Data Analysis MCQ PDF

Data Analysis MCQ Done Checkbox Courses 🧪 Research Project A Deadline @January 31, 2025 Multi-select Summative Weighting 20 Things to cover: Lecture 2 CRISPR...

Data Analysis MCQ Done Checkbox Courses 🧪 Research Project A Deadline @January 31, 2025 Multi-select Summative Weighting 20 Things to cover: Lecture 2 CRISPR powerpoint - good overall key summary of the project Go over the Fungi lecture by Prof Kim Hammond-Kosack - this will probably be in the exam Go over TBL1 material focusing on the math and calculation; units,molarity, dilutions calc, mole, c1 x v1 = c2 x v2, serial dilutions TBL2 - Techniques - this needs to be a key focus so you clearly understand each of the techniques - add to your notes using the links Understanding gel electrophoresis results Manufacturer Protocols? Understanding the DSB repair mechanisms Powerpoints of each experiment: EXP1 EXP2 EXP3 EXP4 EXP5 EXP6 + 7 - have a look again at your nanodrop and sequencing results EXP8 EXP9 EXP10 This will assess your understanding of what you have done in the research project It will only cover knowledge or techniques used in this course NOT ONLY MOLARITY CALCULATIONS Data Analysis MCQ 1  Types of questions Conceptual – understanding the principles behind a molecular technique Calculation – preparing a solution/ reagent Interpretation – understanding the readout from a certain experiment Question structures Label a graph or figure Complete a missing word/number Answer a question based on information presented to you Techniques used throughout the research project: PCR - Polymerase Chain Reaction: Pairs oligo primers normally 20-30 nucleotides in length Anneals them to specific DNA sequences - so the region between them can be synthesised using a DNA Polymerase enzyme Uses free nucleotides - dNTPs Repeated cycles of melting the newly formed DNA strand from the template strand; annealing primers, extending the strand with DNA polymerase Starting template strand is either genomic or plasmid DNA Steps in brief: 1. Melt dsDNA to separate the double stranded DNA strands - 95 degrees 2. Anneal primers and cool to 54 degrees 3. Add nucleotides and DNA polymerase to extend the DNA strands - 4. Melt the DNA strands 5. Reanneal primers and extend → Repeat this cycle over and over again to amplify the region between primers 1 and 2 Agarose Gel Electrophoresis: Data Analysis MCQ 2  Used to separate the charged molecules - nucleic acids - depending on their size. Migration of the nucleic acids through the matrix gel depends on these variables: 1. Size of nucleic acid - normally in base pairs 2. Conformation of the nucleic acid - can be supercoiled, circular, linear 3. Base composition of the nucleic acid - different bases have different pI values 4. Voltage across the gel - a higher voltage will ‘pull’ nucleic acids through a gel more quickly than a lower voltage 5. Density of the agarose gel - a high density will result in smaller ‘pores’ in the matrix so the DNA will migrate more slowly. → The progress of the DNA through the gel is monitored using loading samples mixed with loading buffer: Contains dyes Xylene cyanol FF and bromophenol blue - used to mark the positions of molecules - 4000 to 300 base pairs in length Loading buffer also contains Ficoll to increase the density of the samples so it sinks into the wells of the gel. 🧬 The nucleic acids in the gel can then be stained with non-toxic fluorescent dye, GelRed - the gel is then imaged on a UV transilluminator. Nucleic Acid Quantification: Performed using spectrometry: 260 nm absorbance = Nucleic acids absorb UV light at 260 nm due to their aromatic base moieties within their structure. 280 nm absorbance = Proteins and phenolic compounds have strong absorbance 230 nm absorbance = Organic compounds have strong absorbance - phenol, TRIzol, guanidine and carbohydrates. A260/280 ratio = Shows if there is protein contamination A260/230 ratio = Shows if there is organic contaminants Data Analysis MCQ 3  💡 Both these ratios should be above 1.6 - or it could interfere with downstream applications User Cloning: - watch a video on it User-friendly DNA engineering method to combine multiple PCR fragments - to allow directional cloning. Target DNA molecules and cloning vectors are generated by PCR - 6-10 bases between the neighbouring ‘overlapping’ fragments PCR primers contain a single deoxyuracil residue - dU - flanking the 3’ end of the homology region. Amplifying the vector and target DNA in the overlapping fragments that incorporate a dU at each end Treatment of PCR fragments with the USER enzyme creates a single nucleotide gap at each location of dU Resulting in PCR fragments flanked with single-stranded extensions that allow seamless and directional assembly of the customized DNA molecules → into a linearized vector. What is USER cloning dependent on? 1. Multinicking and type II REase enzymatic step - USER enzyme mix for plasmid linearization 2. Uracil containing primers 3. Proof reading polymerase that can read through uracil without stalling - Examples: Phusion U, Pfu Cx Hotstart Turbo Polymerase Steps in brief: Data Analysis MCQ 4  1. DNA inserts with overlapping ends - amplified by PCR - the ends at the 3’ end are flanked with a uracil - creating single nucleotide gaps 2. Add USER enzyme 3. Incubate at 37 degrees celsius for 15 minutes 4. Transform using E.coli 5. DNA analysis CRISPR-CAS9: Using highly specific DNA double strand breaks (DSB) introduced by the Cas9 endonucleases - this allows site- specific genetic modifications to be inputted Allows protection against foreign genetic elements - such as plasmids and phages. 🧬 Cas9 nuclease forms a complex with trans-activating RNA and CRISPR RNAs composed of a constant section and a 20 nt variable section (protospacer) The protospacer provides specificity and guides the Cas9 to the complementary sequence - where it produces a DSB - ONLY if followed by a protospacer adjacent motif (PAM motif). PAM sequence is usually NGG - the reverse complement strand would have a PAM of CCN → Linking all the RNAs by a hairpin loop produces a single chimeric guide RNA (sgRNA) Data Analysis MCQ 5  The introduction of double strand breaks allows genome editing driven by non-homologous end-joining (NHEJ) or homologous recombination (HR) repair. CRISPR-CAS9 Optimisation for Aspergilli Cas9 gene from S.pyogenes was optimised for Aspergillus niger - then fused with Kozak sequence in front of the start codon and NLS sequence. Synthetic cas9 gene was driven by a strong constitutive A.nidulans tef1 promoter and terminator. In fungi… → The sgRNA is embedded in the middle of a larger transcript synthesized by RNA Polymerase II. sgRNA is liberated from the larger transcript in the nucleus by the action of two ribosome sequences; 5’-end hammerhead and 3’ end hepatitis delta virus which flank the sgRNA So the the HH ribozyme and the HDV ribozyme splices the sgRNA transcript Protospacer - 20 nt sequence complementary to the targeted genomic/viral DNA sequence PAM - 3 nt sequence - NGG - downstream of the protospacer detected by Cas9. If in reverse the PAM would appear to be NCC. Cas9 - creates the double stranded breaks so either strand can be targeted. We have a template of the sgRNA transcript within a plasmid - pFC334 - BUT it is missing the target-specific sequences. We need to design an approach to insert our desired protospacer and HH hairpin sequences. Data Analysis MCQ 6  EXP1: Design of primers for CRISPR plasmid construction Purpose: To insert target-specific sequences into the primers used to PCR amplify two overlapping fragments of the sgRNA. → We need to add the protospacer and the HH hairpin All the CRISPR experiments used: PgpdA-forward primer - promoter GGGTTTAAUGCGTAAGCTCCCTAATTGGC TtrpC-reverse primer - terminator GGTCTTAAUGAGCCAAGAGCGGATTCCTC Selecting sgRNA1 and sgRNA4 protospacers within the yA gene But each individual CRISPR experiment needs two additional primers which contain variable sequences designed to target specific regions of the yA gene sgRNA1-yA-fwd primer: AGTAAGCUCGTCX1XXXXXXXXXXXXXXXXXXX20GTTTTAGAGCTAGAAATAGCAAGTTAAA X1-X20 - is identical to the sequence of the protospacer sgRNA1-yA-reverse primer: AGCTTACUCGTTTCGTCCTCACGGACTCATCAGGGGCGGACGGTGATGTCTGCTCAAGCG X1-X6 - is identical to the first 6 nt of the protospacer sequence and forms a hairpin in sgRNA-yA targeting protospacer = Hammerhead Ribozyme section *Sequences in bold anneal to the template during PCR. Protospacer for sgRNA1 = GGCGGAGTATCATAACATCG - THIS PROTOSPACER IS IN THE FORWARD ORIENTATION PAM for sgRNA1 = AGG (NGG) PCR1: 1. Complete primer for sgRNA1 - sgRNA1-yA-reverse: AGCTTACUCGTTTCGTCCTCACGGACTCATCAGGGGCGGACGGTGATGTCTGCTCAAGCG 2. PgpdA-fwd: Data Analysis MCQ 7  GGGTTTAAUGCGTAAGCTCCCTAATTGGC PCR2: 1. Complete primer for sgRNA1 including protospacer - sgRNA1-yA-fwd: AGTAAGCUCGTCGGCGGAGTATCATAACATCGGTTTTAGAGCTAGAAATAGCAAGTTAAA 2. TtrpC-rv: GGTCTTAAUGAGCCAAGAGCGGATTCCTC For sgRNA4 the protospacer and the PAM sequence is in the reverse orientation: Protospacer for sgRNA4 = CCGGTGATCTACGTCGATCC PAM for sgRNA4 = CCC (CCN) The orientation is [protospacer:PAM] → As its in reverse we need to reverse complement the protospacer…. GGCCACTAGATGCAGCTAGG —— GGATCGACGTAGATCACCGG Reverse complement of PAM… GGN PCR1: 1. PgpdA-fwd: GGGTTTAAUGCGTAAGCTCCCTAATTGGC (this is the same as the one for sgRNA1) 2. Complete the primer for sgRNA4-yA-rv: We will input the reverse complement of the protospacer AGCTTACUCGTTTCGTCCTCACGGACTCATCAGGGGATCG CGGTGATGTCTGCTCAAGCG PCR2: Data Analysis MCQ 8  1. Complete primer for sgRNA4-yA-fwd: AGTAAGCUCGTCGGATCGACGTAGATCACCGGGTTTTAGAGCTAGAAATAGCAAGTTAAA 2. TtrpC-rv: GGTCTTAAUGAGCCAAGAGCGGATTCCTC The main aim of the research project is to see if the CRISPR-Cas9 genome ediiting is useful for functional genomics research in fungi The Hypotheses of the research project: 1. The region of the gene targeted for the creation of the DSB effects the efficiency of CRISPR-Cas9 mediated gene editing. To do this we generated two plasmids targeting the same yA gene but at different locations; creating plasmids containing either sgRNA1 or sgRNA4 These will then be transformed into Aspergillus independently and compare the efficiencies — 2. Targeting multiple sites within a single gene for the creation of DSB increases the efficiency of CRISPR-Cas9 mediated gene disruption. Transform the Aspergillus with the sgRNA1 and sgRNA4 plasmids at the same time = Co-transformation Then the efficiency will be compared to when only using a single sgRNA Can only repair using the NHEJ mechanism — 3. The two DSB repair mechanisms (NHEJ and HR) have differing efficiencies in generating CRISPR-Cas9 mediated transformants. Does the method of repair matter? Using sgRNA1 or sgRNA4 and another GTS plasmid = Co-transformation Data Analysis MCQ 9  Contains seq. up/down stream of yA gene Results in loss of yA gene during HR repair This has been made for you You will compare efficiency of sgRNAs disrupting yA gene via NHEJ or HR repair EXP2: Generation of two DNA fragments containing the sgRNA To construct the CRISPR vector we need to generate two PCR reactions using the primers described in EXP1 → Using the existing CRISPR vector pFC334 as the template DNA for both the DNA reactions → Using uracil-containing primers - so we must use a proof-reading polymerase that tolerates uracil - Phusion U PCR reactions: PCR1: Data Analysis MCQ 10  Amplifies fragment 1 using the primers PgpdA-fwd and sgRNA1-yA-reverse. This fragment contains the promoter and the major part of the Hammerhead ribozyme PCR2: Amplifies fragment 2 using the primers sgRNA1-yA-fwd and TtrpC-reverse. This fragment contains the remaining part of the Hammerhead ribozyme, the sgRNA, the HDV ribozyme and the terminator Using a negative control for each of the PCR reactions - no DNA template (no pFC334 only water). The plasmid DNA template contains a template for the sgRNA but without the desired protospacer. The thermocycling PCR conditions: 1. 98 degrees for 2 mins 2. 35 cycles of: 98 for 30s, 58 for 30s, 72 for 1 min 3. 72 degrees for 10 mins Data Analysis MCQ 11  4. Cool to 10 degrees After the PCR reactions the enzyme DpnI is added to digest unwanted plasmid template Q1: List the PCR reaction conditions that can be modified to optimize the reaction and explain how each modification would affect the outcome Temperature and duration of steps: Denaturation temperature - affects DNA strand separation Annealing temperature - influences primer binding specificity Extension time - impacts completeness of amplification Reagent concentrations: Primers - affects amplification efficiency Template DNA - influences yield and specificity Magnesium - impacts enzyme activity and specificity Cycle number: More cycles increase yield but may introduce errors Fewer cycles reduce non-specific products EXP3: Preparation of CRISPR plasmid for USER cloning The CRISPR vector - circular pFC330 DNA is designed for USER cloning - it will be linearized for cloning by restriction digest using the PacI and Nt.BbvCI: PacI - Opens the vector and creates linear DNA Nt.BbvCI - Nicking endonuclease that cleaves only one strand of DNA on a double-stranded DNA substrate. Data Analysis MCQ 12  This allows the ligation of the two PCR DNA fragments 1 and 2 into the pFC330 vector by USER cloning. Ptef - Promoter pyrG - Auxotropic marker for selection of tranformed Aspergillus nidulans ampR - Ampicillin resistance for selection of transformed E.coli AMA1 - Enhances transformation efficiency in Aspergillus nidulans Ttef - Terminator ORI - Origin of replication NLS - Nuclear localisation signal and restriction site motifs (PacI/Nt.BbvCI) The codon optimised cas9 is driven in Aspergillus nidulans by strong constitutive tef promoter and terminator sequences — Brief steps of digesting the pFC330 CRISPR vector: 1. Digest using CutSmart Buffer, ddH2O, and the enzymes PacI and Nt.BbvCI These enzymes are used to digest the plasmid 2. After the reaction is stopped by Heat-inactivating it at 80 degrees Data Analysis MCQ 13  EXP4: Purification of PCR fragments and the linearized vector + Electrophoresis: What are the next steps: 1. Check the size of PCR products/amplicons of our fragments 1 and 2: PCR fragment 1 = 540 base pairs PCR fragment 2 = 420 base pairs 2. Check for additional unwanted bands 3. Check the negative control is blank 4. Check that the vector has been cut This is done by running only an aliquot of the DNA on an agarose gel EXP4.1: Electrophoresis We have to do an electrophoresis reaction first before we purify the PCR fragments as it depends on the outcome of the PCR reaction. Steps for electrophoresis: 1. We have 4 50 ul PCR reactions - labelled A-D (4 tubes from EXP2) and a single 50 ul digested plasmid (single tube from EXP3 - pFC330) 2. In new PCR tubes, add 5 ul dH2O and 2 ul 6x loading buffer 3. Add only 5 ul of the PCRs, or plasmid digests into the new corresponding tubes containing the loading buffer 4. Load each 12 ul sample into a single well on a 1% agarose gel containing Sybr Safe DNA stain, along with the 1kb GeneRuler DNA ladder. 5. Run the gel at 80 volts for 40 mins. 6. Visualise under UV light Now next steps depending on the outcome of the gel… Multiple PCR bands - Gel extraction using the QIAquick Gel Extraction protocol Data Analysis MCQ 14  Running the gel again, under UV light excise the correct sized band from the gel using a scalpel in 2ml tube, add the QG buffer, incubate at 50 for 10 min..etc… Single PCR bands// linearized plasmid - Monarch PCR and DNA Cleanup protocol - DID THIS PURIFICATION As my electrophoresis outcome produced no bands for both PCR 1 and PCR 2, we were given backup PCR The plasmid digest was successful and produced a band at 15700 bp So with the backup PCR given we performed the Monarch PCR and DNA Cleanup protocol: 1. Add 225 ul of DNA cleanup binding buffer to each PCR - buffer 5:1 PCR ratio so 45 ul left of PCR x 5 = 225 ul of buffer 2. Add 90 ul DNA cleanup binding buffer to the 45 ul of pFC330 digest - buffer 2:1 plasmid ratio, so 45 x 2 = 90 ul 3. Insert column into collection tube. Label top of the column accordingly 4. Load all the sample into the column 5. Centrifuge, discard the flow-through and re-insert the column 6. Add 200 ul DNA wash buffer, centrifuge, discard 7. Repeat step 6 8. Centrifuge empty, discard the collection tube and keep the column 9. Transfer column to clean labelled 1.5 ml tube 10. Add 40 ul warm elution buffer on the centre of the column, wait for 1 min 11. Centrifuge, discard column and keep flow-through 12. Use 1 ul to analyse the DNA quality and conc. on Nanodrop 13. Store DNA on ice Data Analysis MCQ 15  Results for nanodrop for PCR fragments 1 and 2 (backup) and linearized vector: Label - Group A260/280 - A260/230 - number, Sample ng/μl Presence of Presence of Sample, protein organic Purified PCR fragment 1 Group 3: 72.250 1.927 1.501 (A) 3AP PCR fragment 3CP 54.550 1.871 0.583 2 (C) pFC330 (E) 3EP 12.400 1.953 0.996 We do the nanodrop to confirm the purity of the extracted DNA - we measure it at 260 nm for the nucleic acid To estimate the quantity - we use 1 A260 nm unit is equal to 50 ug/ml for dsDNA A260 = Nucleic acids A260:A280 - presence of protein A260:A230 - presence of organics The ratios should be greater than 1.6 So both the PCR Fragment 2 and the pFC330 are not above 1.6 and show contamination of organics. Example of organics: Phenol, Ethanol, TRIZOL, guanidine, carbohydrates 🧂 Its normal to have high A230 contamination due to the salt/ethanol from the purification buffer. — Data Analysis MCQ 16  Q4: Explain why your PCR fragments and linearized vector samples are/arent of sufficient quantity and purity for EXP5 We started with 1 ug of plasmid of the PFC330 plasmid which was then digested And then we had approx of 40 ul of plasmid DNA at a conc of 15-20 ng/ul If at 15 ng/ul conc = 40 x 15 = 600 ng = 60% recovery If at 20 ng/ul conc = 40 x 20 = 800 ng = 80% recovery But we obtained a 12.4 conc so 40 ul x 12.4 ng/ul = 496 ng = 49.6% - 50% recovery Other reasons: Large plasmids are harder to recover - the pFC330 plasmid is 15700 base pairs in size Our plasmid contains many elements for the CRISPR-Cas9 system and genes for selection in bacteria and fungi How to improve recovery? 1. Make sure the elution buffer is warm - needs to be at 50 degrees 2. Increase the incubation of elution buffer on the column - only waited for 1 minute - couldve incubated for up to 5 mins? EXP5: USER Cloning and E.coli transformation Why do we do USER Cloning? It is used to combine the two purified PCR fragments within the pFC330 plasmid vector. The USER (Uracil-specific excision reagent) enzyme combines Uracil DNA glycosylase and Endonuclease VIII activities to generate a single nucleotide gap at each location of dU - producing PCR fragments flanked with single-stranded extensions that allow seamless and directional assembly of customized DNA molecules into a linearized vector. The overlapping sequences included in the primers will allow the two PCR fragments to fuse and ligate into the open pFC330 vector. The USER cloning reaction: Data Analysis MCQ 17  In a 1.5 ml tube mix a 10 ul USER cloning reaction in the following order: 4 ul purified PCR1 4 ul purified PCR2 1 ul pre-digested and purified pFC330 vector 0.5 ul buffer for enzymes (e.g: Cutsmart 10x) 0.5 ul USER enzyme mix — Q5: Describe how USER cloning works and how you will select E.coli cells harbouring the pFC330 vector 1. The Uracil DNA Glycosylase (UDG) catalyzes the removal of Uracil 2. Forming an abasic (apyrimidinic) site - leaving the phosphodiester backbone intact 3. Endonuclease VIII breaks the phosphodiester backbone where the abasic site is, releasing the deoxyribose. So the USER enzyme combines two enzymatic events: UDG + Endonuclease VIII = USER Enzyme — E.coli transformation: 1. To the USER cloning reaction add very gently 25 ul competent 5-alpha E.coli cells (C29857) - DONT MIX BY PIPETTING. 2. Incubate on ice for 30 mins 3. Heat shock for 30 secs at 42 degrees on a hot block 4. Incubate on ice for 5 minutes Data Analysis MCQ 18  5. Add 950 ul SOC outgrowth medium, and incubate at 37 degrees for 1 hour - shaking at 200 rpm Preparation of LB agar and ampicillin plates: Add 40 ul of Ampicillin (100 mg/ml) into the 50 ml falcon tube containing 40 ml of LB agar Pour approx 20 ml of LB agar into each plate Plate 100 ul cells on LB + Ampicillin plates → For the plates we only got approx 5 colonies when we expected 20, this could be due to not treating/handling the cells gently; heat shock for too long perhaps? sgRNA 1 plate - what it should look like Do not mix the E.coli cells by flicking, vortexing or pipetting Dont touch the bottom where the cells are and defrost slowly on ice The cells must be on ice when not used Sterile technique when handling the cells - stay close to a bunsen burner — Q6: If your ampicillin stock solution is 100 mg/ml, what volume would you add to 50 ml molten LB agar media before pouring your plates? c1 x v1 = c2 x v2 C1 = Concentration of Amp stock solution = 100 mg/ml V1 = ? Data Analysis MCQ 19  C2 = Concentration of LB agar media + amp plate = 100 ug/ml = divide by 1000 = 0.1 mg/ml V2 = 50 ml (100 mg/ml) x ? = (0.1) x (50) 5/100 = 0.05 ml = 50 ul I would add 50 ul of Ampicillin stock solution Overall summary of EXP1-6 - Preparation of the CRISPR vector: The pFC330 plasmid vector is digested with PacI and Nt.BbvCI - restriction digest enzymes… PacI - opens the vector and linearizes it Nt.BbvCI - a nicking endonuclease that cleaves one strand of DNA The pFC334 vector… The DNA fragments are amplified by PCR - specifically with U containing primers, and Phusion U The two PCR fragments ligate together and then into the vector EXP6: Isolation of CRISPR-Cas9 containing the yA sgRNA guide and yA gene- targeting substrate (GTS) vectors In EXP5, the Ampicillin-resistant E.coli containing the pFC330 vector with the yA sgRNA was grown in LB agar plates. Data Analysis MCQ 20  pAC895 vector GTS for marker-free guided HR has been constructed and the E.coli containing this construct is already pre-grown. Sequence structure of the pAC895 vector Fusion of the up and downstream yA sequences to form the marker-free GTS. Co-transformation of CRISPR-Cas9+yA-sgRNA with this GTS will promote DSB repair by HR between the up and downstream sequences with the fungal genome. Replacing the intervening yA gene with the GTS. The marker-free GTS is carried in the ampicillin resistant pAC895 vector EXP6.1: Picking pFC330+yA-sgRNA colonies Using sterile technique pick 2 colonies of pFC330+yA-sgRNA1 colonies and 1 colony of pAC895 - contains the yA GTS for gene deletion by HR. Incubate overnight Spin down the culture Now you will isolate the 3 plasmids using GeneElute (Sigma) — What is the Gene-targeting substrate (GTS) vector for? Data Analysis MCQ 21  When the pFC330+yA-sgRNA is co-transformed with pAC895 (yA-GTS) - a homologous gene-targeting substrate - the double strand break caused by the sgRNA and cas9 - is repaired by homologous recombination repair (HR). The DNA in between the homologous flanking DNA sequences in the GTS is inserted into the genome replacing the gene at this locus The GTS replaces the existing yA gene in between the up and downstream sequences - with the fungal genome? It is marker-free as a it doesnt contain a selectable marker — EXP6.2: Plasmid Purification GenElute Plasmid Miniprep Kit Steps: 1. Resuspend pellet in resuspension solution 2. Add lysis solution and invert gently to mix 3. Add Neutralisation buffer, invert 6 times and centrifuge for 10 mins 4. Add Column Preparation solution to the binding column in a collection tube 5. Centrifuge 1 min 13’000 rpm + discard flow through 6. Transfer lysate into column 7. Centrifuge 1 min 13’000 rpm + discard flow through 8. Add Wash solution to column 9. Centrifuge 1 min 13’000 rpm + discard flow through 10. Centrifuge 1 min 13’000 rpm + empty - to get rid of trace residues 11. Transfer column into clean 1.5 ml tube labelled accordingly. 12. Add Elution solution, wait 1 min 13. Centrifuge 1 min 13’000 rpm - collect the eluted DNA - you will have a little under 50 ul of extracted DNA plasmid Data Analysis MCQ 22  Next steps… Keep the purified plasmids and store on ice Nanodrop quantify DNA concentration and purity Make dilution for two sgRNA plasmids: approx 50 ul and approx 100 ng/ul — Results of Nanodrop - concentration and purity of the extracted vectors: Label - Group A260/280 - A260/230 - number, Sample ng/μl Presence of Presence of Sample, protein organic Purified pAC895 pAC 62.950 1.967 2.755 pFC330+yA sgRNA_C1 pY1 234.10 1.939 2.341 (pY1)* pFC330+yA sgRNA_C2 pY2 162.20 1.939 1.912 (pY2)** *C1 = Colony 1 **C2 = Colony 2 EXP7: Confirmation CRISPR-Cas9 vector contains error-free yA sgRNA guide We now need to confirm that the pFC330 plasmid contains the correct yA-sgRNA sequence. Using primers that target the region of interest: 1. Perform diagnostic pCR to determine if the plasmids contain the yA-sgRNA insert (A) Using primers sgRNA_seq F and sgRNA_seq_R and the plasmid DNA to amplify the region of the plasmid containing the yA-sgRNA insert Data Analysis MCQ 23  If the pFC330 contains the yA-sgRNA insert it will yield a PCR product of 1150 base pairs → But if not it will only be 205 base pairs 2. The plasmids will be sent for Sanger Sequencing to confirm the sequence has no errors (B) - checking if the sgRNA is error-free The resulting DNA sequences are then compared with the desired sequence to identify unwanted errors. Only will be using a single primer - either the forward or reverse primer. Doing a PCR of the reverse primer only — Q7: Using the data in table 3, calculate the volume of pFC330 vector with the yA-sgRNA required to produce a 50 ul plasmid DNA suspension at a concentration of 100 ng/ul For pY1 Conc = 234.10 ng/ul 234.10 x ? = 50 x 100 ? = 21.36 ul For pY2 Conc = 162.20 162.20 x ? = 50 x 100 ? = 30.83 ul EXP7.1: Diagnostic Redtaq PCR of yA-sgRNA insertion into the pFC330 plasmid Prepare a 25 ul PCR reaction to amplify each of the yA-sgRNA region of plasmid pFC330 from colonies 1 and 2 (pY1 and pY2) - using a single negative control. Order of solutions - all need to be kept on ice: 9.5 ul ddH2O 12.5 ul RedTaq master mix 1 ul of each primer - seqF and seqR 1 ul of template plasmid DNA - pFC330+yA-sgRNA - the conc of the DNA needs to be at 100 ng/ul Data Analysis MCQ 24  Electrophoresis gel results: There is a band in the negative lane which shouldnt be present - this could be due to not changing tips Amplification in negative - cross contamination (tips) EXP7.2: Sanger Sequencing Prepare a single Eurofins sequencing reaction using the reverse primer for each of the purified pFC330+yA-sgRNA plasmids Pair Number Sample Primer Tube Barcode pFC330-+yA 3 sgRNA_seq_R 54752929 sgRNA_C1 (pY1) pFC330-+yA 3 sgRNA_C2 sgRNA_seq_R 54752936 (pY2) 15 ul of plasmid DNA - 100 ng/ul 2 ul of single primer (10 uM) sgRNA_seq_R Add 3 ul of water - so the full volume adds up to 20 ul Send for sequencing EXP6-7 Summary: In EXP6 we purified the plasmids - so 2 colonies of the pFC330-yA-sgRNA1 (pY1, pY2) and the pAC895 GTS plasmid Then in EXP7 we only used the two purified sgRNA-containing plasmids and set up diagnostic PCR to check if the sgRNA is present (using both forward and reverse primers), then did Sanger sequencing to check the sgRNA is error- free using ONLY the reverse primer. Data Analysis MCQ 25  EXP8: Analysis of the cloned yA-sgRNA sequence within the pFC330 vector → Aligning the sequences onto the expected yA-sgRNA sequence 1.Download the correct yA-sgRNA nucleotide sequences (sgRNA1 sgRNA4 seqs) from Moodle. 2.Download your “FASTA files” for your sequencing reactions (sgRNA seq results 2024) from Moodle. 3.In a single FASTA file (using Notepad) organise your sequences as following, >Seq NAME, return. (You should have 3 sequences: sgRNA1 or 4; plus your two colonies) 4.Note that all YOUR sequences used the sgRNA_seq_R primer and will need to be reverse complemented using https://www.genscript.com/sms2/rev_comp.html 5.Now open https://www.ebi.ac.uk/Tools/msa/muscle/ 6.Paste the correct pFC330+yA-sgRNA (1 or 4) sequence and all your reverse complemented sequences into the input box 7.Select ClustalW, then submit. 8.Inspect the output alignment of your sequences against the desired yA-sgRNA to identify any mutations/errors. Organized sequences for MUSCLE alignment >pFC330-yA-sgRNA1 CTGCGGAACATATACTGGGCCCGGGAAGATCTCATGGTCATAGCTGTTTCCGCTGAGGGTTTAATGCGTAAGCTCCCTAA TTGGCCCATCCGGCATCTGTAGGGCGTCCAAATATCGTGCCTCTCCTGCTTTGCCCGGTGTATGAAACCGGAAAGGCCGC TCAGGAGCTGGCCAGCGGCGCAGACCGGGAACACAAGCTGGCAGTCGACCCATCCGGTGCTCTGCACTCGACCTGCTGAG GTCCCTCAGTCCCTGGTAGGCAGCTTTGCCCCGTCTGTCCGCCCGGTGTGTCGGCGGGGTTGACAAGGTCGTTGCGTCAG TCCAACATTTGTTGCCATATTTTCCTGCTCTCCCCACCAGCTGCTCTTTTCTTTTCTCTTTCTTTTCCCATCTTCAGTAT ATTCATCTTCCCATCCAAGAACCTTTATTTCCCCTAAGTAAGTACTTTGCTACATCCATACTCCATCCTTCCCATCCCTT ATTCCTTTGAACCTTTCAGTTCGAGCTTTCCCACTTCATCGCAGCTTGACTAACAGCTACCCCGCTTGAGCAGACATCAC CGTCCGCCCTGATGAGTCCGTGAGGACGAAACGAGTAAGCTCGTCGGCGGAGTATCATAACATCGGTTTTAGAGCTAGAA ATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTGGCCGGCATGGTCCC AGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCTTCGGCATGGCGAATGGGACTGATTTAATAGCTCCATGTCAACAAGA ATAAAACGCGTTTCGGGTTTACCTCTTCCAGATACAGCTCATCTGCAATGCATTAATGCATTGGACCTCGCAACCCTAGT ACGCCCTTCAGGCTCCGGCGAAGCAGAAGAATAGCTTAGCAGAGTCTATTTTCATTTTCGGGAGACGAGATCAAGCAGAT CAACGGTCGTCAAGAGACCTACGAGACTGAGGAATCCGCTCTTGGCTCATTAAGACCTCAGCCGAGACAGCAGAATCACC GCCCAAGTTAAGCCTTTGTGCTGATCATGCTCTCGAACGGGCCAAGTTCGGGAAAAGCAAAGGAGCGTTTAGTGAGGGGC AATTTGACTCACCTCCCAGGCAACAGATGAGGGGGG >P3_C1_Premixed CTGGGGCCCCCGGAAGATTCTCAGGTCATAGCTGTTTCCGCTGAGGGTTTAATGCGTAAGCTCCCTAATTGGCCCATCCGGCA >P3_C2_Premixed ATCTCATGTCATAGCTGTTTCCGCTGAGGGTTTAATGTGTAAGCTCCCTAATTGGCCCATCCGGCATCTGTAGGGCGTCCAAAT Data Analysis MCQ 26  Final checks before Aspergillus transformation: Do I have enough DNA? We want 1 ug of each plasmid in a transformation - doing 3 transformations with each sgRNA plasmid = approx 3 ug We will use the GTS plasmid (pAC895) only once = 1 ug For colony 1 - pY1: Used 21 ul for EXP7 Whats left.. 50-21-1 = 28 ul of plasmid DNA Conc of C1 = 234.10 ng/ul Total ng = 28 x 234.10 = 6554.8 ng *Need at least 3000 ng For colony 2 - pY2: Used 31 ul Whats left.. 50-31-1 = 18 ul Conc of C2 = 162.20 ng/ul Total ng = 18 x 162.20 = 2919.6 ng So we used Colony 1 For pAC895 - pAC: 45 ul left of the plasmid Conc of pAC = 62.950 ng/ul Total ng = 45 x 62.950 = 2832.75 ng *More than enough for the fungi transformation Data Analysis MCQ 27 Data Analysis MCQ 28