Molecular Analysis Textbook - DNA Library, PCR, Sequencing

BIOL 239 Molecular analysis Textbook 12.1 12.2 10.3 1  Lesson-level learning objectives Explain the steps in DNA library creation, FISH, Southern blot, PCR, Sanger sequencing, and genetic testing Identify the purpose of each m...

BIOL 239 Molecular analysis Textbook 12.1 12.2 10.3 1  Lesson-level learning objectives Explain the steps in DNA library creation, FISH, Southern blot, PCR, Sanger sequencing, and genetic testing Identify the purpose of each major component Predict what would happen if a step was skipped, or a component was missing Interpret results Define key terms 2  Molecular cloning 1. Purify a DNA fragment and insert it into a vector. 2. Transfer the vector with its insert into cells. Copies will be made through replication. Insert into cells 3 Genomic Library Collection of DNA clones that theoretically contains copies of every DNA fragment in the whole genome, inserted into a suitable vector and placed into storage. Purposes: - Finding DNA sequences of interest - Genome sequencing 4 (sometimes) How do you find your DNA of interest from a library? 5  DNA probes - Short single-stranded stretches of DNA - 25 to 1000s of nucleotides in length - Probes must be labeled to visualize - e.g. fluorescent dyes, 32P - Identifies clones that contain complementary DNA * * * 6  Fluorescence in situ hybridization (FISH) Detects nucleic acid sequences by binding fluorescent probes with complementary sequences. in situ means performed on cells or tissues Probe DNA Plasmid or genomic DNA Image: https://www.enzolifesciences.com/science-center/technotes/2019/february/how-to-use-allylamine-dutp-for-fish-dna-probe-labeling?/ FISH with probes that detect sequences of interest in a DNA library. The probe does not have to match the sequence 100%. Image © Kaksonen - http://wiki.biomine.skelleftea.se/biomine/molecular/index_22.htm  Screening Libraries by Hybridization (colony hybridization) Make a labeled probe Plate(s) from the library This one is using radioactivity instead of fluorescence. 9 FISH with probes that detect sequences in specific microbial species  Making DNA probes - Chemical synthesis, or - PCR from a known template using nucleotides with fluorescent dyes 11  Requirements and limitations of hybridization probes The region of complementarity between probe and target sequence must be long enough to allow sufficient hydrogen bonds to provide a cohesive force In general, two single DNA strands that are longer than 50-100 bp will hybridize so long as the extent of their complementarity is more than 80% * * * 12  Southern Blot analysis Uses probes to detect specific sequences from gel electrophoresis Electric current moves charged molecules. DNA has negative charge. The larger the DNA molecule, the more slowly it moves through the gel matrix 13 Southern blot analysis Stain the DNA 14 High-tech, faster Low-tech, slow still good to know in case stuff breaks 15  Southern Blot analysis Add labeled DNA probe View for specific probe gene of interest Result? Many copies of this gene in the genome 16  Polymerase chain reaction (PCR) Method used to make many copies of a DNA sequence Can be visualized using gel electrophoresis Used in research and diagnostics Prenatal genetic testing Testing food for pathogens HIV test  More applications Genetic fingerprinting (forensics, paternity testing) Obtaining DNA fragments for research or genetic engineering Image: https://dna-fingerprinting.fandom.com/wiki/DNA_Fingerprinting Modifications allow for: DNA sequencing RT-PCR qPCR 18  Reagents Template DNA 5’-CGTCGGAATCACATGCCG-3’ TGCAACGTCGGAATCACATGCCGATACGTCTCAGTCGTACTACATGCATCGTCTCTGAAACTGCCTACTTGCACTGAAATGGATTCAGTACG ACGTTGCAGCCTTAGTGTACGGCTATGCAGAGTCAGCATGATGTACGTAGCAGAGACTTTGACGGATGAACGTGACTTTACCTAAGTCATGC 3’-GATGAACGTGACTTTACC-5’ Primers  Reagents Template DNA 5’-CGTCGGAATCACATGCCG-3’ TGCAACGTCGGAATCACATGCCGATACGTCTCAGTCGTACTACATGCATCGTCTCTGAAACTGCCTACTTGCACTGAAATGGATTCAGTACG ACGTTGCAGCCTTAGTGTACGGCTATGCAGAGTCAGCATGATGTACGTAGCAGAGACTTTGACGGATGAACGTGACTTTACCTAAGTCATGC 3’-GATGAACGTGACTTTACC-5’ C Primers A C T T C A G T G A dNTPs T G G  Buffe Reagents r Template DNA 5’-CGTCGGAATCACATGCCG-3’ TGCAACGTCGGAATCACATGCCGATACGTCTCAGTCGTACTACATGCATCGTCTCTGAAACTGCCTACTTGCACTGAAATGGATTCAGTACG ACGTTGCAGCCTTAGTGTACGGCTATGCAGAGTCAGCATGATGTACGTAGCAGAGACTTTGACGGATGAACGTGACTTTACCTAAGTCATGC 3’-GATGAACGTGACTTTACC-5’ C Primers C A C T C A T DNA C G A T Polymera A G T dNTPs se A T G G G  Denature (95- Cycle 98°C) Anneal (variable) Extend (68-72°C) 5’-CGTCGGAATCACATGCCG-3’ TGCAACGTCGGAATCACATGCCGATACGTCTCAGTCGTACTACATGCATCGTCTCTGAAACTGCCTACTTGCACTGAAATGGATTCAGTACG ACGTTGCAGCCTTAGTGTACGGCTATGCAGAGTCAGCATGATGTACGTAGCAGAGACTTTGACGGATGAACGTGACTTTACCTAAGTCATGC 3’-GATGAACGTGACTTTACC-5’ C C A C T C A T C A G T A G T A T G G G  Denature (95- Cycle 98°C) Anneal (variable) Extend (68-72°C) TGCAACGTCGGAATCACATGCCGATACGTCTCAGTCGTACTACATGCATCGTCTCTGAAACTGCCTACTTGCACTGAAATGGATTCAGTACG ACGTTGCAGCCTTAGTGTACGGCTATGCAGAGTCAGCATGATGTACGTAGCAGAGACTTTGACG 3’-GATGAACGTGACTTTACC-5’ C C A C 5’-CGTCGGAATCACATGCCG-3’ ATACGTCTCAGTCGTACTACATGCATCGTCTCTGAAACTGCCTACTTGCACTGAAATGGATTCAGTAC T C A ACGTTGCAGCCTTAGTGTACGGCTATGCAGAGTCAGCATGATGTACGTAGCAGAGACTTTGACGGATGAACGTGACTTTACCTAAGTCATG G T C A G T A G T A T G G G  Denature (95- Cycle 98°C) Anneal (variable) Extend (68-72°C) TGCAACGTCGGAATCACATGCCGATACGTCTCAGTCGTACTACATGCATCGTCTCTGAAACTGCCTACTTGCACTGAAATGGATTCAGTACG ACGTTGCAGCCTTAGTGTACGGCTATGCAGAGTCAGCATGATGTACGTAGCAGAGACTTTGACGGATGAACGTGACTTTACC CGTCGGAATCACATGCCGATACGTCTCAGTCGTACTACATGCATCGTCTCTGAAACTGCCTACTTGCACTGAAATGG CGTCGGAATCACATGCCGATACGTCTCAGTCGTACTACATGCATCGTCTCTGAAACTGCCTACTTGCACTGAAATGGATTCAGTAC GCAGCCTTAGTGTACGGCTATGCAGAGTCAGCATGATGTACGTAGCAGAGACTTTGACGGATGAACGTGACTTTACC ACGTTGCAGCCTTAGTGTACGGCTATGCAGAGTCAGCATGATGTACGTAGCAGAGACTTTGACGGATGAACGTGACTTTACCTAAGTCATG G CGTCGGAATCACATGCCATAACGTCTCAGTCGTACTACATGCATCGTCTCTGAAACTGCCTACTTGCACTGAAATGGATTCAGTACG Exponential Amplification Exponential Amplification  Polymerase Chain Reaction (PCR) Each cycle of PCR results in duplication of the strands - exponential 27  DNA Sequencing Current sequencing technologies based on PCR  Sanger Method Older method Used for smaller sequences (not whole genomes) Combines chain termination with fluorescent labeling Image from Great Lakes Genomics Center, http://greatlakesgenomics.uwm.edu/equipment/3730- DNA Polymerase connects the 3' OH to the next nucleotide at 5’ phosphate α (kicks off phosphates β and γ)  Sequencing uses chain termination DNA Polymerase connects the 3' OH to the next nucleotide at 5’ phosphate α Strand can not elongate without 3' OH group  Sequencing uses fluorescent labeling Each ddNTP labeled with a different colour – ddATP ddCTP ddGTP ddTTP dNTPs are not labeled The ID of the last base can be determined Sequencing process 5’-ATCGTCATGTGACCTAAGTCGACGATTGCGCGATGAGTCAGTATCAG-3’ 3’-TAGCAGTACACTGGATTCAGCTGCTAACGCGCTACTCAGTCATAGTC-5’ Template DNA DNA polymerase 5’-ATCGTCATGTGACCT-3’ 5’-ATCGTCATGTGACCT-3’ 5’-ATCGTCATGTGACCT-3’ primer dNTPs C T T T G T G T G A G ddNT A C A C G C A A C T A Ps C 5’-ATCGTCATGTGACCTAAGTCGACGATTGCGCGATGAGTCAGTATCAG-3’ 3’-TAGCAGTACACTGGATTCAGCTGCTAACGCGCTACTCAGTCATAGTC-5’ 5’-ATCGTCATGTGACCT-3’ 5’-ATCGTCATGTGACCT-3’ 5’-ATCGTCATGTGACCT-3’ C T T T G T G T G A G A C A C G C A A C T A C 5’-ATCGTCATGTGACCTAAGTCGACGATTGCGCGATGAGTCAGTATCAG-3’ 3’-TAGCAGTACACTGGATTCAGCTGCTAACGCGCTACTCAGTCATAGTC-5’ 5’-ATCGTCATGTGACCT 5’-ATCGTCATGTGACCT-3’ 5’-ATCGTCATGTGACCT-3’ C T T T G T G T G A G A C A C G C A A C T A C 5’-ATCGTCATGTGACCTAAGTCGACGATTGCGCGATGAGTCAGTATCAG-3’ 3’-TAGCAGTACACTGGATTCAGCTGCTAACGCGCTACTCAGTCATAGTC-5’ 5’-ATCGTCATGTGACCTAAGTCGACGATT 5’-ATCGTCATGTGACCT-3’ 5’-ATCGTCATGTGACCT-3’ C T G T G A C C A C T 5’-ATCGTCATGTGACCTAAGTCGACGATTGCGCGATGAGTCAGTATCAG-3’ 3’-TAGCAGTACACTGGATTCAGCTGCTAACGCGCTACTCAGTCATAGTC-5’ 5’-ATCGTCATGTGACCTAAGTCGACGATTGCGCGATGAGTC 5’-ATCGTCATGTGACCT 5’-ATCGTCATGTGACCTAAGTCGACGATTGCGCGATGAGTCAGTATCAG 5’-ATCGTCATGTGACCTAAGTCGACGATTGCGCGATGAGTCAG 5’-ATCGTCATGTGACCTAAGTCGACGATTGC 5’-ATCGTCATGTGACCTAAGTCGACGATTGCGCGATGAGT 5’-ATCGTCATGTGACCTAAGTCGACGA 5’-ATCGTCATGTGACCTAAGTCGACGATTGCGCGATGAGTCAGTATC 5’-ATCGTCATGTGACCTAAGTCGACGATT 5’-ATCGTCATGTGACCTAAGTCGACGATTGCGCGA 5’-ATCGTCATGTGACCTAAGTC 5’-ATCGTCATGTGACCTAAGTCGACGATTGCGCGATGAG 5’-ATCGTCATGTGACCTAAGTCGACGATTGCGC 5’-ATCGTCATGTGACCTAAGTCGACGATTGCGCGATGAGTCAGTAT 5’-ATCGTCATGTGACCTAAGTCGA 5’-ATCGTCATGTGACCTAAGTCGACGATTGCGCGATGAGTCAGTATCA Incorporation of the ddNTP is random End up with a mixture of strand lengths, each ending where the ddNTP has been incorporated 39 Capillary electrophoresis (like gel electrophoresis, but in a thin tube) Reaction products separated by size Each fragment size has a fluorescent label 5’-ATCGTCATGTGACCTAATCG 5’-ATCGTCATGTGACCTAATC 5’-ATCGTCATGTGACCTAAT 5’-ATCGTCATGTGACCTAA 5’-ATCGTCATGTGACCTA Image from Evonne Leeper,  Output Sequence chromatogram – Results Text file – Computer’s interpretation – Errors common near the start and end Image from  Output Examine the chromatogram Evenly- spaced peaks Baseline noise Image from  What is the same and different? Similarities Differences Both PCR PCR only Sequencing Reagents and only sequencing Equipment Reagents Products Equipment Results Products Results (Why is each difference necessary?) Scenario 1: 2 parents, both carriers of the sickle-cell allele, want to know the genotype of their newest baby PCR amplification of 500 bp fragment of interest in -globin gene followed by Sequencing 44 Wild-type allele Sickle cell allele 45 Scenario 2: 2 parents, both carriers of CF allele, wish to avoid having a child with CF 46 Preimplantation genetic testing 47  Preimplantation genetic testing * (allele-specific oligonucleotide) wildtype probe mutant probe Diploid remember! 48  Lesson-level learning objectives Explain the steps in DNA library creation, FISH, Southern blot, PCR, Sanger sequencing, and genetic testing Identify the purpose of each major component Predict what would happen if a step was skipped, or a component was missing Interpret results Define key terms 49