a gelatin-coated well of 6-well plate 24 h prior from Yeongju City, Gyeongsangbuk-do, Republic of to viral transduction. The cells were transduced in Korea to capture and collect wild animals (permit accordance with the manufacturer’s protocol. Nine number: 509000058201500001). Animal treatment days post-transduction, small colonies were manually and maintenance were reviewed and approved by the transferred with stretched glass Pasteur pipettes onto institutional animal care and use committee (IACUC) mouse embryonic fibroblast (MEF) feeder cells (Cat# of Institute for Basic Science (IBS), Yuseong-gu, SCRC-1008, ATCC, Manassas, VA, USA) and cul­ Daejeon, Republic of Korea. tured using Stempan E14 GMEM (Product # P08– 50600, PAN-Biotech GmbH, Aidenbach. Germany) or TeSR™-E8™medium (Catalog #05990, Stem Cell 2.1. Chemicals and reagents Technologies, Vancouver, BC, Canada). The colonies Chemicals and reagents were obtained from Sigma- were subsequently dissociated using 0.1% trypsin/1 Aldrich (Merck KGaA) unless otherwise specified. mM EDTA solution and passaged onto new 6-well plates. Upon reaching approximately 60–70% con­ fluency, individual cells were expanded onto 10 cm 2.2. Establishment of primary bat fetal fibroblast dishes. (PBFF) Foetuses were detected through manual abdominal 2.4. Characterization of bat iPSCs through palpation. Euthanasia of bats was performed immunofluorescence using a gradual CO2 charging method (70% chamber volume/min), according to [17,18] and the Michigan Immunofluorescence analysis was conducted fol­ Rabies Working Group (RWG). After waiting lowing a standard protocol. Briefly, the cells were until the bat in the chamber completely lost breathing fixed in 4% paraformaldehyde (Merck KGaA), and consciousness, it was euthanized after waiting for washed three times with PBS and subsequently another 3–5 minutes. The bat was then taken out and permeabilized with 0.3% Triton X-100 (Merck confirmed dead with no heartbeat through palpation. KGaA) and blocked with 5% normal foetal calf PBFFs were isolated from the foetal stage of two native serum for 1 h at room temperature. The cells Korean bats [Hypsugo alaschanicus (n = 4) and were subsequently incubated with primary mouse Pipistrellus abramus (n = 4)] with an average gestation antibodies against Oct4 (P0082-200UL, Sigma- period is 7.5 weeks [20,21]. The foetuses’ heads and Aldrich), and primary rabbit antibodies against  INTERNATIONAL JOURNAL OF VETERINARY SCIENCE AND MEDICINE 83 Nanog (RCAB004P-F, ReproCELL, Beltsville, MD, 2.6. Teratoma formation USA) at 4°C overnight. Primary antibodies were The cells were grown to confluence and dissociated. diluted 1:100 in 5% normal foetal calf serum. A total of 4 × 106 cells diluted in 1/4 Matrigel were Following washing three times with PBS, the cells injected subcutaneously in the right dorsal flank of 6– were incubated with secondary antibodies (Alexa 8 week-old male BALB/c nude mice (n = 6) (obtained CytoTune® 594 goat anti-mouse IgG (Cat # from Japan SLC, Inc.). The subcutaneous tumour A-11005) and Alexa TeSR™ 546 goat anti-rabbit growth progression was observed every two days. IgG (Cat # A-11035), Thermo Fisher Scientific, The experiment was conducted in accordance with Inc.) for 2 h at room temperature. Secondary anti­ the indicator that if problems such as eating or move­ bodies were diluted 1:200 in PBS. The nuclei were ment limitations due to the tumour occurred, the counterstained with 4,6-diamidino-2-phenylindole- experiment would have been terminated immediately. DAPI (Cat# 28718-90-3, Sigma-Aldrich). To Following tumour formation, the animals were eutha­ exclude autofluorescence and non-specific binding nized in a CO2 atmosphere chamber and euthanized of secondary antibodies, controls without primary by cervical dislocation. The resultant teratoma was antibodies were conducted, maintaining the same histologically assessed using haematoxylin and eosin incubation durations. staining to examine the endoderm derivatives ; moreover, Masson’s trichrome stain was used to examine the muscle fibres or mesoderm derivatives 2.5. Characterization of bat iPSCs through [23,24] and a periodic acid-Schiff stain to examine alkaline phosphatase (AP) reaction and embryoid the ectoderm epithelium. body formation For the detection of AP activity, cell colonies fixed in 2.7. Quantitative real-time PCR 4% paraformaldehyde (20 min, room temperature) were stained with an AP solution (Sigma-Aldrich; Invitrogen TRIzol® reagent was used for RNA extrac­ Merck KGaA) for 30 min at room temperature. tion. On the day of RNA extraction, BEF, human Following a 30-min incubation, the colonies were iPSCs (Cat #ACS-1011, ATCC, Manassas, VA, USA), washed three times with PBS, and the observations of and BatiPSCs were harvested and treated with 200 the colonies were conducted. ml TRIzol® reagent. RNA extraction was performed Bat induced pluripotent stem cells (BatiPSCs) following the instructions provided by the manufac­ were dissociated into single cells using 0.1% tryp­ turers. Two hundred ng of isolated total RNAs were sin/1 mM EDTA solution and resuspended in differ­ converted to cDNA in 20-µl reaction volumes by entiation medium composed of DMEM using a Moloney murine leukaemia virus cDNA supplemented with 10% FBS and 1% non-essential synthesis kit from Enzynomics, according to the amino acids. The cells were plated onto non- manufacturer’s instructions. Reverse transcription- adherent bacterial-grade petri dishes at a density of quantitative PCR (RT-qPCR) was performed by 2 × 106 cells per dish in 10 ml differentiation med­ diluting the cDNA samples five times and 3 ml of ium. To achieve uniform distribution of cells, the the diluted cDNA (30 ng or 6 ng) was transferred to Petri dish underwent gentle agitation and was sub­ each well of a 96-well reaction plate (Applied sequently transferred to a humidified incubator set Biosystems; Thermo Fisher Scientific, Inc.). at 37°C with 5% CO2. Following a 24-h incubation TOPreal qPCR 2 PreMIX (SYBR green with low period, the medium was substituted with a fresh ROX, Enzynomics) served as a fluorescent signal to differentiation medium to eliminate non-adherent detect the target cDNA amounts. The thermal cells. During the initial 4 days, embryoid bodies cycling protocol involved an initial step at 95°C for were kept in suspension culture using pluripotent 10 minutes, followed by 40 cycles comprising 10 sec­ stem cell culture medium without Leukaemia inhi­ onds at 95°C, 20 seconds at 60°C, and 40 seconds at bitory factor (LIF). The culture medium was 72°C. The relative mRNA expression levels were refreshed every two days and the cells were main­ determined by the ΔΔCt method , with tained in culture for a total duration of 7 days. GAPDH used as endogenous control. Primers’ Table 1. Primers used for relative quantitative PCR, according to the reference of Mo et al. and Déjosez et al.. Gene F R Product size Accession Oct4/POU5F1 GGTACACCCAGGCCGATGT GATGGTCGTTTGGCTGAACA 71 XM_059702114.1 SOX2 CTGCGAGCGCTGCACAT TCATGAGCGTCTTGGTTTTCC 73 XM_036352470.1 MYC ACGTCAGCTTCGCCAACAG GTTCTCTTCCTCGTCGCAGAA 80 XM_036337663.1 KLF4 CGAACCCACACAGGTGAGAAA CTGAGCGGGCAAACTTCCA 70 XM_036330103.1 GAPDH TGGTGAAGGTCGGAGTGAAC GAAGGGGTCATTGATGGCGA 104 XM_036322999.1 84 Y. LEE ET AL. sequences and accession numbers are provided in asterisks were used to indicate the statistical signifi­ Table 1 [1,15]. The reactions were run on cance between the groups (*p < 0.05, **p < 0.01, a StepOnePlus real-time PCR system (Applied ***p < 0.001) Biosystems; Thermo Fisher Scientific, Inc.). 2.8. Generation of bat-mice chimera in nude 3. Results mouse by using blastocyst complementation 3.1. Establishment of bat fetal fibroblast cell lines The injection of bat-iPS cells into mouse blastocysts and generation of BatiPSCs was performed as previously described. Eight-cell To generate BatiPSCs, BEFs (Figure 1(A-D)) under­ embryos were flushed from the oviducts of plugged went transfection using integration-free CytoTune®- females at 2.5 dpc in medium 2 (M2; MilliporeSigma). iPS 2.0 Sendai Reprogramming Kit. Typically, the The collected embryos were cultured on blastocyst CytoTune Kit enables colonies to be formed approxi­ stage at 37°C with 5% CO2 in KSOM medium. mately on the 12th day. However, in the case of bat Embryo injections were performed on blastocysts cells, iPSC-like colonies were observed approximately stage. 12–15 Bat-iPS cells were injected into blasto­ 3 days earlier than the standard timeline (depicted in cysts. Following injection, the blastocysts were incu­ Figure 2). Colonies exhibiting a compact, glossy bated in potassium simplex optimized medium with appearance with distinct edges and a 3D structure amino acids (KSOM-AA; MilliporeSigma) at 37°C were manually selected and expanded following until transferred to the uterine of pseudo-pregnant trypsinization. Swiss albino female mice by standard methods. In order to identify suitable culture conditions for BatiPSCs, two commonly used culture media for human and mouse stem cells, TeSR™-E8™ and 2.9. Statistical analysis Stempan E14 GMEM, were employed. On the The data are shown as mean ± SEM (standard error fourth day of culture, it was observed that cells in the of the mean). The RT-qPCR data combined tripli­ Stempan E14 GMEM medium were well-maintained, cates from one independent experiment. The differ­ while cells in the TeSR™-E8™ medium exhibited signs entiation experiments were replicated in two of degeneration. The most significant difference independent experiments with triplicate samples. between TeSR™-E8™ and Stempan E14 GMEM media One way ANOVA test was used to compare the lies in the presence or absence of LIF. Therefore, LIF is three groups and Tukey’s post-hoc test was used to considered to be a crucial factor for the maintenance determine the difference among the groups. The of BatiPSCs. Figure 1. Establishment of bat foetal fibroblast cell line. (A) Pregnant bat was used to obtain the embryos (B), and embryonic fibroblasts were obtained, (C) in growing stages, and (D) at confluency. Scale bar = 250 µm.  INTERNATIONAL JOURNAL OF VETERINARY SCIENCE AND MEDICINE 85 Figure 2. Generation of BatiPSC. From the 9th day onward, different types of colonies derived from bat-induced pluripotent stem cells (BatiPSC) started appearing. Notably, we successfully acquired colonies exhibiting morphological features reminiscent of primate iPSCs in plate shape and rodent iPSCs in dome shape. Scale bar = 250 µm. 3.2. Characterization of BatiPSCs qPCR, the expression levels of pluripotency markers BatiPSCs expressed the pluripotency factors Oct4 were compared in BEFs and human iPSCs. A marked (POU5F1A), Sox2 and Nanog as determined by increase was noted in the expression levels of Oct4 in immunofluorescence staining (Figure 3(A)). Using BatiPSCs, while the expression levels of c-Myc were Figure 3. Immunofluorescence and qPCR characterization of BatiPSC. To identify the cell type most closely resembling iPSCs, we conducted OCT4 (scale bar = 250 µm) and nanog (scale bar = 75 µm) immunofluorescence staining (A) and RT-qPCR (B). The findings demonstrated strong expression of pluripotent stem cell markers, particularly in colonies with a dome-shaped structure. Asterisks were used to indicate statistical significance between the groups (*p < 0.05, **p < 0.01, ***p < 0.001). 86 Y. LEE ET AL. significantly lower in BatiPSCs (Figure 3(B)). 3.3. Generation of green fluorescent protein Furthermore, BatiPSCs indicated positive staining of (GFP) expressing BatiPSCs and their use for AP, which is a marker of pluripotency (Figure 4(A)); chimeric mouse production the data indicated the ability of BatiPSCs to form BatiPSCs GFP-expressing colonies were selected and embryoid bodies following culture in low-attachment further expanded in culture (Figure 5). These GFP- dishes (Figure 4(B)). It is interesting to note that expressing cells were injected into the blastocele of BatiPSCs were able to induce teratoma following sub­ wild nude mouse blastocysts. The resultant blastocysts cutaneous injection in non-immune nude mice. About were transferred to surrogate mice and the foetuses 2 cm of teratoma growth were formed in five mice, were examined with regard to the expression of GFP. except for one mouse which showed a small sized The results indicated that GFP signals were slightly teratoma (Figure 4(C,D)). Histological sections of the detected in the neck region of the mouse foetuses resultant teratoma revealed differentiation of the (Figure 6; supplementary STable 1). injected cells into the three germ layers. H&E-stained sections indicated gut-like epithelial cells where hae­ matoxylin-stained nuclei in a purplish-blue hue, while 4. Discussion eosin imparted a pink colouration to the extracellular matrix and cytoplasm, representing endoderm deriva­ The conservation of Asian bats, particularly those tives (Figure 4(E)). Muscle fibres stained red with surviving in Korea, is crucial for maintaining Masson’s trichrome stain, representing mesoderm broader ecosystem functions and resilience. This derivatives (Figure 4(F)). Furthermore, PAS stain conservation effort ensures the sustainability of showed positively magenta-coloured secretory epithe­ natural habitats and the services they provide to lium, representing ectoderm derivatives (Figure 4(G)). humans and other wildlife [28,29]. In our current Figure 4. Characterization of bat iPSC through AP reaction (A), embryoid bodies (B) and teratoma formation (C-D). Scale bar = 75 µm. Histological sections of the resultant teratoma revealed (E) endoderm (arrow head) (stained with H&E stain; haematoxylin- stained nuclei in a purplish-blue hue, while eosin imparted a pink colouration to the extracellular matrix and cytoplasm), (F) mesoderm (stained red with Masson’s trichrome stain, arrow head), and (G) ectoderm (stained magenta with PAS stain, arrow head). Scale bar = 100 µm.  INTERNATIONAL JOURNAL OF VETERINARY SCIENCE AND MEDICINE 87 Figure 5. Generation of GFP bat iPSC. GFP was transfected to BatiPSCs colonies and positive colonies were used for further passaging and expanding the culture. Scale bar = 75 µm. Figure 6. Generation of bat-mice chimera in nude mice through using blastocyst complementation. (A) method of blastocyst complementation through injecting bat iPSCs into mice blastocysts. (B-D) Chimeric embryos were not observed however, we observed a slight GFP signal at the neck region. investigation, we aimed to generate Bat-induced pluripotency factors in bats and humans compared Pluripotent Stem Cells (BatiPSCs) as a tool for con­ to their mouse counterparts. To establish BatiPSC serving two Korean native bat species, Hypsugo cell lines, we utilized the integration-free CytoTune®- alaschanicus and Pipistrellus abramus, and as an alter­ iPS 2.0 Sendai Reprogramming Kit in conjunction native model for live animal research. with a suitable cell culture system. This Kit offers As indicated in Table 2, there was a reasonable several advantages over other methods of iPSC pro­ similarity between the amino acid composition of duction, primarily due to its non-integrative nature 88 Y. LEE ET AL. Table 2. Amino acid identity comparison between bat, human, introduction of BatiPSCs into nude mouse embryos and mouse reprogramming factors. may lead to the regeneration of thymic tissue derived Protein Human Mouse from bat-induced pluripotent stem cells during Oct4 87% 82% Sox2 96% 94% embryonic development. However, chimeric forma­ Klf4 94% 91% tion was not observed in either wild-type mice or Myc 78% 79% nude mice. Previous studies have suggested that spe­ cific differentiated stem cells are necessary to create chimeras between different species. It is antici­ and high efficiency. Unlike methods that integrate into pated that intermediate-stage differentiated stem cells the host genome, the Sendai virus-based system main­ will be required to establish chimeras between bats tains the genomic integrity of reprogrammed cells, and mice. reducing the risk of insertional mutagenesis and sub­ The emergence of BatiPSC colonies after approxi­ sequent genetic instability or tumorigenesis. The mately 9 days of cultivation signifies the efficiency of transient expression of viral RNA, which is diluted out the reprogramming process. Immunofluorescence stain­ as cells divide, eliminates concerns about long-term ing demonstrated the expression of key pluripotency expression of reprogramming factors. factors, Oct4 (POU5F1A) and Nanog, affirming their Additionally, the CytoTune®-iPS 2.0 Kit is known for stem cell identity. The RT-qPCR results demonstrated its high reprogramming efficiency, often surpassing a substantial increase in Oct4 expression, distinguishing other non-integrative methods such as episomal vec­ BatiPSCs from the original BEFs and human iPSCs, tors or mRNA-based reprogramming, resulting in fas­ indicating that the BiPSC lines consistently retained an ter generation of iPSCs and a higher yield of embryonic stem cell state. The expression levels of reprogrammed colonies. Several recent reports c-Myc were significantly reduced in BatiPSCs, indicating have shown the merits of using the CytoTune®-iPS the successful enhancement of the pluripotency of iPSC 2.0 Kit for generating iPSCs from human and animal ; this evidence suggests a unique molecular profile species due to its improved efficiency, safety, and ease that warrants further investigation. of use [33–36]. These advantages are crucial for both Positive AP staining, a recognized pluripotency research and potential clinical applications in regen­ marker, further confirmed the undifferentiated state erative medicine. of BatiPSCs [44,45]. The successful formation of The current results showed the essential roles of LIF embryoid bodies in low-attachment dishes demon­ in inducing and maintaining pluripotency during the strated their ability to undergo spontaneous differ­ generation of BatiPSCs, ensuring the stability and entiation, a characteristic feature of pluripotent stem robustness of reprogrammed cells. LIF activates cells. Notably, the induction of teratoma in the JAK-STAT3 signalling pathway, which in turn non-immune nude mice following subcutaneous upregulates key pluripotency-associated genes such injection underlines the tumorigenic potential of as Oct4, Sox2, and Nanog, thereby maintaining the BatiPSCs, indicating their capability to differentiate cells in an undifferentiated state [38,39]. into tissues representative of all three germ layers Starting from the 9th day of culture, various forms [47,48]. This was also confirmed also by the detec­ of BatiPSC colonies began to emerge. Among these, tion of GFP signals in the neck region of the chi­ colonies with morphological characteristics resem­ meric mouse foetuses, underlining the potential of bling the plate shape of primate iPSCs and the dome BatiPSCs to contribute to the development of speci­ shape typical of rodent iPSCs were identified. To fic tissues and organs in vivo [41,49]. determine which cell type closely resembled iPSCs, Contrary to previously reported bat iPSC lines, AP staining and immunofluorescence staining for which used different species: Hypsugo alaschanicus, pluripotency markers were performed. The results Pipistrellus abramus, Rhinolophus ferrumequinum, revealed a robust expression of pluripotent stem cell and Myotis myotis as reported by Déjosez et al. , markers, particularly in the dome-shaped colonies. and Myotis Lucifugus as reported by Qin et al.. We The BatiPSCs demonstrated specific characteristics used different integration-free system for expressing akin to embryonic stem cells (ESCs), such as typical the pluripotency factors [1,2,15], the method pre­ iPSC morphology, positive AP staining, expression of sented in the current study confirmed the ability of pluripotency markers, and the ability to form embry­ BatiPSCs to form differentiating teratoma and inte­ oid bodies [6,7]. grate into the blastocysts. Nevertheless, additional Xenotransplantation experiments were conducted molecular characterization of both PBFF and the involving bats and mice; however, clear chimeric resultant BatiPSCs is necessary. results were not obtained. The rationale for utilizing In conclusion, the establishment and characteri­ nude mice was based on their congenital deficiency in zation of BatiPSCs, coupled with their successful thymic tissue, making them a representative model of integration into chimeric mice, underscore their organ deficiency. The hypothesis was that the potential as valuable tools for the preservation of  INTERNATIONAL JOURNAL OF VETERINARY SCIENCE AND MEDICINE 89 endangered bat species. The distinctive molecular Chehelgerdi M, Behdarvand Dehkordi F, profile of BatiPSCs and their demonstrated pluripo­ Chehelgerdi M, et al. Exploring the promising poten­ tency render them promising for conservation tial of induced pluripotent stem cells in cancer research and therapy. Mol Cancer. 2023;22(1). doi: efforts. Further studies are required to obtain bat 10.1186/s12943-023-01873-0 naïve iPSCs and exploration of other bat species Karami Z, Moradi S, Eidi A, et al. Induced pluripotent for refinement of interspecies chimera production stem cells: generation methods and a new perspective using BatiPSCs. in COVID-19 research. Front Cell Dev Biol. 2023;10. doi: 10.3389/fcell.2022.1050856 Stadtfeld M, Nagaya M, Utikal J, et al. Induced plur­ Acknowledgement ipotent stem cells generated without viral integration. Science. 2008;322(5903):945–949. doi: 10.1126/ This project was conducted with the support of the science.1162494 Alchemist Project of the Korea Evaluation Institute of Hao YJ, Wang YL, Wang MY, et al. The origins of Industrial Technology (KEIT 20018560, NTIS 1415184668) COVID‐19 pandemic: a brief overview. Transbound funded by the Ministry of Trade, Industry & Energy Emerg Dis. 2022;69(6):3181–3197. doi: 10.1111/tbed. (MOTIE, Korea). 14732 Park G, Rim YA, Sohn Y, et al. Replacing animal testing with stem cell-Organoids: advantages and Disclosure statement limitations. STEM Cell Rev And Rep. 2024;2024: doi: 10.1007/s12015-024-10723-5 No potential conflict of interest was reported by the Pessôa LVDF, Bressan FF, Freude KK. Induced plur­ author(s). ipotent stem cells throughout the animal kingdom: availability and applications. World J Stem Cells. 2019;11(8):491–505. doi: 10.4252/wjsc.v11.i8.491 ORCID Kim T-W, Che J-H, Yun J-W. Use of stem cells as alternative methods to animal experimentation in Younsu Lee http://orcid.org/0009-0007-0025-5248 predictive toxicology. Regul Toxicol Pharmacol. Okjae Koo http://orcid.org/0000-0001-6399-6472 2019;105:15–29. doi: 10.1016/j.yrtph.2019.03.016 Islam M. Saadeldin http://orcid.org/0000-0002-7633- Mo X, Li N, Wu S. Generation and characterization of 730X bat-induced pluripotent stem cells. Theriogenology. 2014;82(2):283–293. doi: 10.1016/j.theriogenology. 2014.04.001 Data availability statement Haarsma A-J. Manual for assessment of reproductive The data supporting the findings of this study is available status, age and health in European vespertilionid bats. from the corresponding author upon a reasonable request. Hillegom, Holland: Electronic publication Version 1; 2008. Ellis MV. Development of a compact system for field References euthanasia of small mammals. J Mammal. 2017;98 (4):1211–1214. doi: 10.1093/jmammal/gyx072 Déjosez M, Marin A, Hughes GM, et al. Bat pluripo­ Reilly JS. Euthanasia of animals used for scientific tent stem cells reveal unusual entanglement between purposes. 2nd ed. Adelaide: ANZCCART, Adelaide host and viruses. Cell. 2023;186(5):957–974.e928. doi: University; 2001. 10.1016/j.cell.2023.01.011 Group MRW. Humane euthanasia of bats for public Qin Y, Li C, Gao X, et al. Derivation of transgene-free health rabies testing. Lansing (MI): Michigan Rabies bat induced pluripotent stem cells amenable to chi­ Working Group; 2014. p. 2014. mera formation in mice, pigs, and chicks. Cell Discov. Altringham JD. Reproduction and development. Bats. 2023;9(1). doi: 10.1038/s41421-023-00587-3 2011;10(1093/acprof:osobl/ Wu Y, Wang C, Fan X, et al. The impact of induced 9780199207114.003.0005pp):113–135. pluripotent stem cells in animal conservation. Vet Res Badwaik NK, Rasweiler JJ. (6) Pregnancy. In: Commun. 2024;48:649–663. doi: 10.1007/s11259- Reproductive biology of bats. Academic Press; 2000. 024-10294-3 p. 221–293. doi: 10.1016/b978-012195670-7/50007-2 Kasso M, Balakrishnan M. Ecological and economic Nelakanti RV, Kooreman NG, Wu JC. Teratoma for­ importance of bats (order Chiroptera). ISRN mation: a tool for monitoring pluripotency in stem Biodivers. 2013;2013:1–9. doi: 10.1155/2013/187415 cell research. Curr Protoc Stem Cell Biol. 2015;32(1). Ye L, Swingen C, Zhang J. Induced pluripotent stem doi: 10.1002/9780470151808.sc04a08s32 cells and their potential for basic and clinical sciences. Zhai M, Zhu Y, Yang M, et al. Human mesenchymal Curr Cardiol Rev. 2013;9(1):63–72. doi: 10.2174/ stem cell derived exosomes enhance cell‐Free bone 157340313805076278 regeneration by altering their miRNAs profiles. Adv Takahashi K, Yamanaka S. Induction of pluripotent Sci. 2020;7(19). doi: 10.1002/advs.202001334 stem cells from mouse embryonic and adult fibroblast Lee M-O, Moon SH, Jeong H-C, et al. Inhibition of cultures by defined factors. Cell. 2006;126 pluripotent stem cell-derived teratoma formation by (4):663–676. doi: 10.1016/j.cell.2006.07.024 small molecules. In: Proceedings of the National Takahashi K, Tanabe K, Ohnuki M, et al. Induction of Academy of Sciences; 2013, 110, doi:10.1073/pnas. pluripotent stem cells from adult human fibroblasts 1303669110 by defined factors. Cell. 2007;131(5):861–872. doi: 10. Kim JS, Hong YJ, Choi HW, et al. Generation of 1016/j.cell.2007.11.019 in vivo neural stem cells using partially 90 Y. LEE ET AL. reprogrammed cells defective in in vitro differentia­ FGF-Dependent authentic iPS cells. PLOS ONE. 2012;7 tion potential. Oncotarget. 2017;8(10):16456–16462. (6):e39022. doi: 10.1371/journal.pone.0039022 doi: 10.18632/oncotarget.14861 Telugu BPVL, Ezashi T, Sinha S, et al. Leukemia Livak KJ, Schmittgen TD. Analysis of relative gene inhibitory factor (LIF)-dependent, pluripotent stem expression data using real-time quantitative PCR and cells established from inner cell Mass of porcine the 2−ΔΔCT method. Methods. 2001;25(4):402–408. embryos. J Biol Chem. 2011;286(33):28948–28953. doi: 10.1006/meth.2001.1262 doi: 10.1074/jbc.M111.229468 Nagy A, Gertsenstein M, Vintersten K; Behringer R, Graf U, Casanova EA, Cinelli P. The role of the editors, editors. Manipulating the mouse embryo; leukemia inhibitory factor (LIF) — pathway in deri­ a laboratory manual. 3 ed. (NY): Cold Spring vation and maintenance of murine pluripotent stem Harbor Laboratory Press; 2003. cells. Genes (Basel). 2011;2(1):280–297. doi: 10.3390/ Jo Y-S, Baccus JT, Koprowski JL. Mammals of Korea: genes2010280 a review of their taxonomy, distribution and conser­ Mecklenburg L, Tychsen B, Paus R. Learning from vation status. Zootaxa. 2018;4522(1). doi: 10.11646/ nudity: lessons from the nude phenotype. Exp zootaxa.4522.1.1 Dermatol. 2005;14(11):797–810. doi: 10.1111/j.1600- Yoon KB, Lim SJ, Park YC. Analysis on habitat char­ 0625.2005.00362.x acteristics of the Korean bats (Chiroptera) using geo­ Wu J, Platero-Luengo A, Sakurai M, et al. Interspecies graphic information system (GIS). J For And Environ chimerism with mammalian pluripotent stem cells. Sci. 2016;32(4):377–383. doi: 10.7747/jfes.2016.32.4.377 Cell. 2017;168(3):473–486.e415. doi: 10.1016/j.cell. Lieu PT, Fontes A, Vemuri MC. Generation of 2016.12.036 induced pluripotent stem cells with CytoTune, a Hanna JH, Saha K, Jaenisch R. Pluripotency and non-integrating Sendai virus. Methods Mol Biol. cellular reprogramming: facts, hypotheses, unre­ 2013;997:45–56. doi: 10.1007/978-1-62703-348-0_5 solved issues. Cell. 2010;143(4):508–525. doi: 10. Kunitomi A, Hirohata R, Arreola V, et al. Improved 1016/j.cell.2010.10.008 Sendai viral system for reprogramming to naive Habib O, Habib G, Choi HW, et al. An improved pluripotency. Cell Rep Methods. 2022;2(11):100317. method for the derivation of high quality iPSCs in the doi: 10.1016/j.crmeth.2022.100317 absence of c-myc. Exp Cell Res. 2013;319 Beers J, Linask KL, Chen JA, et al. A cost-effective and (20):3190–3200. doi: 10.1016/j.yexcr.2013.09.014 efficient reprogramming platform for large-scale pro­ Štefková K, Procházková J, Pacherník J. Alkaline duction of integration-free human induced pluripo­ phosphatase in stem cells. Stem Cells Int. tent stem cells in chemically defined culture. Sci Rep. 2015;2015:1–11. doi: 10.1155/2015/628368 2015;5(1). doi: 10.1038/srep11319 O’Connor MD, Kardel MD, Iosfina I, et al. Alkaline Haase A, Göhring G, Martin U. Generation of phosphatase-positive colony formation is a sensitive, non-transgenic iPS cells from human cord blood specific, and quantitative indicator of undifferen­ CD34 + cells under animal component-free tiated human embryonic stem cells. Stem Cells. conditions. Stem Cell Res. 2017;21:71–73. doi: 10. 2008;26(5):1109–1116. doi: 10.1634/stemcells.2007- 1016/j.scr.2017.03.022 0801 Ura H, Togi S, Hatanaka H, et al. Establishment of Guo N-N, Liu L-P, Zheng Y-W, et al. Inducing a human induced pluripotent stem cell line, human induced pluripotent stem cell differentiation KMUGMCi010-A, from a patient with X-linked through embryoid bodies: a practical and stable ohdo syndrome bearing missense mutation in the approach. World J Stem Cells. 2020;12:25–34. doi: MED12 gene. Stem Cell Res. 2024;77:103388. doi: 10.4252/wjsc.v12.i1.25 10.1016/j.scr.2024.103388 Gutierrez-Aranda I, Ramos-Mejia V, Bueno C, et al. Shi Z, Liu H, Feng F, et al. Generation of an induced Human induced pluripotent stem cells develop tera­ pluripotent stem cell line GWCMCi006-A from toma more efficiently and faster than human embryo­ a patient with autosomal dominant neurodevelop­ nic stem cells regardless the site of injection. Stem mental disorder with or without hyperkinetic move­ Cells. 2010;28(9):1568–1570. doi: 10.1002/stem.471 ments and seizures harboring GRIN1 c.389A > Hong SG, Winkler T, Wu C, et al. Path to the clinic: G mutation. Stem Cell Res. 2024;76. doi: 10.1016/j. assessment of iPSC-based cell therapies in vivo in scr.2024.103371 a nonhuman Primate Model. Assess Of iPSC-Based Ishikawa K-I, Shiga T, Yoshino H, et al. Generation of Cell Therapies In Vivo In a Nonhum Primate Model. three clones (JUCGRMi002-A, B, C) of induced plur­ Cell Rep. 2014;7(4):1298–1309. doi: 10.1016/j.celrep. ipotent stem cells from a Parkinson’s disease patient 2014.04.019 with SNCA duplication. Stem Cell Res. West FD, Terlouw SL, Kwon DJ, et al. Porcine 2024;74:103296. doi: 10.1016/j.scr.2023.103296 induced pluripotent stem cells produce chimeric Cooney AJ, Hirai H, Firpo M, et al. Establishment of offspring. Stem Cells Dev. 2010;19(8):1211–1220. LIF-Dependent human iPS cells closely related to basic doi: 10.1089/scd.2009.0458