BIOL 3120 - Cell Biology Lab PDF

BIOL 3120 - Cell Biology Lab Lab 7. Targeted Amplification from Genomic DNA and cDNA by PCR; First- strand cDNA synthesis by reverse transcription (Demo) Rubaia Tasmin Teaching Assistant 10/21/2024 Email: [email protected]...

BIOL 3120 - Cell Biology Lab Lab 7. Targeted Amplification from Genomic DNA and cDNA by PCR; First- strand cDNA synthesis by reverse transcription (Demo) Rubaia Tasmin Teaching Assistant 10/21/2024 Email: [email protected] Today’s Lab Objectives 1. Understand the principles of PCR & RT-PCR 2. Learn how to design gene-specific primers (Arabidopsis ACTIN1 gene as an example) 3. Set-up and run PCR reactions The Central Dogma of Molecular Biology Unusual flows of information highlighted in green. https://en.wikipedia.org/wiki/ Genomic DNA Organization for Protein- coding Introns are Genes non-coding sequences of a gene that are removed from the RNA transcript during RNA splicing Exons are coding sequences of a gene that remain in the mature RNA after splicing and are translated into proteins https://www.genome.gov/genetics- 4 glossary/Intron Polymerase Chain Reaction Powerful method to amplify a specific DNA sequence or gene of interest in vitro Developed by Kary Mulis in 1983 (Nobel Prize Winning discovery in 1993) PCR Steps: 1) Denaturation (45 sec – 1 min) at 95 ℃ 2) Annealing (45 sec) at 55 ℃ 3) Extension (1 – 1.5 min) at 72 ℃ https:// www.britannica.com/science/polymerase-chain-reaction  Polymerase Chain Reaction Contents of a PCR reaction: Target DNA (template) Primers PCR buffer ( Tris HCl, KCl, Mg2+) dNTPs Taq Polymerase After each PCR cycle, the amount of DNA doubles. The amount of amplified DNA at the end of N cycles is 2N https:// www.britannica.com/science/polymerase-chain-react Designing Primers Forward primer: binds to the DNA bottom strand Reverse primer: binds to the DNA top strand - Note that the primer sequences are always provided from 5’ to 3’ direction https:// www.researchgate.net/post/How_to_select_primers_for_Polymerase_Chain_Re Designing Primers for a DNA Segment in ACTIN1 Gene GTGAGCCACACTGTTCCTATCTATGAGGGGTATGCACTTCCACATGCTATCCTACGTCTTGATCTTGCTGGTCG TGACCTCACGGATGCGCTGATGAAGATCCTAACCGAGCGTGGTTACTCTTTCACCACCACAGCAGAGCGTGAAA TTGTCAGAGACATAAAGGAGAAGCTTTGCTACATTGCTCTTGACTACGAGCAGGAACTCGAGACAGCCAAAACC AGCTCATCTGTTGAGAAGAACTACGAGCTACCTGATGGGCAAGTGATCACCATTGGATCAGAGCGATTCCGTTG TCCTGAGGTTCTTTACCAGCCATCTATGATTGGTATGGAGAATGCTGGTATCCATGAAACCACCTATAACTCCA TAATGAAGTGTGATGTCGACATCAGGAAGGACTTGTACGGTAACATTGTGCTCAGTGGTGGAACCACAATGTTC CCTGGAATCGCCGACAGAATGAGCAAAGAGATCACTGCTTTGGCTCCAAGCAGCATGAAGATCAAAGTCGTTGC CCCTCCAGAGAGGAAATACTCTGTCTGGATTGGAGGGTCCATCTTGGCCTCCCTCAGTACCTTCCAGCAGGTAC ACACAGTCCCATCACTTGTTTACTCTAAACAGACCTAAACTAAATCCTAATCACTCTCAGCTTAACTAAACTGG TTCAATTCTGAAACTATGTGTTACCTTGTGCAGATGTGGATCGCAAAGGCAGAGTATGACGAGTCAGGTCCATC GATTGTTCACAGGAAGTGCTTCTGAGTTCAAAGTTGATCATTTTTCAGAGAAGAAGCACCGCCAG Forward primer: 5’–GTGAGCCACACTGTTCCTATCT–3’ Reverse primer: 5’–CTGGCGGTGCTTCTTCTCTGA–3’ (Reverse Complementary to the top strand) 8 How well do you understand the PCR ? Why do the primers anneal to the target DNA instead of target DNA re-hybridizing?  We add primers in excessive molar concentration to prevent DNA re- hybridization Why does the PCR commonly run for no more than 30 cycles?  Primers and dNTPs will eventually be consumed; dNTPs are heat-labile Why the length of PCR products is defined by the 5’-end of primers? Polymerase can presumably extend the products beyond the "boundary" set by primers.  Original template runs out Reverse Transcription: The Synthesis of cDNA cDNA: complemen tary DNA KEY Reagents: Reverse transcriptase (RT) Oligo (dT)n RNase H 10  Difference between PCR and RT- PCR 1. PCR uses genomic DNA (gDNA) as the starting material, while RT-PCR uses RNA, which is first converted into complementary DNA (cDNA) before amplification M 1 2 3 4 5 6 gDNA 1000 bp 500 bp cDNA Lanes 1, 3-6 show At-ACTIN gDNA (with introns); size: 805bp Jorge L. Contreras (2021) Michigan Technology Law Lane 2 shows At-ACTIN cDNA (no introns); size: 694bp Review 11  Difference between PCR and RT- PCR 2. Tissue-specific gene expression RNA sequencing data showing the differences in RNA levels for two human genes in seven different tissues Fig 7 – 3 12  Difference between PCR and RT- PCR https:// image.slidesharecdn.com/c93faa69-19af-4da4-a227-f8f23c0c5a18-161127140939/95/introduction-of-rt-pcr-3-638.jpg? 13 cb=1480255798  PCR Reaction (A) Set- up - Use the extracted genomic DNA (gDNA) from lab 6 -Amplify ACTIN1 gene using forward and reverse primers (At-ACTIN-483F & At- ACTIN-D40-R2) Component Volume Final dH2O Concentration 35.75µl 1X (1.5mM MgCl2)2 10X Standard Taq Reaction Buffer 10.0µl PCR nucleotide mix (10mM) 1.0µl 0.2mM each dNTP Forward primer (AtACTIN1_483F ) 1.0µl 0.1-1.0µM Reverse primer (AtACTIN1_D40_R2) 1.0µl 0.1-1.0µM Taq DNA Polymerase 0.25µl 1.25units/50 µl PCR gDNA 1.0µl Total Volume: 50.0µl  PCR Reaction (B) Set-up -Use the synthesized complementary DNA (cDNA) from ACTIN1 provided by your TA -Amplify ACTIN1 gene using forward and reverse primers (At-ACTIN-483F & At- ACTIN-D40-R2) dH2O Component 35.75µl Volume Final Concentration 1X (1.5mM MgCl2)2 10X Standard Taq Reaction Buffer 10.0µl PCR nucleotide mix (10mM) 1.0µl 0.2mM each dNTP Forward primer (AtACTIN1_483F ) 1.0µl 0.1-1.0µM Reverse primer (AtACTIN1_D40_R2) 1.0µl 0.1-1.0µM Taq DNA Polymerase 0.25µl 1.25units/50 µl PCR cDNA 1.0µl Total Volume: 50.0µl PCR Program 1. Initial denaturation 95oC 2min 2. Denaturation 94oC 1min 3. Annealing 59oC 1min 4. Extension 72oC 50sec 5. Go to step 2 for 29 times 6. Final Extension 72oC 10min 7. Storage 4oC “∞”