The Cellular Level of Organization PDF

The Cellular Level of Organization Copyright 2010, John Wiley & Sons, Inc. Chapter 3: The Cellular Level of Organization Cells are the smallest living things Cells are the structural and functional subunits of all of our body systems Cell Biology is the study of cells, their...

The Cellular Level of Organization Copyright 2010, John Wiley & Sons, Inc. Chapter 3: The Cellular Level of Organization Cells are the smallest living things Cells are the structural and functional subunits of all of our body systems Cell Biology is the study of cells, their internal structures, and the chemical reactions that occur within them Copyright 2010, John Wiley & Sons, Inc.  Cells Are Made of Three Main Parts Every cell has 3 principal parts:  The plasma membrane is the flexible outer surface of the cell  The cytoplasm contains numerous organelles surrounded by cytosol  The nucleus is a large organelle that contains the cells chromosomes Copyright 2010, John Wiley & Sons, Inc. Cells Are Made of Three Main Parts Copyright 2010, John Wiley & Sons, Inc.  Plasma Membrane The plasma membrane is a strong but flexible barrier between the interior of a cell and the outside world The fluid mosaic model describes membrane structure:  A bilayer of phospholipids provides a structural foundation  A variety of membrane proteins interact with the lipids  All lipids and many proteins are able to move about freely The plasma membrane is the major means that cells use to communicate with other cells and with the environment Copyright 2010, John Wiley & Sons, Inc. Lipid Bilayers - The Key Role of Membrane Lipids Phospholipid bilayers are effective barriers for polar and charged molecules, and for ions Cholesterol and glycolipids are two other types of lipids that are found in animal cell membranes Copyright 2010, John Wiley & Sons, Inc. Lipid Bilayers - The Key Role of Membrane Lipids Copyright 2010, John Wiley & Sons, Inc. Membrane Proteins Several sub-classes of membrane proteins exist:  Integral proteins  Peripheral proteins  Glycoproteins Copyright 2010, John Wiley & Sons, Inc. Membrane Proteins - Their Varied Functions Reflect Differences in Their Structure Copyright 2010, John Wiley & Sons, Inc. Membrane Fluidity Various membrane functions require a balance between strength and flexibility of the membrane Membrane fluidity refers to the viscosity of the lipid bilayer of a membrane Membrane fluidity depends mainly on a balance in the number of double bonds in the membranes’ fatty acids Copyright 2010, John Wiley & Sons, Inc. Membrane Permeability Small and/or non-polar molecules are able to pass easily through phospholipid bilayers The permeability of membranes to ions/polar molecules depends on the number of specific transport proteins How quickly ions and molecules cross membranes depends on:  Concentration gradient of the ion/molecule  Electrical gradients that can speed or slow the movement of ions Copyright 2010, John Wiley & Sons, Inc. Active Versus Passive Processes All transport of molecules or ions across membranes can be classified as being either passive or active: Passive processes are spontaneous:  Chemicals move based on their kinetic energy  Movement is from higher to lower concentrations (“downhill”)  Examples: simple diffusion, facilitated diffusion, osmosis Active processes use stored energy:  Energy input is required for chemicals to move  Movement is from lower to higher concentrations (“uphill”)  Examples: primary and secondary active transport, endocytosis Copyright 2010, John Wiley & Sons, Inc. Diffusion - Passive Movement of Solutes Movements of solutes directly through the lipid bilayer is called simple diffusion Movement of solutes with the help of membrane proteins is called facilitated diffusion The rate of diffusion depends on:  Concentration gradient  Temperature  Mass of diffusing ion/molecule  Membrane surface area  Diffusion distance Copyright 2010, John Wiley & Sons, Inc. Diffusion - Passive Movement of Solutes Copyright 2010, John Wiley & Sons, Inc. Diffusion - Three Examples of Diffusion Non-polar molecules move via simple diffusion Many ions cross membranes through ion channels Polar molecules are transported by carrier-mediated facilitated diffusion Copyright 2010, John Wiley & Sons, Inc. Diffusion - Three Examples of Diffusion Copyright 2010, John Wiley & Sons, Inc. Osmosis - Movement of Water Instead of Solutes Most membranes are selectively permeable - and allow water to move much more quickly than many solutes Water moves in response to differences in solute concentrations, and water always moves toward the higher solute level Copyright 2010, John Wiley & Sons, Inc. Osmosis - Movement of Water Instead of Solutes Copyright 2010, John Wiley & Sons, Inc.  Osmosis - Tonicity and its Effects on Cells Osmotic gradients can have dramatic effects on cells 3 types of solutions are:  Hypotonic solutions  Isotonic solutions  Hypertonic solutions Because water moves quickly, most of our body fluids and cells are in osmotic equilibrium Copyright 2010, John Wiley & Sons, Inc. Osmosis - Tonicity and its Effects on Cells Copyright 2010, John Wiley & Sons, Inc. Active Transport In active transport, chemicals move “uphill” (against their concentration gradients] Energy is required to drive all active processes The three types of active processes are:  Primary active transport - ATP is the source of energy  Secondary active transport - ion gradients are the source of energy  Transport in vesicles - some large molecules can enter (endocytosis) and leave (exocytosis) cells without being broken down Copyright 2010, John Wiley & Sons, Inc. Primary Active Transport Primary active transport pumps ions “uphill” (against their concentration gradients) Energy from ATP hydrolysis is used to power this process The Na+/K+ pump and Ca2+/Mg2+ pump are examples of primary active transport Copyright 2010, John Wiley & Sons, Inc.  Active Transport Solutes are transported across plasma membranes with the use of energy, from an area of lower concentration to an area of higher concentration Example: Sodium-potassium pump Extracellular fluid Na+ Na+/K+ ATPase 3 Na+ expelled 2K+ gradient Cytosol 3 Na+ K+ gradient 1 3 Na+ P Cytosol K+ ATP 4 2K + gradient 1 2 ADP 3 P imported Copyright Copyright 2010, 2010 John John Wiley Wiley & & Sons, Inc. 23 Secondary Active Transport Secondary active transport also moves ions or molecules “uphill” (against their concentration gradients) Energy from an existing ion gradient powers this process Symporters and antiporters are two types of secondary active transport - many specific examples of each type exist in cells Copyright 2010, John Wiley & Sons, Inc. Secondary Active Transport Copyright 2010, John Wiley & Sons, Inc.  Transport in Vesicles Vesicles are small spherical membrane sacs Vesicles are used to move large molecules in and out of cells, and between organelles One important example is receptor-mediated endocytosis Copyright 2010, John Wiley & Sons, Inc. Transport in Vesicles Copyright 2010, John Wiley & Sons, Inc.  Transport in Vesicles - Other Examples Phagocytosis allows some cells to “eat” large particles Bulk-phase endocytosis allows cells to take in fluid and small solutes together Transcytosis allows cells to transport large chemicals across an epithelium Copyright 2010, John Wiley & Sons, Inc. Transport in Vesicles - Other Examples Copyright 2010, John Wiley & Sons, Inc.  Cytoplasm Cytoplasm consists of everything between the nucleus and the cell membrane Cytosol is the intracellular fluid, mostly water but with many dissolved chemicals Organelles are structures that each perform specific functions for the cell Copyright 2010, John Wiley & Sons, Inc. Cytoskeleton - A Network of Protein Filaments that Stretches Throughout the Cytosol Major functions:  Determining cell shape  Organizing the contents of the cell  Moving organelles  Moving chromosomes during cell division  Creating and moving membrane vesicles (in phagocytosis, etc.) Copyright 2010, John Wiley & Sons, Inc. Cytoskeleton - A Network of Protein Filaments that Stretches Throughout the Cytosol Copyright 2010, John Wiley & Sons, Inc. Centrosome Makes new microtubules in nondividing cells Forms the mitotic spindle during cell division Copyright 2010, John Wiley & Sons, Inc. Cilia and Flagella - Projections of the Cell Surface that Create Movement Cilia move fluid along the cell surface Flagella move cells through the medium Copyright 2010, John Wiley & Sons, Inc.  Ribosomes - The Site of Protein Synthesis Ribosomes have two major subunits, and are made of both RNA and proteins Free ribosomes make proteins used in the cytosol Attached ribosomes make proteins used in membranes and for export Copyright 2010, John Wiley & Sons, Inc.  Endoplasmic Reticulum Endoplasmic reticulum (or just “ER”) is an extensive membrane network within the cytosol Rough ER contains bound ribosomes Smooth ER has enzymes involved in metabolism of lipids and drugs Copyright 2010, John Wiley & Sons, Inc. Golgi Complex Modifies and sorts proteins produced by the rough ER Generates vesicles for moving molecules around inside of cells, and for export Copyright 2010, John Wiley & Sons, Inc. Golgi - Processing and Packaging of Proteins Copyright 2010, John Wiley & Sons, Inc.  Lysosomes, Peroxisomes, Proteasomes Lysosomes contain digestive enzymes used to break down:  Ingested material  Worn-out parts of cells  Destroy the whole cell Peroxisomes contain oxidative enzymes important in metabolism Proteasomes break down worn out or unneeded proteins Copyright 2010, John Wiley & Sons, Inc. Lysosomes, Peroxisomes, Proteasomes Copyright 2010, John Wiley & Sons, Inc.  Mitochondria Mitochondria contain enzymes that help cells produce large amounts of ATP, in a process called cellular respiration Mitochondria contain an inner and an outer membrane Mitochondria self-replicate, using their own ribosomes and some of their genes are on their own DNA Copyright 2010, John Wiley & Sons, Inc. Mitochondria Copyright 2010, John Wiley & Sons, Inc.  Nucleus - The Central Control Center of a Cell A double-walled nuclear envelope separates the nucleus from the cytoplasm The nucleolus is a site within the nucleus that produces new ribosomes Chromosomes contain our genes - the source of information for building and running cells Copyright 2010, John Wiley & Sons, Inc. Nucleus - The Central Control Center of a Cell Copyright 2010, John Wiley & Sons, Inc.  Chromosomes, Chromatin, and DNA Our genome consists of 23 pairs of chromosomes Each chromosome contains DNA combined with histone proteins to form chromatin The histones allow the DNA to be tightly packed After DNA replication, sister chromatids are connected at the centromere Copyright 2010, John Wiley & Sons, Inc. Chromosomes , Chromatin, and DNA Copyright 2010, John Wiley & Sons, Inc. Proteins Are an Expression of Genetic Information Transcription is the process where DNA sequence is copied (or transcribed) into RNA sequence If the RNA contains sequence meant to encode proteins, it is called messenger RNA (mRNA) The mRNA sequence is used to make new proteins in a process called translation Copyright 2010, John Wiley & Sons, Inc. Proteins Are an Expression of Genetic Information Copyright 2010, John Wiley & Sons, Inc.  Transcription Transcription transfers genetic information from DNA into one of three major classes of RNA:  Messenger RNA (or mRNA)  Ribosomal RNA (or rRNA)  Transfer RNA (or tRNA) The enzyme RNA polymerase creates the RNA molecules Regulation of transcription is a major way that cells control which proteins get made Copyright 2010, John Wiley & Sons, Inc. Transcription Copyright 2010, John Wiley & Sons, Inc.  Translation - Using mRNA and Ribosomes to Create Proteins Ribosomes have 2 subunits, these combine when a mRNA is available The ribosomes are made of proteins and rRNA, and they have multiple binding sites for mRNA and tRNA tRNA’s help line up the correct amino acids to make a new protein Copyright 2010, John Wiley & Sons, Inc. Translation - Using mRNA and Ribosomes to Create Proteins Copyright 2010, John Wiley & Sons, Inc.  Large Large Amino Aminoacid acid PPsite site subunit subunit Translation UUAACC CCGGGGAAUUGGUUAA GGCCUU AAsite GGCCUU site Initiator InitiatortRNA tRNA tRNA tRNA A U A A U A A U A U GGAA AAUUCC AACC Small Small PPsite site subunit subunit Anticodon Anticodon AAsite site UUAACC GGUUAA UU GGCC GGCCUU 22 Large Large Largeand and andsmall small smallribosomal ribosomal ribosomal AAUUAAAAUUCCGGGGAAUU AACC GGAA subunits subunits subunitsjoin join jointo to toform form formaaafunctional functional functional ribosome ribosome ribosomeand and andinitiator initiator initiatortRNA tRNA tRNA mRNA mRNA Amino Aminoacid acid fits fits fitsinto into intoPP Psite. site. site. Codons Codons (methionine) (methionine) Initiator InitiatortRNA tRNA 33 Anticodon Anticodonofofincoming incomingtRNA tRNApairs pairs Anticodon Anticodon with withnext nextmRNA mRNAcodon codonatatAAsite. site. mRNA mRNA UUAACC C G C G G GAAUUGGUUAAGGCCUUGG AACCAAUUAAAAUU CCUU GGAA Small Small mRNA mRNA subunit subunit binding binding site site Start Startcodon codon UUAACCAAUUCC 11 Initiator Initiator InitiatortRNA tRNA tRNAattaches attaches attachesto to toaaa A A A U A U GGGGAAUUGGUUAAGGCCUUGGCCUU CC start start startcodon. codon. codon. A AACC U A U GGAA New New peptide peptide bond bond 44 Amino Amino Aminoacid acid acidon on ontRNA tRNA tRNAatat atPP Psite site site forms forms formsaaapeptide peptide peptidebond bond bondwith with with amino amino aminoacid acid acidatat atAA Asite. site. site. A UC G U A G C U GC UG A A U C GG A U UUAACC AAUUCC AA GG AA GG AAUUAAAAUUCCGGGG UU UU CCUUGGCCUU AACC GGAA mRNA mRNA Stop codon movement movement 6 Protein synthesis stops when 55 tRNA tRNAatatPPsite siteleaves leavesribosome, ribosome, the ribosome reaches stop ribosome ribosomeshifts shiftsby byone onecodon; codon; codon on mRNA. tRNA tRNApreviously previouslyatatAAsite siteisisnow now atatthe thePPsite. site. Key: Key: Growing Complete protein ==Adenine Adenine mRNA protein tRNA ==Guanine Guanine ==Cytosine Cytosine ==Uracil Uracil Summary of movement of ribosome along mRNA  Cell Division and the Cell Cycle All non-gamete producing cells of the body are produced by mitosis The cell cycle is an orderly sequence of events by which somatic cells replicate Cells grow, and also duplicate their DNA during interphase Cells divide their chromosomes and their nuclei during mitosis After mitosis, cells finish dividing during cytokinesis Copyright 2010, John Wiley & Sons, Inc. Cell Division and the Cell Cycle Copyright 2010, John Wiley & Sons, Inc. DNA Replication DNA molecules are copied during S phase the structure of the double helix allows both copies of the new DNA to have the same sequence At the end of S phase, sister chromatids have been created (even though they are not visible until mitosis) Copyright 2010, John Wiley & Sons, Inc. DNA Replication Copyright 2010, John Wiley & Sons, Inc.  1 1 Centrosome: Centrosome: Mitosis Centrioles Centrioles Pericentriolar material Pericentriolar material Nucleolus Nucleolus Nuclear envelope Nuclear envelope Chromatin Chromatin Plasma membranePlasma membrane 6 LM all at 700x LM all at 700x Cytosol Cytosol (a) INTERPHASE (a) INTERPHASE 2 2 Kinetochore Kinetochore CentromereCentromere Mitotic spindle Mitotic spindle ChromosomeChromosome (microtubules) (microtubules) (two chromatids (two chromatids (f) IDENTICAL CELLS IN INTERPHASE Fragments of Fragments of joined at joined at 55 centromerecentromere nuclear envelope nuclear envelope Early Early (b) PROPHASE Late (b) PROPHASE Late Metaphase plate Metaphase plate 3 3 CleavageCleavage furrow furrow (c) METAPHASE (c) METAPHASE 4 4 (e) TELOPHASE (e) TELOPHASE CleavageCleavage furrow furrow Chromosome Chromosome Early Early Late Late (d) ANAPHASE(d) ANAPHASE  Meiosis = Reproductive Cell Division In sexual reproduction, unique cells called gametes are formed Gametes contain half as many chromosomes as all other cells, and are referred to as haploid cells Early in the first division chromosome pairs exchange DNA in a process called crossing over (an example of genetic recombination) At fertilization male and female gamete combine to create a new diploid individual, which will then undergo mitosis Copyright 2010, John Wiley & Sons, Inc. Meiosis or Reproduc tive Cell Division Copyright 2010, John Wiley & Sons, Inc.