University of Bordeaux 2020-2021 Exam TD + TP on TMBC CBIO (PDF)

ANNEE UNIVERSITAIRE 2020-2021 HORS SESSION JANVIER 2021 MENTION : MASTER BS - M 1 CBIO (EN ANGLAIS) Collège Code UE : 4TBO701EX1...

ANNEE UNIVERSITAIRE 2020-2021 HORS SESSION JANVIER 2021 MENTION : MASTER BS - M 1 CBIO (EN ANGLAIS) Collège Code UE : 4TBO701EX1 Sciences et Intitulé de l’épreuve : TD + TP TMBC CBIO technologies Date : 8 Janvier 2021 Heure : 11h-13h Durée : 2h Documents : autorisés / non autorisés Masters Epreuve de Mrs: D CAPPELLEN, P AUGUSTE & P SCOTTI, & Mmes C VARON & S POGLIO TD / TP (2 x 1h conseillé) Exam TD (tutorials) UE TBMC‐CBIO (recommended time: 1 hour) Respond on a separate copy than that of the TP exam TD, Part 1: The figures below and next page represent the thermodynamic analyses of a nucleotidic sequence, with the aim to design a primer pair for quantitative PCR analysis. Features of the selected forward primer (underlined on the upper panel and highlighted in red in the lower panel). 1/5 Features of the selected reverse primer (underlined on the upper panel and highlighted in red in the lower panel). Anticipated interactions between the forward and reverse primers and features of the expected PCR fragment. Question 1: Which parameters are crucial for both primers of a primer pair, individually and with respect to one another, to be suitable for PCR analysis, notably for quantitative PCR? Do you believe that this given primer pair is: A) Perfect; B) Acceptable; C) Bad (to be avoided)? Justify why (in a few lines only). Question 2: Describe briefly (in a few lines only) the principle of the design of a PCR primer pair aimed to create, by site directed mutagenesis, a Stop codon or an internal deletion starting from a wild‐type sequence as an initial PCR template. You can draw a scheme (with different colors if you want) to help to explain your strategy. 2/5 TD, Part 2: Investigators have identified a candidate cancer gene, TSGX, that is inactivated in certain cancers. Their studies have also revealed that this gene produces various isoforms due to alternative splicing of exon 4 in messenger RNAs. In order to study their biological functions in cancer cell lines, the cDNAs of the two main TSGX splice variants were cloned into lentiviral expression vectors. By quantitative RNA analysis, these researchers showed that the transcripts with and without splicing of exon 4 are expressed at similar levels, when considering both endogenous expression in native cells and ectopic high expression in cells transduced with lentiviral vectors encoding the corresponding transcripts. However, by Western blotting analysis, only the 205 amino acids long isoform encoded by the transcript with all exons was detected. The other isoform, called Δ exon 4, due to splicing out of the fourth exon, causing a frameshift starting from codon 47, and leading to a Stop at amino‐acid position 55, was not detected. c o d o n s t o p p r é m a t u r é - > Question 3: a) What could be the explanation(s) for the lack of detection of the Δ exon 4 isoform? b) Which strategies would you carry out to investigate these possibilities? L e n t i v i r a l By site directed mutagenesis, these researchers have introduced mutations inactivating the translation initiation codon in the TSGX splice variants cDNA lentiviral vectors. They have verified, for the 205 amino acids long isoform that is normally detectable by western blot, that these mutations abrogate protein expression. They next transduced cancer cells exhibiting low endogenous expression levels of the TSGX gene with the control vector encoding only the selection marker but without any TSGX cDNA, or vectors encoding the selection marker and wild type or initiation codon‐mutated TSGX cDNA isoforms. They selected the transduced cells and analyzed them in soft agar assays. The results of this soft agar experiments are displayed on Figure A bellow (a representative phase contrast microscopy picture of cells transduced by each tested lentiviral vector is shown). Figure A: Phase contrast microscopy photographs of representative wells of soft agar assays with cells transduced by the indicated lentiviral vectors (see text above for details). p r o l i f Question 4: a) What properties of the cells are tested in soft agar assays? b) What can you conclude concerning the function of the TSGX 205 amino acids and Δ exon 4 isoforms in oncogenesis? c) What kind of information is brought by the mutation of the initiating codon in the expression vectors, notably for the Δ exon 4 isoform? t u m o r s u p r e Question 5: Describe briefly (in a few lines only) the strategy that you would now use to detect the expression of the protein isoform encoded by the Δ exon 4 transcripts and how that would help to explain why the TSGX Δ exon 4 protein isoform was not detected in initial experiments? W B w i t h o r 3/5 Exam TP (practical work) UE TBMC‐CBIO (recommended time: 1 hour) Respond on a separate copy than that of the TD (tutorials) exam TP, Part 1: It has been proposed that the mutation Q61L in the Rac1 protein was responsible for the invasive phenotype of certain cancer cells. To confirm this hypothesis you have proceeded to the reversion of this mutation into the wild type Q amino acid in Rac1 using a mutagenic strategy based on the Q5® quick change kit. Now, you would like to assess whether the invasive phenotype relies on the introduction of the leucine residue per se or rather relies on the general hydrophobic character of the leucine side chain. Therefore, you are planning now to exchange the 61 leucine residue for an isoleucine one (Rac1 L61I). GTPase always ON -> prolif Q1: Could you briefly explicit what is the main molecular effect of the Q61L mutation? A aa aa aa aa aa 49 60 61 62 67 B C 5’ 3’ Rac1 L61I antisense primer: TATCCCATAAGCCCAGATTCAC 5’TACAGCGCCATTGAAGATT 3’ Rac1 L61I sense primer ? : ‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐ Figure 1: (A) Part of Rac1Q61L coding sequence. Amino acid (aa) positions within the full length protein are indicated on the top of the sequence and the leucine codon is squared. (B) Sequence of the reverse primer used for the Q5® quick change mutagenesis. (C) Genetic codes. Q2: A portion of the Rac1Q61L coding sequence (cloned cDNA) is given in Figure 1A. Starting from this clone cDNA sequence, design a primer to exchange the leucine codon (position 61) into an isoleucine one using the same strategy as during the practical work. To guide you in your designing, the fixed sequence of the antisense primer used for the mutagenesis PCR is given in Figure 1B, as well the genetic code (Figure 1C). Please justify your sense primer sequence features. Q3: Between PCR amplification and bacteria transformation, an “all in one” incubation step is required to perform the complete mutagenesis. Could you briefly explicit the different reactions proceeding in the reaction tube? (which one ? what for ?) KLD 4/5 TP, Part 2: Now, you want to study the functional effects of the exchange of the 61 leucine residue for an isoleucine (mutant Rac1 L61I) in the Rac1 protein on adherent fibroblastic cell lines. For that, you have to transfect the cells with a plasmid containing a Rac1 L61I‐GFP encoding sequence (in frame fusion of GFP sequence to Rac1 one), culture them and analyze the morphology of the cells. Q4: Propose two cell control conditions you have to make in this experiment. Explain the utility of each control. (6 lines max) Vecteur avec glutamine (revertant) + GFP sans mutation Q5: You want to make the transient transfection of the DNA plasmids you prepared previously using the Lipofectamine 2000® kit. Could you cite and explain briefly the main steps of the transfection process that allow the entry and the expression of the plasmid by the cells (6 steps max, 12 lines max)? Q6: After the transfection of the cells, you plan to make an immunofluorescence to detect the filamentous actin organization, nuclei and Rac1 expression. Which components can you use to detect filamentous actin, nuclei and Rac1 protein (3 lines max)? Which fluorescent molecules do you need to use to detect these components according to the 3 channels available on the fluorescence microscope which are mentioned below (3 lines max)? Cell Preparation: DNA-Lipofectamine Complex Formation: Incubation of Complexes: Addition to Cells: Internalization and Release: Expression of Plasmid: 5/5