BIOL140A Introduction PDF - Cell & Molecular Biology

BIOL140A Cell & Molecular Biology Overview of today’s class ▪ Introduction ▪ Syllabus & Canvas ▪ Introduction to Biology ▪ What is Life ?  Main learning objectives class 1 ▪ Know some characteristics and definitions of life  Various definitions of life ▪ homeostatic metabolism + development...

BIOL140A Cell & Molecular Biology Overview of today’s class ▪ Introduction ▪ Syllabus & Canvas ▪ Introduction to Biology ▪ What is Life ?  Main learning objectives class 1 ▪ Know some characteristics and definitions of life  Various definitions of life ▪ homeostatic metabolism + development + growth + reproduction ▪ (Abel, 2002). ▪ thermodynamic disequilibrium + low-entropy state + information encoding and transformation ▪ (Schulze-Makuch and Irwin, 2004). ▪ evolution + reproduction + metabolism ▪ (National Research Council, USA, 2007) ▪ Who defines life? ▪ Scientists propose definitions ▪ in peer-reviewed publications ▪ Scientific community decides on “working definitions” ▪ Can definitions of life change? ▪ Definitions are a work in progress  Various definitions of life ▪ homeostatic metabolism + development + growth + reproduction ▪ (Abel, 2002). ▪ thermodynamic disequilibrium + low-entropy state + information encoding and transformation ▪ (Schulze-Makuch and Irwin, 2004). We will use this definition ▪ evolution + reproduction + metabolism ▪ (National Research Council, USA, 2007)  Biology: Inquiring about Life Is a virus alive? Zika virus, Atomic level structure In small groups discuss: What is a virus? Is a virus alive? Consider our definition of life: evolution + reproduction + metabolism What is a virus? Zika, a single-stranded RNA virus  What is a virus? ▪ Nucleic acid + protein coat ▪ possibly surrounded by membrane ▪ Reproduces in host cells Zika, a single-stranded RNA virus SARS CoV-2 Are viruses “alive”? Influenza virus (single-stranded RNA virus) SARS-CoV 2 Infecting a human cell Do viruses show these characteristics? ▪ Can viruses evolve? ▪ Can viruses reproduce? ▪ Can viruses maintain a metabolism? Influenza virus (single-stranded RNA virus) SARS-CoV 2 Infecting a human cell  Do viruses show these characteristics? ▪ Evolution ▪ yes ▪ Example: drug resistance, new variants ▪ Reproduction ▪ yes ▪ But only with help of a host cell ▪ Metabolism ▪ No; use metabolism of host cell Some properties of life Order Regulation Evolutionary Reproduction adaptation Response Energy to the processing environment Growth and development Evolutionary adaptation: Camouflage, flower mantid Discuss in groups ▪ How did this adaptation happen? Natural Selection ▪ Variations in offspring ▪ some individuals slightly more camouflaged ▪ Differential reproductive success ▪ Less visible to prey and predators > more offspring ▪ Gradual changes over generations Applying natural selection in medical applications ▪ Flu vaccine ▪ Attenuated (weakened) ▪ Nasal spray ▪ “Killed” (damaged by heat, chemicals) ▪ injection  How to make attenuated flu vaccine? ▪ Virus applied to foreign host (not human)  How to make attenuated flu vaccine? ▪ Virus applied to foreign host ▪ e.g. chicken egg  How to make attenuated flu vaccine? ▪ Variation: some have mutations to infect new host; ▪ these can replicate  How to make attenuated flu vaccine? ▪ after a few months ▪ accumulated mutations that improve replication in chicken eggs  How to make attenuated flu vaccine? ▪ after a few months ▪ accumulated mutations that improve replication in chicken eggs ▪ will not replicate well in human  How to make attenuated flu vaccine? ▪ after a few months ▪ accumulated mutations that improve replication in chicken eggs ▪ will not replicate well in human ▪ ->attenuated vaccine Charles Darwin: Evolution can explain unity and diversity of life  Unity of Life Discuss with your neighbor: ▪ What do all known life forms on earth have in common? All known life forms on earth share DNA as genetic material Nearly identical genetic code Ribosomes to translate proteins Cell membranes similar basic metabolism Evolution can also explain the diversity of life: BIOL 140A, class 2 ▪ The chemical context of Life  Main Learning outcomes ▪ Understand the concept of elements, atoms, isotopes and molecules ▪ Be able to distinguish ▪ covalent bonds ▪ ionic bonds ▪ weak bonds  Matter (anything that takes space) 118 known Elements (categories of atoms) Elements (and their atoms) cannot be broken down to other substances by chemical reactions Atoms (the units of an elements) Periodic table of Elements An Element’s Atomic Number and Atomic Mass ▪ atomic number: ▪ mass number: 2 Atomic number Helium He 2He 4.003 Element symbol Atomic mass Electron distribution diagram An Element’s Atomic Number and Atomic Mass ▪ atomic number: number of protons ▪ mass number: sum of protons plus neutrons 2 Atomic number Helium He 2He 4.003 Element symbol Atomic mass Electron distribution diagram An Element’s Atomic Number and Atomic Mass ▪ atomic number: number of protons ▪ mass number: sum of protons plus neutrons What is an isotope? 2 Atomic number Helium He 2He 4.003 Element symbol Atomic mass Electron distribution diagram Isotopes ▪ Differ (only) in number of neutrons ▪ Radioactive isotopes decay spontaneously ▪ giving off particles and energy Ca Ca40 isotope 40 N 2010, scientists discovered a new kind of human: “Denisovan” Denisovan finger bone How to determine the age of this bone?  Radiometric dating Accumulating “daughter 1/ isotope 2 Remaining 1/ 4 “parent 1/ 8 1/ isotope 16 1 2 3 4 Time (half-lives) Carbon dating ▪ Living organism incorporate 14C at certain rate ▪ At death, the incorporation of 14C stops ▪ 14C decays ▪ Half-life time of 5700 years ▪ For dating up to about 60,000 years 2010, scientists discovered a new kind of human: “Denisovan” Denisovan finger bone Carbon dating: 14C was (½)7.2 ->~7.2 half lives have passed 2010, scientists discovered a new kind of human: “Denisovan” Denisovan finger bone Carbon dating: 14C was (½)7.2 ->~7.2 half lives have passed 7.2 x 5700 y= 41,000 y From the news: Carbon dating reveals whisky fraud, a whiskey from 1863 was made ~2010 How old is a bone with a ratio of 14C to 12C that is 1/16 of present-day animals? Note: The half life of 14C is ~5,700 years  How old is a bone with a ratio of 14C to 12C that is 1/16 of present-day animals. About 22,800 years (4x 5,700) 4 half-lifes of 5,700 years have passed What are some elements that you find in the human body? What are some elements that you find in the human body? C O H N Ca P K S Na Cl Mg + trace elements Elements in the human body Trace elements: Boron, chromium, cobalt, copper, fluorine, iodine, iron, manganese, selenium, silicon, vanadium, zinc What is most important in determining chemical behavior? Hydrogen 2 Atomic Helium 1H He number 2He First Atomic mass 4.003 shell Lithium Beryllium Boron Carbon Nitrogen Oxygen Fluorine Neon 3Li 4Be 5B 6C 7N 8O 9F 10Ne Second shell Sodium Magnesium Aluminum Silicon Phosphorus Sulfur Chlorine Argon 11Na 12Mg 13AI 14SI 15P 16S 17CI 18Ar Third shell Electron distribution diagrams for the first 18 elements in the periodic table Valence electrons electrons in the outermost shell determine chemical behavior elements with full valence shell are chemically inert Noble gas The Energy Levels of Electrons Energy is the capacity to cause ________ An electron’s state of potential energy is called its energy level, or electron shell The Energy Levels of Electrons Energy is the capacity to cause change An electron’s state of potential energy is called its energy level, or electron shell Electrons can absorb and loose energy A ball bouncing down a flight Third shell of stairs can come to rest only on each step, not between steps Second shell Energy absorbed First shell Energy lost Atomic nucleus Electron Orbitals First shell Second shell x y z 1s orbital 2s orbital Three 2p orbitals  7 Where are the electrons in N? N First shell Second shell 14 x y z 1s orbital 2s orbital Three 2p orbitals The 1 s orbital gets filled first 7 N First shell Second shell 14 1 x y z 1s orbital 2s orbital Three 2p orbitals The 1 s orbital gets filled first 7 N First shell Second shell 14 1 2 x y z 1s orbital 2s orbital Three 2p orbitals Then the 2s orbital 7 N First shell Second shell 14 3 1 2 x y z 1s orbital 2s orbital Three 2p orbitals Then the 2s orbital 7 N First shell Second shell 14 3 1 2 x y 4 z 1s orbital 2s orbital Three 2p orbitals Next electron goes into 2px First shell Second shell 3 1 2 5 x y 4 z 1s orbital 2s orbital Three 2p orbitals Electrons repell each other (negative charge), so the next e- does not join the 2px but goes into 2py First shell Second shell 3 1 2 5 x 6 y 4 z 1s orbital 2s orbital Three 2p orbitals The last e- of N goes into the 2pz orbital 7 N First shell Second shell 14 7 3 1 2 5 x 6 y 4 z 1s orbital 2s orbital Three 2p orbitals How many valence electrons? 7 How many unpaired electrons? N First shell Second shell 14 7 3 1 2 5 x 6 y 4 z 1s orbital 2s orbital Three 2p orbitals How many valence electrons? 5 7 How many unpaired electrons? 3 N First shell Second shell 14 7 3 1 2 5 x 6 y 4 z 1s orbital 2s orbital Three 2p orbitals Building Molecules: What chemical bonding between atoms are important for life? Building Molecules: What chemical bonding between atoms are important for life? ▪ Covalent Bonds ▪ Ionic Bonds ▪ Weak Bond  Chemical bonding between atoms ▪ Covalent bonds ▪ Atoms with incomplete valence shells can share valence electrons Covalent Bonds can be polar or non-polar Polar covalent nonpolar covalent  Electronegative elements pull e- toward them increasing electronegativity Atomic Helium e - number Hydrogen 2 1H He 2He First Atomic mass 4.003 shell Lithium Beryllium Boron Carbon Nitrogen Oxygen Fluorine Neon 3Li 4Be 5B 6C 7N 8O 9F 10Ne Second shell Sodium Magnesium Aluminum Silicon Phosphorus Sulfur Chlorine Argon 11Na 12Mg 13AI 14SI 15P 16S 17CI 18Ar Third shell Polar or Name and Electron Lewis Dot Space- Molecular Distribution Structure and Filling non-polar? Formula Diagram Structural Model Formula (a) Hydrogen (H2) H H (b) Oxygen (O2) O O (c) Water (H2O) O H H (d) Methane (CH4) H H C H H Polar or Name and Electron Lewis Dot Space- Molecular Distribution Structure and Filling non-polar? Formula Diagram Structural Model Formula (a) Hydrogen (H2) H H (b) Oxygen (O2) O O (c) Water (H2O) O H polar H (d) Methane (CH4) H H C H H  Ionic Bonds ▪ Atoms sometimes strip electrons from their bonding partners ▪ ->positive cations and negative anions ▪ Compounds formed by ionic bonds are called ionic compounds, or salts + − Na Cl Na Cl Na Cl Na+ Cl− Sodium atom Chlorine atom Sodium ion Chloride ion (a cation) (an anion) Sodium chloride (NaCl) Animation: Ionic Bonds Weak Chemical Interactions ▪ Most of the strongest bonds in organisms are covalent bonds ▪ form a cell’s molecules Weak Chemical Interactions ▪ Most of the strongest bonds in organisms are covalent bonds ▪ form a cell’s molecules ▪ Many large biological molecules are held in their functional form by weak bonds ▪ The reversibility of weak bonds can be an advantage ▪ -> Advantage of Weak Chemical Interactions ▪ Many large biological molecules are held in their functional form by weak bonds ▪ The reversibility of weak bonds can be an advantage ▪ conformational change in proteins ▪ opening DNA double strands Types of weak Chemical Interactions ▪ Hydrogen bonds ▪ Van der Waals interactions  Hydrogen Bonds ▪ form when a hydrogen of a molecule is attracted to another electronegative atom (O, N) δ– δ+ Water (H2O) δ– δ+ Hydrogen bond δ– Ammonia (NH3) δ+ δ+ δ+ BIOL 140A, class 3 ▪ Water and Life Learning objectives ▪ Understand ▪ Molecular bonds important for life ▪ difference between valence and valence electrons ▪ Know ▪ properties of water that support life Building Molecules: What chemical bonding between atoms are important for life? ▪ Covalent Bonds ▪ Ionic Bonds ▪ Weak Bond  Chemical bonding between atoms ▪ Covalent bonds ▪ Atoms with incomplete valence shells can share valence electrons Covalent Bonds can be polar or non-polar Polar covalent nonpolar covalent  Electronegative elements pull e- toward them increasing electronegativity Atomic Helium e - number Hydrogen 2 1H He 2He First Atomic mass 4.003 shell Lithium Beryllium Boron Carbon Nitrogen Oxygen Fluorine Neon 3Li 4Be 5B 6C 7N 8O 9F 10Ne Second shell Sodium Magnesium Aluminum Silicon Phosphorus Sulfur Chlorine Argon 11Na 12Mg 13AI 14SI 15P 16S 17CI 18Ar Third shell Polar or Name and Electron Lewis Dot Space- Molecular Distribution Structure and Filling non-polar? Formula Diagram Structural Model Formula (a) Hydrogen (H2) H H (b) Oxygen (O2) O O (c) Water (H2O) O H H (d) Methane (CH4) H H C H H Polar or Name and Electron Lewis Dot Space- Molecular Distribution Structure and Filling non-polar? Formula Diagram Structural Model Formula (a) Hydrogen (H2) H H (b) Oxygen (O2) O O (c) Water (H2O) O H polar H (d) Methane (CH4) H H C H H  Ionic Bonds ▪ Atoms sometimes strip electrons from their bonding partners ▪ ->positive cations and negative anions ▪ Compounds formed by ionic bonds are called ionic compounds, or salts + − Na Cl Na Cl Na Cl Na+ Cl− Sodium atom Chlorine atom Sodium ion Chloride ion (a cation) (an anion) Sodium chloride (NaCl) Animation: Ionic Bonds Weak Chemical Interactions ▪ Most of the strongest bonds in organisms are covalent bonds ▪ form a cell’s molecules Weak Chemical Interactions ▪ Most of the strongest bonds in organisms are covalent bonds ▪ form a cell’s molecules ▪ Many large biological molecules are held in their functional form by weak bonds ▪ The reversibility of weak bonds can be an advantage ▪ -> Advantage of Weak Chemical Interactions ▪ Many large biological molecules are held in their functional form by weak bonds ▪ The reversibility of weak bonds can be an advantage ▪ conformational change in proteins ▪ opening DNA double strands Types of weak Chemical Interactions ▪ Hydrogen bonds ▪ Van der Waals interactions ▪ …  Hydrogen Bonds ▪ form when a hydrogen of a molecule is attracted to another electronegative atom (O, N) δ– δ+ Water (H2O) δ– δ+ Hydrogen bond δ– Ammonia (NH3) δ+ δ+ δ+ Valences: Hydrogen Oxygen Nitrogen Carbon (valence = ) (valence = ) (valence = ) (valence = ) H O N C Valences: the number of bonds an atom can form Hydrogen Oxygen Nitrogen Carbon (valence = ) (valence = ) (valence = ) (valence = ) H O N C  Valences: the number of bonds an atom can form Hydrogen Oxygen Nitrogen Carbon (valence = 1) (valence = 2) (valence = 3) (valence = 4) H O N C What properties of water contribute to Earth’s suitability for life? What properties of water contribute to Earth’s suitability for life? ▪ cohesion ▪ moderation of temperature ▪ expansion upon freezing ▪ good solvent What properties of water contribute to Earth’s suitability for life? ▪ Cohesive behavior ▪ Sticks together due to ____________ What properties of water contribute to Earth’s suitability for life? ▪ Cohesive behavior ▪ Sticks together due to hydrogen bonds Cohesion of water also explains surface tension Cohesion and Adhesion Water moderates temperature, because of its high specific heat ▪ it absorbs a lot of heat before it gets hot Water’s High Specific Heat ▪ The specific heat of a substance is the amount of heat that must be absorbed ▪ for 1 g to change its temperature by 1ºC ▪ The specific heat of water is 1 cal/(g ºC) ▪ A calorie (cal) is the amount of heat required to raise the temperature of 1 g of water by 1ºC ▪ The “Calories” on food packages are actually kilocalories (kcal); 1 kcal = 1,000 cal Water’s high specific heat keeps temperatures at the coast moderate Evaporative Cooling ▪ Heat of vaporization is the heat a liquid must absorb for 1 g to be converted to gas Floating of Ice on Liquid Water ▪ Water is less dense as a solid than as a liquid Floating of Ice on Liquid Water ▪ hydrogen bonds in ice keep molecules farther apart than in liquid water Polar ice melting: extreme challenge to animals that depend on ice for their survival Water is a versatile solvent due to its polarity ionic compounds polar molecules ▪ When an ionic compound is dissolved in water, each ion is surrounded by a sphere of water molecules called a hydration shell ▪ Water can also dissolve polar molecules  Hydrophilic and Hydrophobic Substances ▪ Water is polar ▪ Polar molecules water: hydrophilic ▪ Non-polar molecules don’t mix well with water: hydrophobic ▪ Lipids, oil When looking for life on other planets, we search for liquid water Solute Concentration in Aqueous Solutions ▪ Most chemical reactions in organisms involve solutes dissolved in water ▪ When carrying out experiments, we use mass to calculate the number of solute molecules in an aqueous solution Molar mass 1 mol = molar mass of particle in g = 6.02  1023 molecules ▪ Avogadro’s number To calculate molar mass, add 11 17 mass numbers: What is the molar mass of NaCl? Na Cl 22.99 35.45 Molar mass 1 mol = molar mass of particle in g = 6.02  1023 molecules ▪ Avogadro’s number To calculate molar mass, add 11 17 mass numbers: What is the molar mass of NaCl? Na Cl 22.99 35.45 22.99 g + 35.45 g = 58.4 g or you can look up the molecular weight (MW) MW=58.4 Mole and Molarity ▪ Mole (symbol mol) ▪ number of particles ▪ 1 mol= 6.022×10²³ particles ▪ Molar= mol/Liter (symbol M) ▪ A unit of concentration ▪ How would you make 1 L of a 1 M (“molar”) solution of NaCl? NaCl MW 58.4 ▪ How would you make 1 L of a 1 M (“molar”) solution of NaCl? ▪ 58.4 g NaCl in 1 L H2O NaCl MW 58.4  Acidic and basic conditions affect living organisms ▪ What are acids? ▪ What are bases?  Acidic and basic conditions affect living organisms ▪ Acids _______the H+ concentration of a solution ▪ H+ donors ▪ Bases _______ the H+ concentration ▪ H+ acceptors  Acidic and basic conditions affect living organisms ▪ Acids increase the H+ concentration of a solution ▪ H+ donors ▪ Bases decrease the H+ concentration ▪ H+ acceptors  The pH Scale ▪ The pH of a solution is defined as the negative logarithm of H+ concentration: ▪ –log [H+]  The pH Scale ▪ The pH of a solution is defined as the negative logarithm of H+ concentration: ▪ –log [H+] ▪ For a neutral aqueous solution, [H+] is 10–7, so pH =  The pH Scale ▪ The pH of a solution is defined as the negative logarithm of H+ concentration: ▪ –log [H+] ▪ For a neutral aqueous solution, [H+] is 10–7, so pH = 7 ▪ What is the pH if the concentration of protons [H+] is 10–6 (1 H+ for every 1 Million H2O molecules?) ▪ What is the pH if the concentration of protons [H+] is 10–6 (1 H+ for every 1 Million H2O molecules?) ▪ pH6 ▪ Do you know any acids and bases?  pH Scale 0 1 Battery acid Increasingly Acidic 2 Gastric juice (in stomach), lemon juice [H+] > [OH–] 3 Vinegar, wine, cola Acidic 4 Tomato juice solution Beer 5 Black coffee Rainwater 6 Urine Saliva Neutral 7 Pure water [H+] = [OH–] Human blood, tears 8 Seawater Neutral Inside small intestine solution Increasingly Basic 9 [H+] < [OH–] 10 Milk of magnesia 11 Household ammonia 12 Basic solution Household 13 bleach Oven cleaner 14  Buffers maintain fairly neutral pH in cells ▪ Buffers minimize changes in H+ concentrations ▪ weak acid and conjugate base can give and take H+ Carbonic acid Bicarbonate Acidification: A Threat to Our Oceans ▪ Human activities such as burning fossil fuels threaten water quality Acidification: A Threat to Our Oceans ▪ About 25% of generated CO2 is absorbed by the oceans ▪ CO2 dissolved in seawater forms carbonic acid: H2O + CO2 ⇌ H2CO3 Protons compete with carbonate to form bicarbonate ions instead of calcium carbonate ▪ Carbonate is required for calcification by many marine organisms ▪ ocean acidification is likely to cause “profound, ecosystem-wide changes in coral reefs”  BIOL 140A, class 4 ▪ Carbon and Life Learning objectives ▪ Know ▪ what makes carbon so important for life on earth ▪ the 7 most important functional groups of organic molecules ▪ isomers (structural, geometric and enantiomers) What properties of water contribute to Earth’s suitability for life? What properties of water contribute to Earth’s suitability for life? ▪ Cohesive behavior ▪ Sticks together ▪ Ability to moderate temperature ▪ High specific heat ▪ Expansion upon freezing ▪ Ice swims on water ▪ Good solvent  Hydrophilic and Hydrophobic Substances ▪ Water is polar ▪ Polar molecules water: hydrophilic ▪ Non-polar molecules don’t mix well with water: hydrophobic ▪ Lipids, oil soup with olive oil  Acidic and basic conditions affect living organisms ▪ What are acids? ▪ What are bases?  Acidic and basic conditions affect living organisms ▪ Acids increase the H+ concentration of a solution ▪ H+ donors ▪ Bases decrease the H+ concentration ▪ H+ acceptors The pH Scale  The pH Scale ▪ The pH of a solution is defined as the negative logarithm of H+ concentration: –log [H+] The pH Scale ▪ The pH of a solution is defined as the negative logarithm of H+ concentration: ▪ –log [H+] ▪ For a neutral aqueous solution, [H+] is 10–7, so pH = 7  pH Scale 0 1 Battery acid Increasingly Acidic 2 Gastric juice (in stomach), lemon juice [H+] > [OH–] 3 Vinegar, wine, cola Acidic 4 Tomato juice solution Beer 5 Black coffee Rainwater 6 Urine Saliva Neutral 7 Pure water [H+] = [OH–] Human blood, tears 8 Seawater Neutral Inside small intestine solution Increasingly Basic 9 [H+] < [OH–] 10 Milk of magnesia 11 Household ammonia 12 Basic solution Household 13 bleach Oven cleaner 14  Buffers maintain fairly neutral pH in cells ▪ Buffers minimize changes in H+ concentrations ▪ weak acid and conjugate base can give and take H+ Carbonic acid Bicarbonate Acidification: A Threat to Our Oceans ▪ About 25% of generated CO2 is absorbed by the oceans ▪ CO2 dissolved in seawater forms carbonic acid: H2O + CO2 ⇌ H2CO3 Protons compete with carbonate to form bicarbonate ions instead of calcium carbonate CaCO3 is required for calcification by many marine organisms including corals You compare two solutions. Solution A has a pH of 3, solution B a pH of 5. How does the H+ concentration of solution A differ from that in solution B? A B pH 3 pH 5 You compare two solutions. Solution A has a pH of 3, solution B a pH of 5. How does the H+ concentration of solution A differ from that in solution B? 100 x higher [H+] A B pH 3 pH 5 Carbon: The Backbone of Life  Organic chemistry is the study of carbon compounds ▪ Organic compounds contain carbon and have C-H bonds ▪ range from simple molecules to colossal ones titin, a giant protein methane Carbon’s ability to form 4 bonds: ideal building block for complex molecules CH4 Carbon: how many valence electrons? 6 How many unpaired electrons? C First shell Second shell 12 3 1 2 5 x 6 y 4 z 1s orbital 2s orbital Three 2p orbitals Carbon: how many valence electrons? 4 6 How many unpaired electrons? 2??? C First shell Second shell 12 3 1 2 5 x 6 y 4 z 1s orbital 2s orbital Three 2p orbitals Orbital hybridization theory 6 ->4 unpaired electrons C First shell Second shell 12 3 1 2 5 x 6 y 4 orbital hybridization z 1s orbital 2s orbital Three 2p orbitals  Valence of carbon is typically 4 ->carbon can form 4 bonds; ideal building block Hydrogen Oxygen Nitrogen Carbon (valence = 1) (valence = 2) (valence = 3) (valence = 4) H O N C carbon dioxide hydrogencyanide methane formaldehyde  Wide variation of carbon “skeletons” carbon (dark)  Wide variation of carbon “skeletons” vary in length single and double bonds linear or ring form can branch Building blocks Hydrocarbons ▪ Hydrocarbons consists of only carbon and hydrogen ▪ Hydrocarbons can release large amounts of energy The hydrocarbon chain of a fatty acid stores lots of energy Fat has 3 hydrocarbon chains which store lots of energy Nucleus Fat droplets 10 µm (a) Part of a human adipose cell (b) A fat molecule Isomers are compounds with the same molecular formula but different structures Structural isomers: Enantiomers: mirror images different bonds Pentane 2-Methylbutane L isomer D isomer Geometric isomers, such as Cis-trans isomers: different rotation cis isomer: trans isomer: The two Xs are on The two Xs are the same side. on opposite sides. Enantiomers are important in the pharmaceutical industry ▪ Two enantiomers of a drug may have different effects ▪ Usually, only one enantiomer is biologically active Enantiomer: L-Dopa A few chemical groups are key to molecular function Estradiol Testosterone -OH: hydroxyl group =O: carbonyl group -CH3: methyl group ▪ The 7 functional groups that are most important in the chemistry of life are the following:  Chemical Group Compound Name Examples Hydroxyl group (—OH) Alcohol Ethanol Carbonyl group ( C ═ O) Ketone Aldehyde Acetone Propanal Carboxyl group (—COOH) Carboxylic acid or organic acid Acetic acid Amino group (—NH2) Amine Glycine © 2017 Pearson Education, Inc. Figure 4.9b Chemical Group Compound Name Examples Sulfhydryl group (—SH) Thiol Cysteine Phosphate group Organic (—OPO32−) phosphate Glycerol phosphate Methyl group (—CH3) Methylated compound 5-Methylcytosine © 2017 Pearson Education, Inc. How did organic molecules form before life evolved? Organic Molecules and the Origin of Life on Earth: Miller - Urey experiment Organic Molecules and the “Atmosphere” CH4 Origin of Life on Earth: Water vapor Miller - Urey experiment Electrode Condenser Cooled “rain” containing Cold organic water molecules H2O “sea” Sample for chemical analysis Results of Miller/Urey experiments: variety of organic molecules including amino acids  Instead of forming in the atmosphere first organic compounds on Earth may have formed near submerged volcanoes deep-sea vents  Amino acid synthesis in simulated atmosphere (1953) or volcano (2008) 20 200 Mass of amino amino acids Number of acids (mg) 10 100 0 0 1953 2008 1953 2008  Extraterrestrial Sources of Organic Compounds? Carbon compounds are common in meteorites that landed on Earth Organic molecules may have originated ▪ in the atmosphere ▪ at deep-sea vents ▪ extraterrestrial  BIOL 140A, class 5 ▪ Macromolecules I ▪ Carbohydrates & lipids Learning objectives ▪ Understand ▪ how polymers are made ▪ general structures, characteristics and functions of ▪ Carbohydrates ▪ Lipids Small organic molecules can be building blocks for macromolecules ▪ What macromolecules do you know? macromolecules ▪ DNA, RNA ▪ Proteins ▪ Polysaccharides ▪ Lipids Which of these are true polymers (made by adding monomers)? ▪ DNA, RNA ▪ Proteins ▪ Polysaccharides ▪ Lipids Which of these are true polymers (made by adding monomers)? ▪ DNA, RNA ▪ Proteins ▪ Polysaccharides ▪ Lipids Polymerization to macromolecules ▪ A polymer is a long molecule consisting of many monomers (similar building blocks) DNA Polysaccharide protein Synthesizing a polymer: __________? 1 2 3 monomer forming a new bond H2O 1 2 3 4 Breaking down a polymer: ___________? 1 2 3 4 H2O breaking a bond 1 2 3 H Synthesizing a polymer: Dehydration 1 2 3 monomer forming a new bond H2O 1 2 3 4 Breaking down a polymer: ____________ 1 2 3 4 H2O breaking a bond 1 2 3 H Synthesizing a polymer: Dehydration 1 2 3 monomer forming a new bond H2O 1 2 3 4 Breaking down a polymer: Hydrolysis 1 2 3 4 H2O breaking a bond 1 2 3 H What are carbohydrates? Carbohydrates serve as fuel and building material ▪ simple carbohydrates are sugars (monosaccharides and disaccharides) ▪ Carbohydrate macromolecules are polysaccharides, polymers composed of many sugar building blocks starch  Sugars ▪ Monosaccharides ▪ usually multiples of CH2O ▪ Glucose (C6H12O6) most common monosaccharide Monosaccharides are classified by the location of carbonyl group (aldose or ketose) number of carbons in the carbon skeleton Aldose Ketose (Aldehyde Sugar) (Ketone Sugar) Pentoses: five-carbon sugars (C5H10O5) Ribose Ribulose What type of isomer are these? Aldose Ketose (Aldehyde Sugar) (Ketone Sugar) Pentoses: five-carbon sugars (C5H10O5) Ribose Ribulose Structural isomers: same chemical formula, but different bonds Aldose Ketose (Aldehyde Sugar) (Ketone Sugar) Pentoses: five-carbon sugars (C5H10O5) Ribose Ribulose Hexoses: 6 C Aldose Ketose (Aldehyde Sugar) (Ketone Sugar) Hexoses: six-carbon sugars (C6H12O6) Glucose Galactose Fructose What type of isomers are these? Aldose Ketose (Aldehyde Sugar) (Ketone Sugar) Hexoses: six-carbon sugars (C6H12O6) Glucose Galactose Fructose What type of isomers are these? Aldose Ketose (Aldehyde Sugar) (Ketone Sugar) Hexoses: six-carbon sugars (C6H12O6) Glucose Galactose Fructose Geometric isomers Structural isomer In solutions many monosaccharides form rings linear and ring form of glucose Formation of Disaccharides: H2O Glucose Glucose H2O Glucose Fructose Formation of Disaccharides: Dehydration Glucose H2O Glucose Maltose H2O Glucose Fructose Sucrose Formation of Disaccharides  Polysaccharides ▪ polymers of sugars Starch: linkage of α glucose Cellulose: linkage of β glucose What are some consequences of this difference? Starch: linkage of α glucose Cellulose: linkage of β glucose  What are some consequences of this difference? We can digest starch with amylases helix We can NOT digest cellulose (“fiber”) straight because we lack the enzyme “cellulase” But grass-eating mammals don’t have cellulase, so how can these live on a green diet (mostly cellulose)? Microorganisms (with cellulase) help digestion What are functional differences between: Starch Glycogen Cellulose What are functional differences between starch, cellulose, and glycogen? Energy storage in plants Starch Energy storage in muscles Glycogen Cell wall in plants Cellulose Why should we not eat much of these? processed carbohydrates: starch & sugar, but little fiber (cellulose), increase risk of Digestion of starch O O O O O hydrolysis by amylase O O maltose hydrolysis by maltase glucose Diabetes Lipids are a diverse group of hydrophobic molecules ▪ Not true polymers ▪ Mostly hydrocarbons ▪ The most biologically important lipids are ▪ fats (triglycerides) ▪ phospholipids ▪ steroids Fats: triglycerides ▪ Glycerol ▪ 3-carbon alcohol with 3 OH-groups ▪ fatty acid ▪ carboxyl group attached to long carbon skeleton Triglycerides are formed by dehydration Triglycerides are formed by dehydration  Ester linkage (between carboxyl and OH group) H2O Glycerol Fatty acids Fat molecule (triglyceride) Why are fats so calorific? Why are fats so calorific? ▪ Lots of energy stored in the hydrocarbon bonds What’s the difference? Saturated fat Unsaturated fat No double bonds in fatty acid chains double bond causes bending What do these fatty acids have in common, what is different? What do these fatty acids have in common, what is different? both are mono-unsaturated cis double bond and trans double bond cis-fatty acids trans-fatty acids: Trans fats, intake associated with heart disease cis-fatty acids: good trans-fatty acids: bad rare in nature, Artificially produced from unsaturated vegetable oil Animation: Fats major function of fats: energy storage ▪ Humans and other mammals store their long- term food reserves in adipose cells ▪ Adipose tissue also cushions vital organs and insulates the body Phospholipids ▪ glycerol ▪ 2 fatty acids ▪ hydrophobic ▪ 1 phosphate group ▪ hydrophilic phospholipids Hydrophilic head Choline amphipathic: Phosphate hydrophobic Glycerol & hydrophilic Fatty acids Hydrophobic tails Kink due to cis double bond What happens when you mix phospholipids in water? phospholipids + water ➔ self-assemble into bilayers ▪ Steroids are lipids characterized by a carbon skeleton consisting of 4 fused rings ▪ Cholesterol ▪ component in animal cell membranes ▪ regulates fluidity ▪ precursor from which other steroids are synthesized ▪ is there good and bad cholesterol? LDL HDL ▪ There is only one type of cholesterol, ▪ but it can be transported by different lipoproteins (low-density and high density) ▪ we will discuss this more in ch 7  BIOL140A, class 6 Macromolecules (continued) Learning outcomes Know general molecular structures, characteristics and functions of – lipids – Proteins – DNA and RNA  Lipids are a diverse group of hydrophobic molecules Not true polymers Mostly hydrocarbons The most biologically important lipids are – fats (triglycerides) – phospholipids – steroids  Ester linkage (between carboxyl and OH group) H2O Glycerol Fatty acids Fat molecule (triglyceride) What’s the difference? Saturated fat Unsaturated fat No double bonds in fatty acid chains double bond causes bending What do these fatty acids have in common, what is different? What do these fatty acids have in common, what is different? both are mono-unsaturated cis double bond and trans double bond cis-fatty acids trans-fatty acids: Trans fats, intake associated with heart disease cis-fatty acids: good trans-fatty acids: bad rare in nature, Artificially produced from unsaturated vegetable oil Animation: Fats major function of fats: energy storage Humans and other mammals store their long- term food reserves in adipose cells Adipose tissue also cushions vital organs and insulates the body  Phospholipids glycerol – 2 fatty acids hydrophobic – 1 phosphate group hydrophilic  Hydrophilic head phospholipids Choline Phosphate amphipathic: Glycerol hydrophobic & hydrophilic Hydrophobic tails Fatty acids Kink due to cis double bond What happens when you mix phospholipids in water? phospholipids + water ➔ self-assemble into bilayers  Steroids are lipids characterized by a carbon skeleton consisting of 4 fused rings – Cholesterol component in animal cell membranes –regulates fluidity precursor from which other steroids are synthesized  is there good and bad cholesterol? LDL HDL  There is only one type of cholesterol, but it can be transported by different lipoproteins (low-density and high density) – we will discuss this more in ch 7  Proteins what are some functions of proteins; do you know examples?  Various protein functions Enzymatic proteins Protection against disease Example: Amylase Example: Antibodies Antibodies Enzyme Virus Bacterium Storage proteins Transport proteins Function: Storage of amino acids Function: Transport of substances , Examples: Casein (in milk) Examples: Hemoglobin Ovalbumin Ovalbumin Transport protein Amino acids for embryo Cell membrane Hormonal proteins Receptor proteins Function: , Coordination of an organism’s Activities Function: Response of cell to Example: Insulin Chemical stimuli Normal Signaling molecules Nerve cell blood sugar Contractile and motor proteins Structural proteins Function: Movement Function: Support Examples: Actin and myosin: Examples: Keratin in hair, contraction of muscles. horns, feathers, Collagen in connective Actin Myosin tissues. Collagen Muscle tissue Connective tissue  Structure of proteins one or more polypeptide chains – polymers built from set of 20 amino acids – unbranched  Amino acid Side chain (R group) α carbon  Amino acid Side chain (R group) α carbon Amino Carboxyl group group Side chain (R group) Glycine Alanine Valine Leucine Isoleucine (Gly or G) (Ala or A) (Val or V) (Leu or L) (Ile or I) Methionine Phenylalanine Tryptophan Proline (Met or M) (Phe or F) (Trp or W) (Pro or P) Nonpolar side chains; hydrophobic Side chain (R group) Glycine Alanine Valine Leucine Isoleucine (Gly or G) (Ala or A) (Val or V) (Leu or L) (Ile or I) Methionine Phenylalanine Tryptophan Proline (Met or M) (Phe or F) (Trp or W) (Pro or P)  Serine Threonine Cysteine (Ser or S) (Thr or T) (Cys or C) Tyrosine Asparagine Glutamine (Tyr or Y) (Asn or N) (Gln or Q) Polar (but not charged) side chains; hydrophilic Serine Threonine Cysteine (Ser or S) (Thr or T) (Cys or C) Tyrosine Asparagine Glutamine (Tyr or Y) (Asn or N) (Gln or Q) Electrically charged side chains; hydrophilic Basic (positively charged) Acidic (negatively charged) Aspartate Glutamate Lysine Arginine Histidine (Asp or D) (Glu or E) (Lys or K) (Arg or R) (His or H)  Polypeptides (Amino Acid Polymers) polymer of amino acids – peptide bonds unique sequence of amino acids – N to C terminus  peptide bonds formed by ___________? Peptide bond H2O New peptide bond forming Side chains (R groups) Back- bone Peptide Amino end bond Carboxyl end (N-terminus) (C-terminus)  peptide bonds formed by dehydration Peptide bond H2O New peptide bond forming Side chains (R groups) Back- bone Peptide Amino end bond Carboxyl end (N-terminus) (C-terminus) Protein structure has 4 levels  Primary Structure Amino acids 1 5 10 Amino end 30 25 20 15 Animation: Secondary Protein Structure  Quaternary Secondary Tertiary (kwaa·tur·neh·ree) Structure Structure Structure α helix α helix Hydrogen bond β pleated β strand sheet Hydrogen bond β pleated sheet Quaternary Structure of hemoglobin Heme Iron β subunit α subunit α subunit β subunit  Sickle-Cell Disease inherited blood disorder abnormal hemoglobin aggregates deform red blood cells into a sickle shape 1 letter difference How are these amino acids different? changed to Glutamate Valine  Non-polar ->hydrophobic Polar/charged (sticks to other ->hydrophilic hydrophobic groups) changed to Glutamate Valine  Primary Secondary Quaternary Function Red Blood Cell Structure and Tertiary Structure Shape 1 carry oxygen Normal 2 3 β 4 α 5 6 7 β α Sickle-cell β carry less oxygen Sickle-cell 1 subunit 2 3 β 4 5 α 6 7 β α  Protein Folding in the Cell diseases such as – Alzheimer’s – Parkinson’s – mad cow disease are associated with misfolded proteins Prion diseases, such as Bovine spongiform encephalopathy (mad cow disease), caused by misfolded proteins normal disease-causing form beta sheets can form stable cross-beta aggregates disease-causing form catalyzes misfolding of healthy form cross beta aggregates aggregation  The Roles of Nucleic Acids There are two types of nucleic acids – Deoxyribonucleic acid (DNA) – Ribonucleic acid (RNA) How are these different? DNA RNA Double-stranded Double helix Sugar of backbone is a deoxy ribose A, C, G, T same in cells of individual DNA RNA Double-stranded Single-stranded Double helix Sugar of backbone is a deoxy ribose A, C, G, T same in cells of individual DNA RNA Double-stranded Single-stranded Double helix Various secondary structures Sugar of backbone is a deoxy ribose A, C, G, T same in cells of individual  Secondary structure of DNA and RNA 5′ 3′ Base pair joined G by hydrogen bonding C C G A T C G G G C U C A T A 3′ 5′ Base pair joined by hydrogen bonding DNA: double helix RNA: localized base pairing, -> wide variety of structures DNA RNA Double-stranded Single-stranded Double helix Various secondary structures Sugar of backbone is Sugar of backbone is a deoxy ribose a ribose A, C, G, T same in cells of individual DNA RNA Double-stranded Single-stranded Double helix Various secondary structures Sugar of backbone is Sugar of backbone is a deoxy ribose a ribose A, C, G, T A, C, G, U same in cells of individual DNA RNA Double-stranded Single-stranded Double helix Various secondary structures Sugar of backbone is Sugar of backbone is a deoxy ribose a ribose A, C, G, T A, C, G, U same in cells of amount varies, individual depending on gene expression  Gene expression (more detail in Ch 17) 1 NUCLEUS CYTOPLASM  Gene expression 1 Synthesis Of mRNA Transcription NUCLEUS CYTOPLASM  Gene expression NUCLEUS CYTOPLASM 2 Movement mRNA of mRNA into cytoplasm  Gene expression CYTOPLASM Ribosome 3 Translation Synthesis of protein Polypeptide Amino acids  The Components of Nucleic Acids Nucleic acids are polymers of nucleotides Sugar-phosphate backbone 5′ end nucleic acid Nucleotide Nitrogenous base 5′C 1′C Phosphate 3′C group Sugar (pentose) 3′ end Nucleotides are linked together by phosphodiester bonds Dehydration + H2O Phosphodiester bond The sugar-phosphate backbones of DNA run in opposite directions (antiparallel)  To simplify, we often just write the bases of 1 strand of DNA in 5’->3’ direction >FN297864.1 Escherichia coli partial lacZ gene CGCTGTGGTACACGCTGTGCGACCGCTACGGCCTGTATGTG GTGGATGAAGCCAATATTGAAACCCACGGCATGGTGCCAAT GAATCGTCTGACCGATGATCCGCGCTGGCTACCGGCGATGA GCGAACGCGTAACGCGAATGGTGCAGCGCGATCGTAATCAC CCGAGTGTGATCATCTGGTCGCTGGGGAATGAATCAGGCCA CGGCGCTAATCACGACGCGCTGTATCGCTGGATCAAATCTG TCGATCCTTCCCGCCCGGTGCAGTATGAAGGCGGCGGAGCC GACACCACGGCCACCGATATTATTTGCCCGATGTACGCGCG CGTGGATGAAGACCAGCCCTTCCCGGCTGTGCCGAAATGGT CCATCAAAAAATGGCTTTCGCTACCTGGAGAGACGCGCCCG CTGATCCTTTGCGAATACGCCCACGCGAGGGTAACAGTCTT GGCGGTTTCGCTAAATAC…  NITROGENOUS BASES Pyrimidines Cytosine (C) Thymine Uracil (T, in DNA) (U, in RNA) Purines Adenine (A) Guanine (G)  SUGARS Deoxyribose Ribose (in DNA) (in RNA) Animation: DNA and RNA Structure  BIOL140A, class 7 Nucleic Acids – DNA – RNA – Gene expression How did organic molecules form before life existed? Cells – Prokaryotic  BIOL140A, class 7 Main learning outcomes Review proteins Know general molecular structures and characteristics of – Nucleic Acids: DNA & RNA – How did small organic molecules form before life evolved? Understand – the concept of gene expression  Primary Secondary Quaternary Function Red Blood Cell Structure and Tertiary Structure Shape 1 carry oxygen Normal 2 3 β 4 α 5 6 7 β α Sickle-cell β carry less oxygen Sickle-cell 1 subunit 2 3 β 4 5 α 6 7 β α 2024 May 6 Collecting blood- forming stem cells Correcting mutation, e.g. via CRISPR Transplantation back to patient 2024 Oct 21 ~ $3.1 million treatment, currently ~ 30 patients  Protein Folding in the Cell diseases such as – Alzheimer’s – Parkinson’s – mad cow disease are associated with misfolded proteins Prion diseases, such as Bovine spongiform encephalopathy (mad cow disease), caused by misfolded proteins normal disease-causing form beta sheets can form stable cross-beta aggregates disease-causing form catalyzes misfolding of healthy form cross beta aggregates aggregation  The Roles of Nucleic Acids There are two types of nucleic acids – Deoxyribonucleic acid (DNA) – Ribonucleic acid (RNA) How are these different? DNA RNA Double-stranded Double helix Sugar of backbone is a deoxy ribose A, C, G, T same in cells of individual DNA RNA Double-stranded Single-stranded Double helix Sugar of backbone is a deoxy ribose A, C, G, T same in cells of individual DNA RNA Double-stranded Single-stranded Double helix Various secondary structures Sugar of backbone is a deoxy ribose A, C, G, T same in cells of individual  Secondary structure of DNA and RNA 5′ 3′ Base pair joined G by hydrogen bonding C C G A T C G G G C U C A T A 3′ 5′ Base pair joined by hydrogen bonding DNA: double helix RNA: localized base pairing, -> wide variety of structures DNA RNA Double-stranded Single-stranded Double helix Various secondary structures Sugar of backbone is Sugar of backbone is a deoxy ribose a ribose A, C, G, T same in cells of individual DNA RNA Double-stranded Single-stranded Double helix Various secondary structures Sugar of backbone is Sugar of backbone is a deoxy ribose a ribose A, C, G, T A, C, G, U same in cells of individual DNA RNA Double-stranded Single-stranded Double helix Various secondary structures Sugar of backbone is Sugar of backbone is a deoxy ribose a ribose A, C, G, T A, C, G, U same in cells of amount varies, individual depending on gene expression  Gene expression (more detail in Ch 17) 1 NUCLEUS CYTOPLASM  Gene expression 1 Synthesis Of mRNA Transcription NUCLEUS CYTOPLASM  Gene expression NUCLEUS CYTOPLASM 2 Movement mRNA of mRNA into cytoplasm  Gene expression CYTOPLASM Ribosome 3 Translation Synthesis of protein Polypeptide Amino acids  The Components of Nucleic Acids Nucleic acids are polymers of nucleotides Sugar-phosphate backbone 5′ end nucleic acid Nucleotide Nitrogenous base 5′C 1′C Phosphate 3′C group Sugar (pentose) 3′ end Nucleotides are linked together by phosphodiester bonds Dehydration + H2O Phosphodiester bond The sugar-phosphate backbones of DNA run in opposite directions (antiparallel)  To simplify, we often just write the bases of 1 strand of DNA in 5’->3’ direction >FN297864.1 Escherichia coli partial lacZ gene CGCTGTGGTACACGCTGTGCGACCGCTACGGCCTGTATGTG GTGGATGAAGCCAATATTGAAACCCACGGCATGGTGCCAAT GAATCGTCTGACCGATGATCCGCGCTGGCTACCGGCGATGA GCGAACGCGTAACGCGAATGGTGCAGCGCGATCGTAATCAC CCGAGTGTGATCATCTGGTCGCTGGGGAATGAATCAGGCCA CGGCGCTAATCACGACGCGCTGTATCGCTGGATCAAATCTG TCGATCCTTCCCGCCCGGTGCAGTATGAAGGCGGCGGAGCC GACACCACGGCCACCGATATTATTTGCCCGATGTACGCGCG CGTGGATGAAGACCAGCCCTTCCCGGCTGTGCCGAAATGGT CCATCAAAAAATGGCTTTCGCTACCTGGAGAGACGCGCCCG CTGATCCTTTGCGAATACGCCCACGCGAGGGTAACAGTCTT GGCGGTTTCGCTAAATAC…  NITROGENOUS BASES Pyrimidines Cytosine (C) Thymine Uracil (T, in DNA) (U, in RNA) Purines Adenine (A) Guanine (G)  SUGARS Deoxyribose Ribose (in DNA) (in RNA) Animation: DNA and RNA Structure How did organic molecules form before life evolved? Organic Molecules and the Origin of Life on Earth: Miller - Urey experiment Organic Molecules and the Origin of Life on “Atmosphere” Earth: CH4 Miller - Urey experiment Water vapor Electrode Condenser Cooled “rain” containing Cold organic water molecules H2O “sea” Sample for chemical analysis Results of Miller/Urey experiments: variety of organic molecules – including amino acids  Instead of forming in the atmosphere first organic compounds on Earth may have formed near submerged volcanoes deep-sea vents  Amino acid synthesis in simulated atmosphere (1953) or volcano (2008) 20 200 Mass of amino amino acids Number of acids (mg) 10 100 0 0 1953 2008 1953 2008  Extraterrestrial Sources of Organic Compounds? Carbon compounds are common in meteorites that landed on Earth  Organic molecules may have originated in the atmosphere at deep-sea vents extraterrestrial  Cells: The Fundamental Units of Life All organisms are made of cells Simplest unit of life Cells can differ substantially, but share common features  Cells: The Fundamental Units of Life All organisms are made of cells Simplest unit of life Cells can differ substantially, but share common features – DNA as genetic material – cell membrane – ribosomes – cytoplasm How large are cells?  Most cells are in the micrometer range Electron microscopy Super- Light microscopy resolution microscopy Unaided eye Nucleus Length Most Smallest Small of some Most bacteria bacteria Proteinsmolecules nerve plant Viruses and and muscle Chicken Frog Human animal Mito- Ribo- cells egg egg egg cells chondrion somes Lipids Atoms 10 m 1m 0.1 m 1 cm 1 mm 100 μm 10 μm 1 μm 100 nm 10 nm 1 nm 0.1 nm  Limitation of resolution for light microscopy resolution cannot be smaller than half of the wavelength of visible light 200 nm limit  Physical and computational breakthroughs allow super-resolved fluorescence microscopy Physical and computational breakthroughs - >super-resolved fluorescence microscopy Super-resolution microscopy allows to distinguish structures as small as 10–20 nm across  Two basic types of electron microscopes SEM of a blood clot TEM of an animal cell 20 um  Two basic types of electron microscopes SEMs focus beam of electrons onto surface -> 3-D – Scanning EM TEMs focus beam of electrons through specimen – Transmission EM SEM of a blood clot TEM of an animal cell 20 um  Cells What are the 3 domains of life? The 3 domains of life  The 3 domains of life prokaryotes  Prokaryotic cells are characterized by lacking Prokaryotoic cell, Colorized transmission electron microscopy (TEM)  Prokaryotic cells are characterized by lacking – a nucleus DNA in an unbound region called the nucleoid – membrane-bound organelles  Prokaryotic cell Fimbriae Nucleoid Ribosomes Plasma membrane Bacterial Cell wall chromosome 0.5 μm Flagella (a) A typical rod-shaped (b) A thin section through the bacterium bacterium Corynebacterium diphtheriae (colorized TEM)  BIOL140A, class 8 A tour of the cell  Reminder: Midterm Feb 20 (Th) Bring green scantron Pencil #2, eraser Closed book Notes: one page (single-sided) Calculator recommended (no phone) During regular lecture time ~25 multiple choice questions Practice exam posted on Canvas  BIOL140A, class 8 Main learning outcomes Know – about microscopy and the size of cells – features that distinguish prokaryotic and eukaryotic cells Recognize main cellular components and know their functions How large are cells?  Most cells are in the micrometer range Electron microscopy Super- Light microscopy resolution microscopy Unaided eye Nucleus Length Most Smallest Small of some Most bacteria bacteria Proteinsmolecules nerve plant Viruses and and muscle Chicken Frog Human animal Mito- Ribo- cells egg egg egg cells chondrion somes Lipids Atoms 10 m 1m 0.1 m 1 cm 1 mm 100 μm 10 μm 1 μm 100 nm 10 nm 1 nm 0.1 nm  Limitation of resolution for light microscopy resolution cannot be smaller than half of the wavelength of visible light 200 nm limit  Physical and computational breakthroughs allow super-resolved fluorescence microscopy Physical and computational breakthroughs - >super-resolved fluorescence microscopy Super-resolution microscopy allows to distinguish structures as small as 10–20 nm across  Two basic types of electron microscopes SEM of a blood clot TEM of an animal cell 20 um  Two basic types of electron microscopes SEMs focus beam of electrons onto surface -> 3-D – Scanning EM TEMs focus beam of electrons through specimen – Transmission EM SEM of a blood clot TEM of an animal cell 20 um What are the 3 domains of life? The 3 domains of life  The 3 domains of life prokaryotes  Prokaryotic cells are characterized by lacking – __________ – ___________ Colorized transmission electron microscopy (TEM)  Prokaryotic cells are characterized by lacking – a nucleus – membrane-bound organelles  Prokaryotic cells are characterized by lacking – a nucleus DNA in an unbound region called the nucleoid – membrane-bound organelles  Prokaryotic cell Fimbriae Nucleoid Ribosomes Plasma membrane Bacterial Cell wall chromosome 0.5 μm Flagella (a) A typical rod-shaped (b) A thin section through the bacterium bacterium Corynebacterium diphtheriae (colorized TEM) Eukaryotic cells Animal cell Animal cell Nuclear envelope Nucleolus NUCLEUS Chromatin Animal cell Nuclear envelope Nucleolus NUCLEUS Chromatin Plasma membrane Animal cell Nuclear envelope Nucleolus NUCLEUS Chromatin  ENDOPLASMIC RETICULUM (ER) Animal cell Nuclear Rough ER Smooth ER envelope Nucleolus NUCLEUS Chromatin Plasma membrane Ribosomes Golgi apparatus  ENDOPLASMIC RETICULUM (ER) Animal cell Nuclear Rough ER Smooth ER envelope Nucleolus NUCLEUS Chromatin Plasma membrane Ribosomes Golgi apparatus Peroxisome Lysosome  ENDOPLASMIC RETICULUM (ER) Animal cell Nuclear Rough ER Smooth ER envelope Nucleolus NUCLEUS Chromatin Plasma membrane Ribosomes Golgi apparatus Peroxisome Lysosome  ENDOPLASMIC RETICULUM (ER) Animal cell Nuclear Rough ER Smooth ER envelope Nucleolus NUCLEUS Chromatin Plasma membrane Ribosomes Golgi apparatus Peroxisome Lysosome Mitochondrion  ENDOPLASMIC RETICULUM (ER) Animal cell Nuclear Rough ER Smooth ER envelope Nucleolus NUCLEUS Chromatin Plasma membrane Ribosomes Golgi apparatus Peroxisome Lysosome Mitochondrion  ENDOPLASMIC RETICULUM (ER) Animal cell Nuclear Rough ER Smooth ER envelope Nucleolus NUCLEUS Chromatin Plasma membrane Ribosomes Microvilli Golgi apparatus Peroxisome Lysosome Mitochondrion  ENDOPLASMIC RETICULUM (ER) Animal cell Nuclear Rough ER Smooth ER envelope Nucleolus NUCLEUS Chromatin Plasma membrane Ribosomes Microvilli Golgi apparatus Peroxisome Lysosome Mitochondrion  ENDOPLASMIC RETICULUM (ER) Animal cell Nuclear Rough ER Smooth ER envelope Nucleolus NUCLEUS Chromatin Centrosome Plasma membrane CYTOSKELETON: Microfilaments Intermediate filaments Microtubules Ribosomes Microvilli Golgi apparatus Peroxisome Lysosome Mitochondrion  ENDOPLASMIC RETICULUM (ER) Animal cell Nuclear Rough ER Smooth ER envelope Nucleolus NUCLEUS Flagellum Chromatin Centrosome Plasma membrane CYTOSKELETON: Microfilaments Intermediate filaments Microtubules Ribosomes Microvilli Golgi apparatus Peroxisome Lysosome Mitochondrion What type of cell is this? Plant cell What is different to animal cells  Plant cell Central vacuole Chloroplast Cell wall Plasmodesmata Wall of adjacent cell  Nuclear envelope Plant cell NUCLEUS Nucleolus Rough ER Chromatin Smooth ER Ribosomes Golgi Central vacuole apparatus Microfilaments CYTOSKELETON Microtubules Mitochondrion Peroxisome Plasma membrane Chloroplast Cell wall Plasmodesmata Wall of adjacent cell The Nucleus Nucleolus Nucleus Chromatin Nuclear envelope: Outer membrane Inner membrane Nuclear pore Rough ER Pore complex Ribosome Close-up of nuclear Chromatin envelope The endomembrane system regulates protein traffic and performs metabolic functions in the cell The endomembrane system consists of The endomembrane system regulates protein traffic and performs metabolic functions in the cell The endomembrane system consists of – Nuclear envelope – Endoplasmic reticulum – Golgi apparatus – Vesicles (such as lysosomes) – Vacuoles – Plasma membrane  Cell Component Function Endoplasmic reticulum Smooth ER: (Nuclear envelope) Rough ER: Golgi apparatus Lysosome Vacuole  Cell Component Function Endoplasmic reticulum Smooth ER: synthesis of lipids, metabolism of carbohydrates, Ca storage, 2+ (Nuclear detoxification envelope) Rough ER: synthesis of secreted and membrane proteins; adds carbohydrates to proteins to make glycoproteins; produces new membrane Golgi apparatus Lysosome Vacuole  Cell Component Function Endoplasmic reticulum (Nuclear envelope) Golgi apparatus Modification of proteins, phospholipids; synthesis of many polysaccharides; sorting of Golgi products, which are then released In vesicles Lysosome Vacuole  Cell Component Function Endoplasmic reticulum (Nuclear envelope) Golgi apparatus Lysosome Breakdown of ingested substances, cell macromolecules, and damaged organelles for recycling Vacuole  Cell Component Function Endoplasmic reticulum (Nuclear envelope) Golgi apparatus Lysosome Vacuole Digestion, storage, waste disposal, water balance, cell growth, and protection  Ribosomes translate mRNA into protein 0.25 μm Free ribosomes in cytosol Ribosomes ER Endoplasmic reticulum (ER) Ribosomes bound to ER TEM showing ER and ribosomes Large subunit Small subunit Diagram of Computer model a ribosome of a ribosome  Mitochondria: site of cellular respiration Mitochondrion Intermembrane space Outer membrane DNA Inner Free membrane ribosomes in the Cristae mitochondrial matrix Matrix 0.1 μm Chloroplast: Capture of Light Energy Stroma Ribosomes Inner and outer membranes Granum DNA Thylakoid Intermembrane space 1 μm  The theory of endosymbiosis mitochondria and plastids small prokaryotes living within larger host cells Ancestral prokaryote Nucleus engulfed aerobic bacterium  Engulfed aerobic bacterium Mitochondrion Ancestral heterotrophic eukaryote  engulfed photo- synthetic bacterium heterotrophic eukaryote Plastid photosynthetic eukaryote  Evidence for endosymbiont theory?  Evidence for endosymbiont theory? Mitochondria and plastids have double membrane circular DNA ribosomes resembling prokaryotic ribosomes replication by division Human mitochondrial DNA ~16,600 bp 22 tRNA genes 13 coding genes  What is Mitochondrial Disease? genetic disorder 1:2000 individuals in the US symptoms vary between individuals Can affect many body systems – frequent miscarriages Britain was first nation to legalize the “3-parent baby” 1 possibility: transfer of healthy mitochondria  or “nuclear transfer” Donor egg nucleus replaced by mother egg nucleus What is your opinion on 3-parent babies? Should it be legalized in the US Why, or why not?