Laboratory Techniques In DNA Manipulation PDF

20.01.25 [Laboratory Techniques In DNA Manipulation: Lecture 1] [What Is A Gene?] Definition: A gene is a discrete, unit of heredity. What is a gene made up of?: A gene is made up of DNA. What do SOME genes contain?: Some genes contains instructions to make proteins; many others do not. How mu...

20.01.25 [Laboratory Techniques In DNA Manipulation: Lecture 1] [What Is A Gene?] Definition: A gene is a discrete, unit of heredity. What is a gene made up of?: A gene is made up of DNA. What do SOME genes contain?: Some genes contains instructions to make proteins; many others do not. How much protein-coding genes do humans have?: Human have protein-coding made up of 20-25000 genes. How can genes vary in length?: Genes can be a variety of lengths -- Largest genes: Dystrophin 2.3 mega bases OR Smallest gene: Testis determining factor (TDF) -- 14bp. How are Protein-coding genes defines and what do they consist of?: 1. Protein-coding genes are clearly defined START to STOP regions. 2. They have introns (non-coding regions) 3. Have regulatory sequences outside (and occasionally) inside the protein-coding region of the gene. Mine: A gene is a discrete unit of hereditary. It is made up of DNA. Some genes contain instructions to make proteins; while many others do not. Humans have protein-coding made up of 20-25000 genes. Genes also vary in length from largest to smallest. The largest is Dystrophin of 2.3 mega bases and the smallest is Testes determining factor (TDF)-14bp. Protein-coding genes are clearly defined as START to STOP regions. They have introns (non-coding regions). They also consist of regulatory sequences outside (and occasionally) inside the protein-coding region of the gene. ChatGPT's: A gene, the fundamental unit of heredity, is composed of DNA and may or may not contain instructions for protein synthesis. In humans, approximately 20,000 to 25,000 protein-coding genes exist, each varying in length. The largest known gene is dystrophin, spanning 2.3 mega bases, while the smallest is the testis determining factor (TDF), only 14 base pairs. Protein-coding genes are defined by their START and STOP regions, with introns (non-coding sequences) interspersed between exons (coding sequences). Additionally, genes include regulatory sequences, which are typically found outside but occasionally within the coding region, and these sequences play a critical role in controlling gene expression. [What Is A Gene Cloning?] Definition: Taking a gene and making exact copies of it. Is it commonly used?: Yes, it is a common practice in Molecular Biology Laboratories. Why do we clone genes?: 1. To isolate a gene to identify/study it, for example this can include disease related genes -- genetic analysis. And also disease diagnosis e.g. Dystrophin. 2. Manipulating a gene for researching the function of a gene also expressing protein to study in the laboratory. 3. Producing reagents for medicine or industry. What are some uses of genes to produce proteins for therapeutic uses?: 1. Insulin Vaccines 2. Clotting factors 3. Growth hormones 4. Cytokines 5. Anti-cancer drugs 6. Enzymes (Restriction enzymes, Taq) Gene cloning is a widely used technique in molecular biology laboratories, involving the creation of exact copies of a gene. This process is essential for isolating and studying specific genes, such as disease-related ones like dystrophin, which is associated with muscular dystrophy. Gene cloning also facilitates gene manipulation to understand gene functions and express proteins for laboratory research.\ Additionally, cloned genes can be used to produce therapeutic proteins, which play critical roles in medicine and industry. Examples include insulin for diabetes management, clotting factors for haemophilia, growth hormones for developmental disorders, cytokines for immune modulation, anti-cancer drugs, and enzymes like restriction enzymes and Taq polymerase for molecular biology applications. [Genetic Engineering] What is genetic engineering?: It changes the DNA of organisms. What does it result in?: It results in changes to proteins. State some examples of genetic engineering.: Dolly the sheep and GMO organisms. [How to clone a gene?] What is the gene?: Identify the specific gene you want to clone. Where is it from?: Determine the source of the gene (e.g., cell, organism, or tissue). What do you want to do with it?: Define the purpose of cloning (e.g., studying gene function, protein production, therapeutic applications). Steps needed 1. Identification (cell, organism, tissue): to locate the gene of interest from a specific cell, organism, or tissue. 2. Isolation of the gene: Extract the gene from its source using techniques like PCR or restriction enzyme digestion. 3. Insertion into a suitable 'Vector': Incorporate the isolated gene into a suitable vector (e.g.,plasmid). 4. Introduction of the Vector/Gene into an organism -- multiplication: Transfer the vector carrying the gene into a host organism (e.g., bacteria) to enable multiplication and expression. [Definition: **VECTOR**] What is a vector?: A DNA molecule used as a vehicle to carry foreign DNA into a cell or organism. What are the 2 types of vectors?: Vectors can be chromosomal or circular (Plasmids). Types of Vectors: 1. Chromosomal vectors: integrated into host's chromosome. 2. Circular Vectors (Plasmids): independent circular DNA molecules, commonly used in gene cloning. Mine: When cloning a gene, three questions are to be taken into consideration: what is the gene?, where is it from?, what do you want to do with it?. Furthermore, there are steps required 1. Identification (cell, organism, tissue): to locate the gene of interest from a specific cell, organism, or tissue. 2. Isolation of the gene: Extract the gene from its source using techniques like PCR or restriction enzyme digestion. 3. Insertion into a suitable 'Vector': Incorporate the isolated gene into a suitable vector (e.g., plasmid). 4. Introduction of the Vector/Gene into an organism -- multiplication: Transfer the vector carrying the gene into a host organism (e.g., bacteria) to enable multiplication and expression. A vector is a DNA molecules used as a vehicle to carry foreign DNA into a cell or organism. There are two types of vectors: Chromosomal - integrated into host's chromosome or circular (plasmids) - independent circular DNA molecules, commonly used in gene cloning. ChatGPT's: When cloning a gene, three key questions must be considered: What is the gene? Where is it from? What do you want to do with it? The process involves several steps. First, **identification** locates the gene of interest from a specific cell, organism, or tissue. Second, **isolation** extracts the gene from its source using techniques such as polymerase chain reaction (PCR) or restriction enzyme digestion. Third, the isolated gene is **inserted into a suitable vector**, such as a plasmid. Finally, the vector carrying the gene is **introduced into a host organism**, such as bacteria, where it can multiply and potentially express the desired gene product. A vector is a DNA molecule used as a vehicle to carry foreign DNA into a cell or organism. Vectors can be classified into two types: **chromosomal vectors**, which integrate into the host's chromosome, and **circular vectors (plasmids)**, which are independent DNA molecules commonly used in gene cloning due to their versatility and ease of replication. [Making a protein: Basic Concepts] How is proteins synthesised?: DNA RNA PROTEIN What does it need?: Needs a lot of proteins/cofactors to do this - Transcription factors; Translation factors; Ribosomes; and Nucleotides etc. Proteins are synthesized through a two-step process involving transcription and translation. First, DNA is transcribed into RNA, a process requiring transcription factors, nucleotides, and RNA polymerase. Then, RNA is translated into a protein, a step that involves translation factors, ribosomes, and additional cofactors. These molecular components work together to ensure the accurate synthesis of proteins, which are essential for cellular functions. [What do we want to do in Lab techniques??] **What do we want to achieve with lab techniques? - Goal**: Make a recombinant protein encoded by a gene, such as Glutathione S transferase (GST). **What is GST?**: GST is an enzyme that adds glutathione onto other substrates (specific function is not critical for this context). **What does \"recombinant\" mean? - Definition**: Recombinant refers to a cell, organism, or protein produced when DNA segments from different sources are joined together (\"recombined\"). **What are the steps to make recombinant protein?** 1. **Identification of the gene** **Target**: GST. **Why is bioinformatics important?**: To prepare for experimental procedures and to acquire the DNA sequence of GST. **Why do we need the DNA sequence?:** To design reagents for PCR and to determine the gene length (in base pairs) to verify the experiment's success. 2. **Isolation of the gene** **What is PCR? & How is the gene isolated? -** Using **PCR** (Polymerase Chain Reaction). And PCR is a cyclic process developed by Dr. Kary Mullis in 1983 (Nobel Prize, 1993). **What does PCR do?:** It amplifies specific DNA fragments and It's a very sensitive technique capable of amplifying DNA by many orders of magnitude, even from a single DNA sequence in a sample. 3. **Insertion into a suitable vector** **What vector is used?:** A bacterial expression plasmid. 4. **Introduction of the vector/gene into an organism** **What organism is used?:** *E. coli* (a bacterial host). In the lab we want to achieve lab techniques, specifically making a recombinant protein encoded by a gene, such as Glutathione S transferase (GST). GST is an enzyme that adds gluthanione onto other substrates (specific function is not critical for this context). Recombinant DNA refers to a cell, organism, or protein produced when DNA segments from different sources are joined together ("recombined"). There are steps to make recombinant protein, this includes: 1. Identification of the gene, 2. Isolation of the gene, 3. Insertion into a suitable vector, 4. Introduction of the vector/gene into an organism. Firstly, the gene is identified, the target is GST and bioinformatics plays an importance in this as it prepares for experimental procedures and to acquire the DNA sequence of GST. We need the DNA sequence to design reagents for PCR and to determine the gene length (base pairs) to verify the experiment's success. Secondly, the gene is isolated by using PCR (Polymerase Chain Reaction) and the PCR is a cyclic process developed by Dr. Kary Mullis in 1983 (Nobel Prize,1993). The PCR amplifies specific DNA fragments and it's a very sensitive technique capable of amplifying DNA by many orders of magnitude, even from a single DNA sequence in a sample. [What is PCR?] What is an example of DNA amplification?: Process of DNA amplification -- e.g. a gene How is a PCR performed?: In a PCR tube, add reagents that are involved in DNA replication 1. **DNA template** (you need to know the sequence of what you want to amplify) 2. **DNA polymerase** 3. Two '**oligonucleotide primers**' (Small pieces of DNA) 4. **Nucleotides** (DNA building blocks) 5. The polymerase uses the oligonucleotide primers and the DNA template to make more DNA 6. Cycle the temperature (thermocycling) to optimise replication of the DNA What is the purpose of PCR?: it creates many copies of specific DNA fragments for research or practical applications. **[What else do you need for a PCR reaction?]** 2x Oligonucleotide primers; Building blocks of DNA -- dNTPs : deoxyribonucleotide triphosphate - also, this provides the energy for the reaction. A DNA template - Something for the PCR to get started on for the GST practical, this will be provided for you. Buffer to Correct conditions for the enzyme reaction to occur; Buffered pH at 20 mM Tris HCl (pH 8.4), 50 mM KCl, MgCl~2~^\*^. Lastly, A DNA polymerase, which will add dNTPs onto a growing DNA strand. [PCR is a cyclic process Requires changes in Temperature] Temperature is key to PCR: Conversion of dsDNA to ssDNA (95^o^C), Annealing temperature (^o^C depends on primer sequence), Polymerase -- optimal working temperature. Each step requires a different temperature; Cycle through the temperatures to complete a cycle. Cycle of amplification -- duplication of a DNA sequence. Repeat the heating stages again - Get another round of amplification - Using previously generate PCR products as templates - Stages are repeated \~30 times: Exponential increase of the amount of amplified DNA; Heating is bad for enzymes - DNA Polymerase is an enzyme [Use a polymerase that is able to tolerate high temperatures] Isolate a polymerase from an extremophile - *Thermus aquaticus* Taq polymerase is able to survive at high temps, Catalyses DNA polymerisation at 72^o^C, Revolutionised PCR. [At the end of a PCR reaction] You will have many copies of amplified DNA; Need to confirm whether the PCR was successful. Gel electrophoresis -- next lecture Mine - PCR: polymerase chain reaction is a process used for DNA amplification (amplifying a gene). Its purpose is to create many copies of specific DNA fragments for research or practical applications. A PCR is performed in a PCR tube where reagents are added that involved in a DNA replication. The reagents required in this tube is a DNA template (you need to know the sequence of what you want to amplify); DNA polymerase (enzyme that catalyses DNA synthesis), two 'oligonucleotide primers' (small/short pieces of DNA sequences complementary to the target DNA); Nucleotides (dNTPs) (building blocks of DNA); The polymerase uses the oligonucleotide primers and the DNA template to make more DNA this Cycles the temperature (thermocycling) to optimise replication of the DNA. There also other things needed for PCR - 2x Oligonucleotide primers; Building blocks of DNA -- dNTPs : deoxyribonucleotide triphosphate - also, this provides the energy for the reaction. A DNA template - Something for the PCR to get started on for the GST practical, this will be provided for you. Buffer to Correct conditions for the enzyme reaction to occur; Buffered pH at 20 mM Tris HCl (pH 8.4), 50 mM KCl, MgCl~2~^\*^. Lastly, A DNA polymerase, which will add dNTPs onto a growing DNA strand. PCR is a cyclic process requires changes in temperature. Temperature is key to PCR: Conversion of dsDNA to ssDNA (95^o^C), Annealing temperature (^o^C depends on primer sequence), Polymerase -- optimal working temperature. Each step requires a different temperature; Cycle through the temperatures to complete a cycle. Cycle of amplification -- duplication of a DNA sequence. The heating stages are to be repeated to: get another round of amplification; using previously generated PCR products as templates. Stages are repeated \~30 times: Exponential increase of the amount of amplified DNA; Heating is bad for enzymes. DNA Polymerase is an enzyme. Use a polymerase that is able to tolerate high temperatures Isolate a polymerase from an extremophile - *Thermus aquaticus*. Taq polymerase is able to survive at high temps, Catalyses DNA polymerisation at 72^o^C, Revolutionised PCR. At the end of the PCR reaction, you will have many copies of amplified DNA; Need to confirm whether the PCR was successful. ChatGPT's: PCR (Polymerase Chain Reaction) is a technique used for DNA amplification, such as amplifying a specific gene, to create many copies of specific DNA fragments for research or practical applications. PCR is performed in a PCR tube where essential reagents involved in DNA replication are added. These reagents include a DNA template (the sequence to be amplified), DNA polymerase (an enzyme that catalyses DNA synthesis), two oligonucleotide primers (short DNA sequences complementary to the target DNA), nucleotides (dNTPs, the building blocks of DNA, which also provide energy for the reaction), and a buffer to maintain optimal conditions for the enzyme reaction. The buffer typically contains 20 mM Tris HCl (pH 8.4), 50 mM KCl, and MgCl₂. PCR is a cyclic process that relies on temperature changes, known as thermocycling. The key steps include denaturation (conversion of double-stranded DNA to single-stranded DNA at 95°C), annealing (primers binding to the target DNA, with the temperature depending on the primer sequence), and extension (DNA polymerase synthesizing new DNA strands at 72°C). These steps are repeated approximately 30 times, leading to an exponential increase in the amount of amplified DNA. During this process, previously generated PCR products serve as templates for subsequent cycles. Heating can denature most enzymes, but PCR utilizes Taq polymerase, an enzyme isolated from the extremophile *Thermus aquaticus*, which can withstand high temperatures and catalyses DNA polymerization at 72°C. This innovation revolutionized PCR technology. At the end of a PCR reaction, many copies of the amplified DNA are produced, and techniques such as gel electrophoresis are used to confirm the success of the reaction. **[Oligonucleotide primers]** State characteristics of oligonucleotides. : Short (20ish base pairs) single stranded DNA fragments; Complementary to a region at one of the extremities of the DNA you want to amplify; One per DNA strand; Define the ends (termini) of the PCR product; Defines how long the PCR product will be. Oligonucleotide primers only bind to singe stranded DNA because they Need to convert dsDNA into single strand and Heat to 95^o^C -- disrupt the hydrogen bonds Why are oligonucleotides complementary? : Oligonucleotide primers need to be complementary to the ends of the DNA sequences that they are going to amplify - Buy them from the oligonucleotide shop! (ie you need to know the sequence). Taq polymerase will bind to the primer and initiate DNA polymerisation. Where does DNA amplification occur? : DNA amplification occurs in a 5' to 3' orientation. **[Oligonucleotide Primer Annealing Temperature]** **[Primer Sequence Requirements]** - **Specificity of Sequence:**\ The primer sequence must match the target DNA sequence to ensure specific binding.\ Example sequence: **ATGAACAATCCGTCAGAAACCAGT** - **Short primers** are not specific enough and may bind to unintended regions in the DNA template. - **Long primers** increase specificity but have a higher chance of forming secondary structures like hairpins or dimers, and they require higher melting temperatures. **[Structural Considerations for Primer Design]** - **Absence of Dimerization Capability:**\ Primers should not bind to themselves (self-dimers) or to each other (primer-dimers), as this can prevent them from binding to the target DNA. - **Absence of Significant Hairpin Formation:**\ Hairpins occur when complementary regions within the primer bind to each other, forming a loop structure. Significant hairpins (usually with \>3 base pairs) can hinder the primer's ability to bind the target sequence. - **Avoid Secondary Priming Sites:**\ Primers should not have regions that bind to unintended locations in the DNA template. This ensures amplification of only the desired DNA sequence. **[Melting Temperature (Tm)]** - **Definition:**\ Tm is the temperature at which 50% of the primer is bound (annealed) to the target DNA, and 50% is free in solution. - **Calculation:**\ The Tm of a primer can be estimated using the formula:\ **Tm = 2 × (A + T) + 4 × (G + C)** - Guanine (G) and cytosine (C) form **three hydrogen bonds (3 H-bonds)**, making their interactions stronger and more stable. - Adenine (A) and thymine (T) form **two hydrogen bonds (2 H-bonds)**, making their interactions relatively weaker. **[Primer GC Content]** - The GC content of a primer is critical because it affects both the stability of the primer and its melting temperature. - A higher GC content increases stability and Tm due to the **three hydrogen bonds** between G and C. - Primers often include a **GC clamp**, which is a guanine or cytosine base at the 3\' end of the primer. This improves binding stability at the target site. **[Annealing Temperature (Ta)]** - **Definition:**\ The annealing temperature is the temperature used during the annealing step of PCR, where primers bind to the single-stranded DNA template. - **Relation to Tm:**\ The annealing temperature is typically set **5°C below the Tm** of the primer to ensure efficient and specific binding. **[Why Primer Annealing Temperature Matters]** The annealing temperature directly influences the specificity and efficiency of primer binding: - **If Ta is too low:**\ Primers may bind non-specifically, leading to unwanted amplification products. - **If Ta is too high:**\ Primers may not bind at all, leading to no amplification. **[Other interesting features of Oligonucleotides]** - They are synthesised artificially - Send a sequence to a company, they synthesis the oligonucleotide and send it back - £5ish per 100nmol - We can dictate the sequence - Make mutations to change the sequence - add pieces of DNA to the ends - This is important for molecular cloning - Need to prepare the oligonucleotides to facilitate cloning #### Synthesis of Oligonucleotides Oligonucleotides are **synthesized artificially** based on the desired sequence. The process involves sending the desired DNA sequence to a company, which then synthesizes the oligonucleotide and sends it back. **Cost:** Approximately **£5 per 100 nmol**. #### Customizable Features The sequence of oligonucleotides can be **dictated** based on the specific requirements of the experiment. - **Mutations:** Specific changes can be introduced to alter the sequence for experimental purposes. - **Extensions:** Additional DNA sequences can be added to the ends of the oligonucleotide. #### Applications in Molecular Cloning - Oligonucleotides play a critical role in **molecular cloning** by facilitating the cloning process. **[DNA: Basic Concepts]** - Base Pairing - Directionality - For DNA and RNA polymerases **[Laboratory Techniques in DNA manipulation]** [**Molecular Cloning:** **Manipulating DNA -- Lecture 2**] [How to analyse the PCR result] At the end of the experiment, we want to be able to see whether it has worked. PCR HAS A HIGH FAILURE RATE. #### Steps to Verify Success 1. **Analyse the PCR Product** - At the end of the experiment, the sample contains a mixture of template DNA and amplified DNA fragments. - Key question: **Is it the correct fragment?** - Verification methods are necessary to confirm. 2. **Assess DNA Fragment Sizes** - Analyse the sizes of the DNA fragments to identify the amplified product. 3. **Gel Electrophoresis** - Use **gel electrophoresis** to separate DNA fragments based on their size. - This technique allows visualization of the DNA bands, confirming the size of the amplified fragment. To analyse a PCR result, you need to be aware that at the end of the experiment, we want to be able to see whether it has worked. But be aware PCR has a high failure rate. There a specific steps to verify the process: 1. Analyse the PCR product : at the end of the experiment, the sample contains a mixture of template DNA and amplified DNA fragments. The key question needs to be considered, 'is it the correct fragment?'. Verification methods are necessary to confirm. 2. Assess DNA fragments; analyse the sizes of the DNA fragments to identify the amplified product. 3. Gel Electrophoresis -- use gel electrophoresis to separate the DNA fragments based on their size. This technique allows visualisation of the DNA bands, confirming the size of the amplified fragment. **[Agarose Gel Electrophoresis]** DNA has a negatively charged phosphate backbone. It will migrate to a positive pole in an electric field (cathode). In a porous gel, smaller DNA fragments will migrate faster than larger fragments. Use agarose gel to separate DNA fragments. DNA has a negatively charged phosphate backbone, which causes it to migrate towards the positive pole (cathode) in an electric field. In a porous gel, smaller DNA fragments migrate faster than larger ones, allowing for effective size-based separation. To achieve this, agarose gel is commonly used to separate DNA fragments during electrophoresis. **[Apply an electric current for \~1 hour]** Need to detect the DNA Use a dye that binds to DNA - A specific stain Gel RED - Intercalates with DNA - Fluoresces under UV light! - Can be easily seen (using a UV light box) See whether you have amplified some of your own DNA HOW DO YOU KNOW IF IT IS THE "CORRECT" SIZE To detect DNA, a dye or specific stain, such as Gel RED, is used. This dye intercalates with DNA and fluoresces under UV light, allowing the DNA to be easily visualized using a UV light box. This technique helps confirm whether DNA amplification has occurred. To ensure the DNA is of the correct size, gel electrophoresis can be used to compare the size of the amplified fragments against a DNA ladder or marker. **[CLONING A GENE]** 1. Identification - GST 2. Isolation of the gene - by PCR 3. Insertion into a suitable 'Vector' - a bacterial expression plasmid 4. Introduction of the Vector/Gene into an organism - *E.coli* **[PCR isolates and amplifies a gene]** - Want to express protein from it. - TRANSCRIPTION TRANSLATION - **How?** - Transcription and translation are complicated - Need to mimic/duplicate these processes - **Need to provide** - Promotor signals (transcription) - RNA polymerase (transcription) - Ribosomes (translation) - **Need to mimic these processes in the lab!** PCR is used to isolate and amplify a specific gene with the ultimate goal of expressing the protein encoded by it. This involves transcription and translation, which are complex biological processes that need to be mimicked or duplicated in the lab. To achieve this, certain components are essential, including promoter signals and RNA polymerase for transcription, as well as ribosomes for translation. By replicating these processes in a laboratory setting, the gene can be successfully expressed as a protein. **[Cloning vector]** After isolating and amplifying a specific gene through PCR, the next step is to insert it into a suitable cloning vector, such as an expression vector or plasmid. These vectors are circular pieces of DNA that contain essential promoters, genes, and sequences necessary for gene expression. There are various types of cloning vectors available, including examples like pBluescript KS+, each designed for specific purposes in molecular biology experiments. **[pBluescript KS+]** Provides: - Ori (origin of replication) - Promoter , T7 - Bacterial promotor, 18 base pairs long - Recognized by T7 RNA polymerase - LacZ gene - Encodes beta-galactosidase - Cleaves lactose into glucose + galactose - Antibiotic resistance gene - Ampicillin - Multiple cloning site (MCS) After isolating and amplifying a specific gene through PCR, the next step is to insert it into a suitable cloning vector, such as an expression vector or plasmid. These vectors are circular pieces of DNA that contain essential promoters, genes, and sequences necessary for gene expression. There are various types of cloning vectors available, including examples like pBluescript KS+, each designed for specific purposes in molecular biology experiments. Key components include an origin of replication (Ori), which allows the plasmid to replicate within a host cell, and a promoter, such as the T7 bacterial promoter. The T7 promoter, an 18-base-pair sequence, is specifically recognized by T7 RNA polymerase to initiate transcription. Additionally, the vector may contain a LacZ gene, which encodes beta-galactosidase, an enzyme that cleaves lactose into glucose and galactose. This is often used as a reporter for successful cloning. Antibiotic resistance genes, such as the ampicillin resistance gene, are also included to enable the selection of successfully transformed cells. Finally, a multiple cloning site (MCS) provides a region containing numerous restriction enzyme recognition sites, allowing the easy insertion of the target gene into the plasmid. **[Antibiotic resistance gene]** - We are eventually going to grow bacteria on plates - Want to be able to ensure that the only bacteria that grow are ones that contain pBluescript - Antibiotic resistance gene: - Bla Gene - Breaks down ampicillin - Include ampicillin in the growth medium - Only bacteria containing pBluescript will survive and grow - All others will die off After inserting the amplified gene into the cloning vector, the next step is to grow bacteria on agar plates to propagate the plasmid. To ensure that only bacteria containing the pBluescript plasmid grow, the vector includes an antibiotic resistance gene, such as the Bla gene. This gene encodes an enzyme that breaks down ampicillin, an antibiotic commonly included in the growth medium. As a result, only bacteria that have successfully taken up the plasmid will survive and form colonies, while all others will die off due to the presence of ampicillin. This selective pressure ensures that the bacterial population consists solely of plasmid-containing cells, which can then be used for further experiments. **[T7 promotor and Lac Z gene]** Bacteria containing pBluescript have the T7 promotor and the LacZ gene T7 promotor responds to T7 RNA polymerase - Bacterial polymerase - Lac Z encodes b-galactosidase - Hydrolyses Lactose to glucose and galactose - Also hydrolyses X-Gal to a 5 4' dibromo-4, 4'-chloro-indigo - X-Gal is colourless 5 4' dibromo-4, 4'-chloro-indigo is BLUE Bacteria containing the pBluescript plasmid include the T7 promoter and the LacZ gene. The T7 promoter is specifically recognized by T7 RNA polymerase, a bacterial polymerase that initiates transcription. The LacZ gene encodes the enzyme β-galactosidase, which hydrolyzes lactose into glucose and galactose. Additionally, β-galactosidase can hydrolyze the substrate X-Gal, a colorless compound, into 5,4'-dibromo-4,4'-chloro-indigo, which produces a distinct blue color. This color change provides a visual marker, allowing researchers to easily identify colonies containing the plasmid during screening. **[Outcome]** We want to introduce pBluescript into *E.coli* If pBluescript is in bacteria -- the bacteria turn blue (in the presence of X-Gal); Can be seen in bacterial colonies If pBluescript is present Blue If pBluescript is absent White 'Blue/White Screening' - This is a way of telling us whether bacteria contain pBluescript - Very useful later, during cloning of GST To introduce pBluescript into *E. coli*, a blue/white screening method is employed. This method allows researchers to determine whether the bacteria contain the pBluescript plasmid. In the presence of X-Gal, bacteria with pBluescript produce β-galactosidase, which hydrolyses X-Gal into a blue compound, resulting in blue bacterial colonies. In contrast, bacteria without pBluescript remain white, as they lack the LacZ gene encoding β-galactosidase. This simple yet effective screening technique is particularly useful in later stages of cloning, such as when working with GST. **PLAN...** 1. We want to engineer pBluescript, so that it contains our PCR product (GST) - 'insert' the GST gene into pBluescript 2. Then we can introduce pBluescript into bacteria (*E.coli*) 3. The *E.coli* will then 'instruct' pBluescript to start transcribing GST mRNA 4. The *E.coli* will then translate the mRNA into protein We aim to engineer pBluescript by inserting our PCR product, the GST gene, into it. Once this modification is complete, we will introduce the pBluescript vector into *E. coli* bacteria. The bacteria will then direct the pBluescript to begin transcribing the GST gene into mRNA. Finally, the *E. coli* will translate this mRNA into the GST protein. **[How to engineer pBluescript, so that it contains our PCR product (GST)]** Need to cut open the pBluescript DNA Stick in the GST Gene Tools to do this - DNA cutting enzymes (Restriction enzymes) - DNA sticking enzyme (DNA ligase) Need to identify the site in pBluescript that we can cut MCS within the b-Galactosidase gene - Contains 'restriction enzyme sites' To engineer pBluescript to contain our PCR product (GST), we first need to cut open the pBluescript DNA and insert the GST gene. This process requires specific tools: DNA cutting enzymes, known as restriction enzymes, and a DNA ligase enzyme to stick the DNA together. To identify where to cut, we will focus on the Multiple Cloning Site (MCS) within the β-galactosidase gene, which contains several restriction enzyme sites that facilitate the insertion of the GST gene. **[What is a Restriction Enzyme?]** **Definition:** Restriction enzymes are DNA-cutting enzymes that bind to DNA in a sequence-specific manner. **Key Characteristics:** - Bind to DNA and cut both strands. - Recognize specific sequences (6-10 base pairs, usually inverted palindromes). **Types of Restriction Enzymes:** - **BamHI:** GGATCC - **HindIII:** AAGCTT - **NotI:** GCGGCCGC - **EcoRI:** GAATTC - **EcoRV:** GATATC - **PstI:** CTGCAG **Example:** DNA sequence recognition by BamHI: - 5\' GGATCC 3\' - 3\' CCTAGG 5\' Restriction enzymes are DNA-cutting enzymes that recognize and bind to specific DNA sequences, usually inverted palindromes that are 6-10 base pairs long. Once bound, they cut both strands of the DNA. Examples include BamHI (recognizing GGATCC), HindIII (AAGCTT), NotI (GCGGCCGC), EcoRI (GAATTC), EcoRV (GATATC), and PstI (CTGCAG). For instance, BamHI recognizes the sequence 5\' GGATCC 3\' and cuts the DNA at this site, which is mirrored in the complementary strand as 3\' CCTAGG 5\'.  **[Restriction enzymes: Blunt Ends]** - Some enzymes cut DNA leaving base pairs at the cut site - Blunt ended digestion - No free H bonds Restriction enzymes can cut DNA in a manner that leaves base pairs at the cut site, resulting in what is known as blunt-ended digestion. Unlike sticky ends, blunt ends do not have any free hydrogen bonds, making it more challenging for them to anneal with complementary sequences without the aid of additional chemical processes. These blunt ends are created when the enzyme cuts straight through both strands of the DNA, leaving no overhangs or single-stranded regions. **[Restriction enzymes: Sticky Ends]** Some restriction enzymes cut 'off centre' -- not in the middle of the restriction sequence Results with a DNA molecule with non-overlapping bases - Free H-bonds Assigned to a specific number and sequence of base pairs 'Sticky ends' -- they need to base-pair with something Eg BamHI - Recognition sequence: GGATCC - Enzyme will cut after the first G G/GATCC - Because the recognition sequence is an inverted palindrome -- non-equivalent cuts on the different strands Some restriction enzymes cut DNA 'off centre,' meaning not in the middle of the restriction sequence. This results in a DNA molecule with non-overlapping bases and free hydrogen bonds, creating what are known as 'sticky ends.' These sticky ends need to base-pair with complementary sequences to stabilize. Each sticky end is specific to a particular number and sequence of base pairs. For example, BamHI recognizes the sequence GGATCC and cuts after the first G (G/GATCC). Since the recognition sequence is an inverted palindrome, the cuts on the different strands are non-equivalent, which causes the ends to be 'sticky.'  **[Important - implications for cloning]** - Generating a recombinant molecule - sticking two DNA strands together - Efficient of the two ends are in close proximity - Sticky ends are likely to H bond together - Easily join these together - LIGASE When cloning, the creation of a recombinant molecule involves joining two DNA strands together. This process is more efficient if the two ends are in close proximity. Sticky ends, which are the result of restriction enzyme cuts, are likely to form hydrogen bonds with each other. These sticky ends can be easily joined together using an enzyme called ligase, which facilitates the bonding process. **[DNA Ligase]** Catalyses the formation of a phosphodiester bond between - 5\'-phosphate and 3\'-hydroxyl termini of DNA strands - 'Ligation' DNA ligase catalyses the formation of a phosphodiester bond between the 5\'-phosphate and 3\'-hydroxyl termini of DNA strands in a process called ligation. This enzyme plays a crucial role in joining DNA strands together, ensuring the integrity and continuity of the DNA molecule during processes such as replication, repair, and recombinant DNA technology.  **[Blunt ends do not H bond]** - Less likely to join two strands together - Therefore, we generally use sticky end restriction enzymes in cloning **[Compatibility of ends]** If you cut 2 DNA molecules with the same sticky ended restriction enzyme... - The two ends will have compatible sequences - Same number of free base pairs Can easily use sticky ends to join two DNA molecules together **[Therefore, to join two DNA molecules together]** - Use the same restriction enzyme - **However** -- consider pBluescript - We want to cut pBluescript - so that we can insert the GST gene - Use a sticky ended restriction enzyme - After cutting, the two cut ends will H bond together - We still just be re-joining the circle together **[Solution]** - Use two non-compatible restriction enzymes - HindIII and BamHI - This will cut a small region (30bp) out of pBluescript - pBluescript will be unable to ligate itself back together - Restriction enzymes cut within the MCS to linearise the plasmid - We can the 'insert' our GST into the cut site **[However!!]** - The GST gene does not have BamHI and HindIII restriction sites at either end - Not compatible -- will not ligate together! - We need to engineer the PCR product to include BamHI and HindIII sites **[Once pBluescript is cut, we want to stick our PCR product (GST) into the gap we have made]** - We need to prepare the PCR product, so that it will fit. - We cut pBluescript with BamHI and HindIII. - Therefore, we will cut the PCR product with the same enzymes, to make the ends compatible **[Need to engineer the GST gene to have BamHI and HindIII sites at either end]** - We can do this at the PCR stage - When we are synthesising the PCR product - Add sections of DNA to either end by designing the oligonucleotide primers - Bit complicated to explain -- so have a look at the following schematic! **[Treat the PCR product in the same way as the pBluescript expression vector]** - Treat with HindIII and BamHI - This will generate 'compatible ends' - i.e. ends that will hydrogen bond together - We make the joining permanent by adding a 'DNA ligase' - This will generate a phosphodiester bond Blunt ends do not form hydrogen bonds, making them less likely to join two DNA strands together. Therefore, sticky end restriction enzymes are generally used in cloning. When two DNA molecules are cut with the same sticky-ended restriction enzyme, the resulting ends will have compatible sequences and the same number of free base pairs, making it easy to join them together. To join two DNA molecules, the same restriction enzyme should be used. However, when considering pBluescript for cloning the GST gene, a sticky-ended restriction enzyme is used to cut pBluescript. This allows the two cut ends to hydrogen bond together, but simply rejoining the circle is not the goal. The solution is to use two non-compatible restriction enzymes, such as HindIII and BamHI, to cut a small region (30bp) out of pBluescript, preventing it from ligating itself back together. This cut creates a site to insert the GST gene. However, the GST gene does not have BamHI and HindIII restriction sites at either end, making it incompatible for ligation. To solve this, the PCR product needs to be engineered to include BamHI and HindIII sites. Once pBluescript is cut with BamHI and HindIII, the PCR product (GST) must be prepared by cutting it with the same enzymes to make the ends compatible. By engineering the GST gene to have BamHI and HindIII sites at either end, it can fit into the gap created in pBluescript. At the PCR stage, sections of DNA are added to either end by designing the oligonucleotide primers. The PCR product is treated in the same way as the pBluescript expression vector, using HindIII and BamHI to generate compatible ends. Finally, DNA ligase is added to make the joining permanent by generating a phosphodiester bond. **[How can we test/screen for the correct version?]** - The MCS is WITHIN the LacZ gene - So if you insert a new gene (PCR product) into the MCS... - LacZ will be disrupted - β-Galactosidase will not be expressed - Screen by looking for β-Galactosidase **[How to test whether LacZ is working?]** - Need to express LacZ gene - Provide the vector with signals required for - Transcription - Translation - Best way of doing this - Introduce the vectors into *E.coli* - Work out whether β-galactosidase is being expressed by the *E.coli* **['Introduce' vectors into Bacteria]** - Introduce recombinant DNA into *E.coli* - 'Persuade' *E.coli* to transcribe RNA from the LacZ gene - See whether B-galactosidase is expressed - If it is -- then LacZ is intact -- no GST gene present - If it isn't -- LacZ is disrupted -- GST gene is present To test or screen for the correct version of a recombinant DNA, the MCS (Multiple Cloning Site) is located within the LacZ gene. If a new gene (such as a PCR product) is inserted into the MCS, it disrupts the LacZ gene, preventing the expression of β-Galactosidase. Screening for the presence of β-Galactosidase allows us to determine if the insertion was successful. To test whether the LacZ gene is functioning, the gene needs to be expressed by providing the vector with signals for transcription and translation. This is best achieved by introducing the vectors into E.coli and checking for β-Galactosidase expression. When introducing vectors into bacteria, recombinant DNA is inserted into E.coli, persuading the bacteria to transcribe RNA from the LacZ gene. If β-Galactosidase is expressed, it indicates that the LacZ gene is intact and no GST gene is present. If β-Galactosidase is not expressed, it means that the LacZ gene is disrupted, and the GST gene is present.  **[How to introduce pBluescript/GST into bacteria - Bacterial Transformation]** - Buy some 'competent' bacteria - Receptive to expression vectors - Introduce the expression vector into a population of *E.coli* - Perform a 'Heat shock' - 42^o^C for 90s - **Inefficient** -- not all bacteria will be transformed - Need to get rid of untransformed bacteria **[Multiple problems -- need screening]** 1. Bacteria not transformed 2. Bacteria transformed with pBluescript 3. Bacteria transformed with pBluescript/GST - Lots of features of pBluescript will help here 1. **[Ampicillin resistance gene]** Protects transformed bacteria **Solution =** Grow transformed bacteria on agar plates containing 100µg/mL ampicillin 2. **[β-galactosidase expression]** Identification of the correct bacteria a. Depend on expression of Lac Z If cloning is successful, Lac Z gene will be disrupted If it is unsuccessful, Lac Z will be present Therefore, induce expression of Lac Z b. Test whether it is present Lac Z is under the control of the Lac promotor Use IPTG to induce expression Therefore include IPTG in the agar plate Make it available to the bacteria 3. **[Blue white screening]** Include X-Gal in the agar plate c. Bacteria that express β-galactosidase blue d. Bacteria that do not white To introduce pBluescript/GST into bacteria through bacterial transformation, you start by using 'competent' bacteria that are receptive to expression vectors. The expression vector is introduced into a population of E.coli, and a heat shock at 42°C for 90 seconds is performed. This method is inefficient, as not all bacteria will be transformed, so untransformed bacteria need to be eliminated. During screening, three main problems can occur: 1. Bacteria not transformed. 2. Bacteria transformed with pBluescript. 3. Bacteria transformed with pBluescript/GST. Features of pBluescript can help address these issues: 1. **Ampicillin resistance gene:** This gene protects transformed bacteria, so transformed bacteria are grown on agar plates containing 100µg/mL ampicillin. 2. **β-galactosidase expression:** The correct bacteria can be identified by β-galactosidase expression, which depends on the expression of the Lac Z gene. If cloning is successful, the Lac Z gene will be disrupted; if unsuccessful, Lac Z will be present. To test this, induce the expression of Lac Z using IPTG in the agar plate, as Lac Z is under the control of the Lac promoter. 3. **Blue-white screening:** Include X-Gal in the agar plate. Bacteria that express β-galactosidase will turn blue, while those that do not will remain white. Screen using chemicals! 1. Ampicillin Kills all bacteria without an expression vector 2. IPTG Induces B-Galactosidase expression 3. Xgal substrate for B-Galactosidase (goes blue) **[Molecular Cloning: Protein expression -- Lecture 3]** **[Promoter usage from pBluescript:]** The pBluescript II KS+ plasmid includes two promoters: the Lac promoter and the T7 promoter. The Lac promoter is responsible for the expression of β-galactosidase and responds to IPTG, while the T7 promoter responds to T7 polymerase and is used for GST expression. Here are the key points: 1. **Lac Promoter:** - Responds to IPTG. - Enables the expression of β-galactosidase. 2. **T7 Promoter:** - Responds to T7 polymerase. - Enables the expression of GST. **[If we want to express GST protein]** - Need to use the T7 promotor - T7 promotor is recognised by T7 RNA polymerase - Not present in DH5α *E.coli* - Need to use a bacteria with T7 polymerase **[Cannot use Lac promotor to express GST protein]** - Need to use the T7 promotor - DH5a bacteria do not express T7 - Need to use a bacterium which does - BL21-DE3 - T7 is under the control of a Lac promotor - IPTG will induce T7 expression - Controllable! **[Transform BL21-DE3 *E.coli* with pBluescript]** - Will need to have purified pBluescript/GST DNA - We will be doing this later in trimester - Transform BL21-DE3 *E.coli* with pBluescript/GST - Heat shock as before **[Use BL21-DE3 *E.coli* for protein expression ]** - Induce protein expression - IPTG which induces expression of T7 RNA polymerase **Need to repeat bacterial transformation with BL21-DE3** **No need to use X-Gal -- not doing Blue/White screening** The pBluescript II KS+ plasmid includes two promoters: the Lac promoter, responsible for the expression of β-galactosidase in response to IPTG, and the T7 promoter, which responds to T7 polymerase and is used for GST expression. To express the GST protein, the T7 promoter is required, as it is recognized by T7 RNA polymerase, which is not present in DH5α E.coli. Therefore, bacteria that contain T7 polymerase, such as BL21-DE3, must be used. The T7 promoter is under the control of a Lac promoter, and IPTG can induce T7 expression, making it controllable. For transformation, BL21-DE3 E.coli should be used with purified pBluescript/GST DNA, and a heat shock process similar to before is applied. Using BL21-DE3 E.coli for protein expression involves inducing protein expression with IPTG, which induces T7 RNA polymerase expression. The bacterial transformation needs to be repeated with BL21-DE3, and there is no need to use X-Gal, as blue/white screening is not required. **[Protein Expression]** - Pick a colony - BL21-DE3/pBluescript/GST - Use it to inoculate LB growth medium - Allow to grow for 24 hours - IPTG treatment to induce T7 expression - Allow expression for 3-6 hours - You should now have lots of GST protein in your bacteria - Confirm expression using SDS-PAGE **[SDS-PAGE - SDS-Polyacrylamide gel electrophoresis]** - Lyse bacterial cells - Incubate with SDS and a reducing agent **[Run gel at \~150V for \~1 hour]** - Smaller proteins will migrate quicker - Larger proteins will migrate slower - Can't see the proteins! - Stain with Coomassie blue - Use bioinformatics to predict the MW of GST - Look for it on the Gel For protein expression, pick a colony of BL21-DE3/pBluescript/GST and use it to inoculate LB growth medium. Allow the bacteria to grow for 24 hours, then treat with IPTG to induce T7 expression and allow the expression to continue for 3-6 hours. This should result in a high amount of GST protein in the bacteria. To confirm expression, use SDS-PAGE (SDS-Polyacrylamide Gel Electrophoresis). Lyse the bacterial cells and incubate them with SDS and a reducing agent. Run the gel at approximately 150V for around one hour, where smaller proteins will migrate quicker and larger proteins slower. Since proteins are not visible, stain the gel with Coomassie blue. Use bioinformatics to predict the molecular weight (MW) of GST and look for it on the gel. the steps for protein expression you provided are indeed a continuation of the experiment involving the pBluescript II KS+ plasmid. The process you\'re following seems to encompass the entire experiment, from transforming E.coli with the pBluescript/GST construct to expressing and confirming the presence of GST protein. Here\'s a summarized overview: 1. **Transform BL21-DE3 E.coli** with the pBluescript/GST plasmid using a heat shock method. 2. **Select colonies** and grow them in LB medium. 3. **Induce T7 promoter** with IPTG to express the GST protein. 4. **Confirm GST protein expression** using SDS-PAGE by lysing the bacteria, running the gel, and staining it to visualize the proteins. [Health and Safety] - All activities are risk-assessed - All activities low low-risk - Only if follow instructions - Use appropriate equipment correctly - Wear PPE - Other specific instructions for a particular experiment **[Basic Lab Rules]** - Be familiar with what you are doing - Always read through instructions carefully before you start - Listen carefully to safety briefings (10min pre-brief before each session) - These are usually at the start of a lab session **so turn up on time!** - If you arrive late, **you may not be allowed into the lab if the safety briefing has been complete** - Take off PPE when leaving the lab **[Your responsibilities]** - You must follow the instructions of academic and technical staff at all times - If you are not sure, please ask!! - If you are pregnant (or think you might be pregnant) you must inform me or a member of academic staff as soon as possible to produce specific risk assessments **[Molar Calculations]** **[How to work out molar concentrations]** In ALL laboratories, you will need to 1. **Measure out an amount of a substance** 2. **Dissolve it in a solvent (water) to give a KNOWN concentration** 3. **Dilute the solution to give a desired concentration** First step -- basic information about the substance [Concept 1: **Molecular (atomic) Weight (mass)**] - Atomic number = number of protons (top no. on the left) - Atomic mass = n^o^ of protons + n^o^ of neutrons (top no. on the right) - Unit -- Dalton - 1 Da is 1/12^th^ of the mass of C12 - Approximately equal to a Hydrogen atom - Atomic mass is an average of different isotopes - Eg Carbon -- C12, C13, C14 Atomic mass of carbon = 12.0107 Daltons [How to work out Molecular Weights of compounds: **Potassium chloride (KCl)**] - Potassium: K, atomic mass = 39.1 Da - Chloride: Cl, atomic mass = 35.4 Da - 39.1 + 35.4 = 74.5Da **[Table salt: Sodium Chloride (NaCl)]** - Sodium: Na, atomic mass = 22.99 Da - Chloride: Cl, atomic mass = 35.45 Da - NaCl: 22.99 + 35.45 = 58.44 Da **[Ammonia]** - NH~3~ - Nitrogen: N, atomic mass = 14.007 Da - Hydrogen: H, atomic mass = 1.008 Da - 14.007 + (3 x 1.008) = 17.031 Da - That is how to work out molecular weights - What about manipulation of amounts?? [Concept 2: **Amount of a substance: Mole**] - Quantities (amounts) of substances are usually best expressed in 'moles'. - Defined as the number of atoms in 1/12^th^ g of C12 - 1 mol = 6.022x10^23^ atoms - Units: mol - Relationship to atomic mass - H: Atomic mass = 1 - C: Atomic mass = 12 - 1g of Hydrogen = 1 mol - 12g of Carbon = 1 mol **[Concentrations]** - We are bags of fluid - need to consider compounds in solution! - Concentration = the amount of substance dissolved in a fluid - Abundance of compound divided by the volume of the fluid - How do we express concentrations: **Molarity** **[Concept 3: Molarity]** - The molar concentration - Amount per volume - Moles per volume (Litres, L) - Molar (M) 1 M = 1 mol/L - BUT, a mole is a defined amount that weighs the same as the molecular weight (1mol of carbon = 12g) - Therefore: 1M = X g /L Where X is the atomic or molecular weight **[Example from earlier... Sodium Chloride]** - Sodium: Na, atomic mass = 22.99 Da - Chloride: Cl, atomic mass = 35.45 Da 22.99 + 35.45 = 58.442 Da Molecular Weight = 58.44 Da - 1 mol of NaCl = 58.44 g (1mol of carbon = 12g) Dilute 58.44 g in 1 L 58.44g/L = 1mol/L = 1M **[Making up stock solutions]** - I want a 10 mL solution of Tris buffered saline (TBS). - I need to make it up every day 50mM Tris 150mM NaCl - I don't want to have to make up 50 mM Tris and 150 mM NaCl from solids every day!! - Takes ages and is boring - Also, what happens when I need a different solution of 100mM Tris/1 mM NaCl? - Much faster: - make up a high concentration **stock** **solution** - Take some of this and dilute it to the required concentration **[Diluting a stock solution to a working concentration]** - Depends on how much of a final (working solution) you need for your experiment - What final concentration of the solution is required **[Examples of stock solutions!]** Sodium chloride: 58.4 Da - 58.4 g/L = 1 M - 58.4 mg/mL = 1 M - 58.4 µg/µL = 1 M - 5.84g/100 mL = 1 M (sensible!) Tris: 121.1 Da - 121.1 g/L = 1 M 60.55g/500 mL = 1 M **[Therefore, you have stock solutions: How do you use them?]** - You need to be able to take some **stock** **solution** and dilute it to a **working** concentration. 1. **Very easy example.** Stock solution concentration = 1 M Working concentration = 0.1 M (100 mM) Very easy -- a 1:10 dilution - i.e. take 1 mL of stock solution, add water to make a final volume of 10 mLs (i.e. add 9 mL of water) - All well and good if it is always going to be this easy! 1. **[Diluting the stock solution (M) to a working concentration]** Example a. You have a bottle of 1M NaCl (stock solution) b. Experiment involves a 50mM NaCl solution in 1mL (working solution) A diagram of a mathematical equation Description automatically generated Break this down c. C~1~ Concentration of the Stock solution d. V~1~ Volume of the stock concentration you are going to required e. C~2~ Concentration of the working solution f. V~2~ Volume of the working solution (final volume) - C~1~ Concentration of the Stock solution 1M - V~1~ Volume of the stock concentration you are going to required ??mL (V~1~) - C~2~ Concentration of the working solution 50mM - V~2~ Volume of the working solution (final volume) 1mL C~1~ x V~1~ = C~2~ x V~2~ 1M x V~1~ mL = 50mM x 1mL 1000mM x V~1~ mL = 50mM x 1mL Rearrange the equation V~1~ mL = 50mM x 1mL 1000mM V~1~ = 0.05mL - Therefore, take 0.05mL (50µL) of NaCl (from the 1M stock bottle) - Make it up to 1mL with water (ie, add 0.950mL) - This will give a solution with a concentration of 50mM NaCl in 1mL **[Percentage solutions]** - Percentages are also given as a concentration - 1% = 1g/100mL 2. **[Diluting the stock solution (%) to a working solution]** Example - You have a bottle of 50% BSA - Experiment involves a 0.25% BSA in 7.5mL (working solution) Break this down - C~1~ Concentration of the Stock solution 50% - V~1~ Volume of the stock solution you are going to required ??% (V1) - C~2~ Concentration of the working solution 0.25% - V~2~ Volume of the working solution (final volume) 7.5mL - C~1~ Concentration of the Stock solution 50% - V~1~ Volume of the stock concentration you are going to required ??mL (V~1~) - C~2~ Concentration of the working solution 0.25% - V~2~ Volume of the working solution (final volume) 7.5mL C~1~ x V~1~ = C~2~ x V~2~ 50% x V~1~ mL = 0.25% x 7.5mL Rearrange the equation V~1~ mL = 0.25% x 7.5mL 50% V~1~ = 0.0375mL - Therefore, take 0.0375mL (37.5µL) of BSA (from the 50% stock bottle) - Make it up to 7.5mL with water (ie, add 7.4625mL) - This will give a solution with a concentration of 0.250% NaCl in 7.5mL